-- dump date 20120504_152750 -- class Genbank::repeat_region -- table repeat_region_note -- id note 572418000001 101 bp Mycobacterial Interspersed Repetitive Unit,Class I. See Supply et al. (1997) Molecular Microbiology 26, 991-1003 572418000002 5 x 9 bp GTGGACCCG repeats 572418000003 (MTV030.15), len: 315 bp. REP'-1 pseudogene fragment, similar to many Mycobacterium tuberculosis proteins inside REP13E12 elements e.g. Q50655|Z95390|MTCY13E12.20 (317 aa), FASTA scores; opt: 324 E(): 6.8e-17, 43.4% identity in 99 aa overlap, but no startsite 572418000004 REP-2, len: 1503 bp. REP251, member of REP13E12 family 572418000005 53 bp Mycobacterial Interspersed Repetitive Unit,Class III. See citation below 572418000006 53 bp Mycobacterial Interspersed Repetitive Unit,Class II 572418000007 53 bp Mycobacterial Interspersed Repetitive Unit,Class II 572418000008 39 bp direct repeat 1,AGGTGAAGGCGGCGGATTCGGCGGAATCTGACGCCGGAG 572418000009 39 bp direct repeat 2,AGGTGAAGGCGGCGGATTCGGCGGAATCTGACGCCGGAG 572418000010 101 bp Mycobacterial Interspersed Repetitive Unit,class III 572418000011 3 copies of a 10 bp near-perfect direct repeat,ATTACTACCTATTACTACGTATTACTATCT 572418000012 77 bp Mycobacterial Interspersed Repetitive Unit,Class I. See citation below 572418000013 51 bp Mycobacterial Interspersed Repetitive Unit,Class II 572418000014 58 bp Mycobacterial Interspersed Repetitive Unit,Class III 572418000015 123 bp imperfect direct repeat 2, 92/103 bp identical to first copy at 709425..709548, AGCCCCGGCTCGACGCGGCATAGGGTGGCCACCGTGGCCGAAGCGTTCCATGCGACC GTGCCGTGGCGAGGATCCCGGCCGAACATGGCCCATTGAACGAGGACGTCATCGCAC GACGCCTGC 572418000016 IS1536, len: 1384 bp. Partial copy of insertion sequence IS_1536 572418000017 74 bp imperfect direct repeat 2, 64/73 bp identical to first copy at 706790..706863, CACAGCGGACACCACAAAGCCCGCCGCTGCCACCGGATCGTCGGAACGAAAATAGTC GTACCCGTGAGCCTCGC 572418000018 74 bp imperfect direct repeat 1, 64/73 bp identical to second copy at 703912..703985, CACATCGGACACGACGAAACCCGCCGCTGCCACCGGATCGTCGGAGCGGAAGTAGTC GTACCCGTCGGCCTCGC 572418000019 123 bp imperfect direct repeat 1, 92/103 bp identical to second copy at 701247..701369, AGCCTCGGCTGGCCGCGGCATAAGGTGGCCACCGTGGCCGAAGCGTTCGATGCGACC CAAGCCGTGGCGAGAATCCTGGCCGAACATGGCCCATTGAGCGAGGACGACATCGCA CGACGCCTGC 572418000020 79 bp imperfect direct repeat 1, 73/78 bp identical to second copy at 711624..711702, TAGGGTTCGGCGTTGTGACGGCGCCGACGCGGTGGACCCTGGCCGACGGACGTGAGC TGCTGTTCTTTTCGCTGCCCGG 572418000021 79 bp imperfect direct repeat 2, 73/78 bp identical to first copy at 709585..709663, TAGGGTTCTGCGTTGTGACGGCGCCGACGCGGTGGACCCTGGCCGATGGCCGTGACC TGCTGTTCTTTTCGCTGCCCGG 572418000022 52 bp Mycobacterial Interspersed Repetitive Unit,Class II 572418000023 49 bp Mycobacterial Interspersed Repetitive Unit,Class II 572418000024 87 bp Mycobacterial Interspersed Repetitive Unit,Class III 572418000025 54 bp Mycobacterial Interspersed Repetitive Unit,Class II 572418000026 IS1557'-1, len: 517 bp. Region similar to Insertion sequence IS1557 on MTCY373- (IS1557- 1st copy) 572418000027 101 bp Mycobacterial Interspersed Repetitive Unit,Class I 572418000028 IS1605', len: 