-- dump date   	20120504_152751
-- class       	Genbank::