288 bp. Insertion sequence IS1605' 572418000029 IS1606', len: 331 bp. Insertion sequence IS1606' 572418000030 51 bp Mycobacterial Interspersed Repetitive Unit,Class II 572418000031 REP-3, len: 1325 bp. REP22G8, member of REP13E12 family 572418000032 REP-4, len: 1348 bp. REP165, member of REP13E12 family 572418000033 62 bp direct repeat copy 1, GGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCA ATCT 572418000034 62 bp direct repeat copy 2, GGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCA ATCT 572418000035 62 bp direct repeat partial copy 3 (43/62 bp),GGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGGGGCCCG 572418000036 43 bp Mycobacterial Interspersed Repetitive Unit,Class III 572418000037 52 bp Mycobacterial Interspersed Repetitive Unit,Class III 572418000038 53 bp Mycobacterial Interspersed Repetitive Unit,Class II 572418000039 IS1557-2, len: 1509 bp. Insertion sequence IS1557 572418000040 51 bp Mycobacterial Interspersed Repetitive Unit,Class II 572418000041 21 bp imperfect direct repeat 5,GGCGCACCGGTACCGGTACCC 572418000042 21 bp imperfect direct repeat 4,GGCGGACCGGTACCGATACCG 572418000043 21 bp imperfect direct repeat 2,GGCGCACCGGTACCGATACCG 572418000044 53 bp Mycobacterial Interspersed Repetitive Unit,Class II 572418000045 1260 bp imperfect direct repeat 2, first copy at 1637133..1638392 572418000046 1260 bp imperfect direct repeat 1, second copy at 1633531..1634790 572418000047 53 bp Mycobacterial Interspersed Repetitive Unit,Class II 572418000048 51 bp Mycobacterial Interspersed Repetitive Unit,Class II 572418000049 REP-5, len: 1298 bp. REP336, member of REP13E12 family 572418000050 52 bp Mycobacterial Interspersed Repetitive Unit,Class II 572418000051 56 bp direct repeat 1, AGTCGGGTGACGATGCGGGCCGGTGTGGTCCGAGGAGGAGCCCGACAATTTAAGCT 572418000052 56 bp direct repeat 2, AGTCGGGTGACGATGCGGGCCGGTGTGGTCCGAGGAGGAGCCCGACAATTTAAGCT 572418000053 REP-6, len: 1372 bp. REPI125, member of REP13E12 family 572418000054 53 bp Mycobacterial Interspersed Repetitive Unit,Class II 572418000055 53 bp Mycobacterial Interspersed Repetitive Unit,Class II 572418000056 78 bp imperfect direct repeat 5, CGGCGCCTTCAGCCTGCCCGGGTTGACGTTGCCGTCGTTGAACATCCCGGCCGCCACC ACACCAGCCAACATCACCGT 572418000057 78 bp imperfect direct repeat 6, CGGCGCCTTCAGCCTGCCCGGGTTGACGTTGCCGTCGTTGAACATCCCGGCCGCCACC ACACCCGCCAACATCACCGT 572418000058 78 bp imperfect direct repeat 2, CGGCGCCTTCAGCCTGCCCGGGTTGACGTTGCCGTCGTTGAACATCCCGGCCGCCACC ACACCAGCCAACATCACCGT 572418000059 78 bp imperfect direct repeat 1, TCCCGCCTTCAGTCTGCCGGCAATAACGCTGCCGTCGCTGAACATCCCGGCCGCCACC ACACCGGCCAACATCACCGT 572418000060 58 bp Mycobacterial Interspersed Repetitive Unit,Class III 572418000061 58 bp Mycobacterial Interspersed Repetitive Unit,Class III 572418000062 69 bp imperfect direct repeat 1, TCGGTCCGATTGTGGTGCCGGATATTACTATTCCTGGTATTCCGTTGAGCCTGAACGC GCTGGGTGGTG 572418000063 REP-7, len: 1362 bp. REP09F9, member of the REP13E12 family 572418000064 79 bp Mycobacterial Interspersed Repetitive Unit,Class I 572418000065 58 bp Mycobacterial Interspersed Repetitive Unit,Class II I. Overlaps Rv2195 suggesting alternative GTG start at 2458 468 may be used 572418000066 58 bp inverted repeat near 3'end of MTCY427.28 572418000067 53 bp inverted repeat between 3' ends of MTCY427.29 and MT CY427.31c 572418000068 53 bp Mycobacterial Interspersed Repetitive Unit,Class II 572418000069 50 bp Mycobacterial Interspersed Repetitive Unit,Class II 572418000070 77 bp Mycobacterial Interspersed Repetitive Unit,Class I 572418000071 300 bp direct repeat copy 1 572418000072 300 bp direct repeat copy 2 572418000073 248 bp direct repeat 2 572418000074 258 bp direct repeat 2 572418000075 51 bp Mycobacterial Interspersed Repetitive Unit,Class II 572418000076 51 bp Mycobacterial Interspersed Repetitive Unit,Class II 572418000077 51 bp Mycobacterial Interspersed Repetitive Unit,Class II 572418000078 51 bp Mycobacterial Interspersed Repetitive Unit,Class I 572418000079 51 bp Mycobacterial Interspersed Repetitive Unit,Class III 572418000080 36 bp direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 572418000081 36 bp direct repeat, 35 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 572418000082 36 bp direct repeat, 35 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 572418000083 36 bp direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 572418000084 36 bp direct repeat, 35 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 572418000085 36 bp direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 572418000086 36 bp direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 572418000087 36 bp direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 572418000088 36 bp direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 572418000089 36 bp direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 572418000090 20 bp partial direct repeat, CCCCGAGAGGGGACGGAAAC,of sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 572418000091 36 bp direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 572418000092 36 bp direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 572418000093 36 bp direct repeat, 32 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 572418000094 36 bp direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 572418000095 36 bp direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 572418000096 36 bp direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 572418000097 36 bp direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 572418000098 36 bp direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 572418000099 54 bp direct repeat 4,GGTGGCGACCCGCGGCGCCCGGTCCCCGCGCTTGCGATCGCCACTAGGCTTGGC 572418000100 54 bp direct repeat 3,GGTGGCGACCCGCGGCGCCCGGTCCCCGCGCTTGCGATCGCCACTGGCCCTGAT 572418000101 54 bp direct repeat 2,GGTGGCGACCCGCGGCGCCCGGTCCCCGCGCTTGCGATCGCCACTGGCCCTGAT 572418000102 54 bp direct repeat 1,GGTGGCGACCCGCGGCGCCCGGTCCCCGCGCTTGCGATCGCCACTGGCCCTGAT 572418000103 62 bp Mycobacterial Interspersed Repetitive Unit,Class III 572418000104 51 bp direct repeat 1,GTCCGATGGTGGCGACCCGCTGCGCCCGGCTTCGCCGCGCTTGCGATCGCC 572418000105 51 bp direct repeat 2,GTCCGATGGTGGCGACCCGCTGCGCCCGGCTTCGCCGCGCTTGCGATCGCC 572418000106 (41 bp) part of 51 bp direct repeat 3,GGCGACCCGCTGCGCCCGGCTTCGCCGCGCTTGCGATCGCC 572418000107 (43 bp) part of 51 bp direct repeat,GTGTCGACCCGCTGCGCCCGGCTTCGCCGTGCTTGCGATCGCC 572418000108 53 bp Mycobacterial Interspersed Repetitive Unit,Class II 572418000109 53 bp Mycobacterial Interspersed Repetitive Unit,Class II 572418000110 53 bp Mycobacterial Interspersed Repetitive Unit,Class II 572418000111 IS1539, len: 2267 bp. Insertion sequence IS1539 572418000112 55 bp Mycobacterial Interspersed Repetitive Unit,Class III 572418000113 101 bp Mycobacterial Interspersed Repetitive Unit,Class III 572418000114 98 bp Mycobacterial Interspersed Repetitive Unit,Class III 572418000115 77 bp Mycobacterial Interspersed Repetitive Unit,Class I 572418000116 53 bp Mycobacterial Interspersed Repetitive Unit,Class II 572418000117 58 bp Mycobacterial Interspersed Repetitive Unit,Class III 572418000118 110 bp Mycobacterial Interspersed Repetitive Unit,Class III 572418000119 207 bp imperfect direct repeat 1, 199/207 bp identical to second copy at 3769514..3769720 572418000120 109 bp imperfect direct repeat 1, 95/109 bp identical to second copy at 3769754..3769862 572418000121 98 bp imperfect direct repeat 1, 82/98 bp identical to the second copy at 3770994..3771091 572418000122 207 bp imperfect direct repeat 2, 199/207 bp identical to first copy at 3743198..3743404 572418000123 109 bp imperfect direct repeat 2, 95/109 bp identical to first copy at 3743402..3743510 572418000124 98 bp imperfect direct repeat 2, 82/98 bp identical to the first copy at 3743508..3743605 572418000125 25 bp inverted repeat at the right end of IS1560, TAATTACTAGGACCTGAAAAAGTCG 572418000126 25 bp inverted repeat at the right end of IS1560, TAATTACTAAGACCTGAAAAAGTCG 572418000128 500 bp perfect direct repeat 2; second copy at 3950830..3951329 572418000129 500 bp perfect direct repeat 1; second copy at 3945098..3945597 572418000130 58 bp Mycobacterial Interspersed Repetitive Unit,Class III 572418000131 111 bp direct repeat unit 4, GTGGCGACCCGCTGCACCCGGCTCTGGGGTGATTGCCTGGCTCCTCCTCGGCCCGTTT TGCGGGCCGCATTGTCGCCAGGCGCGGGGTTTGCGATCGCCACGGGGCTGATG 572418000132 111 bp direct repeat unit 5, GTGGCGACCCGCTGCACCCGGCTCTGGGGTGATTGCCTGGCTCCTCCTCGGCCCGTTT TGCGGGCCGCATTGTCGCCAGGCGCGGGGTTTGCGATCGCCACGGGGCTGATG 572418000133 (24 bp) part of 111 bp direct repeat unit 6,GTGGCGACCCGCTGCACCCGGCTC 572418000134 111 bp direct repeat unit 2, GTGGCGACCCGCTGCACCCGGCTCTGGGGTGATTGCCTGGCTCCTCCTCGGCCCGTTT TGCGGGCCGCATTGTCGCCAGGCGCGGGGTTTGCGATCGCCACGGGGCTGATG 572418000135 111 bp direct repeat unit 1, GTGGCGACCCGCTGCACCCGGCTCTGGGGTGATTGCCTGGCTCCTCCTCGGCCCGTTT TGCGGGCCGCATTGTCGCCAGGCGCGGGGTTTGCGATCGCCACGGGGCTGATG 572418000136 125 bp Mycobacterial Interspersed Repetitive Unit,Class III 572418000137 53 bp Mycobacterial Interspersed Repetitive Unit,Class II 572418000138 53 bp Mycobacterial Interspersed Repetitive Unit,Class II 572418000139 51 bp imperfect direct repeat 1,GAACCGGCCGCATCTAAACCACCCACACCCCCCATGCCCATCGCCGGACCC 572418000140 51 bp imperfect direct repeat 2,GAACCGGCCCCACCCAAACCACCCACACCCCCCATGCCCATCGCCGGACCC 572418000141 51 bp imperfect direct repeat 3,GAACCGGCCCCACCCAAACCACCCACACCTCCGATGCCCATCGCCGGACCT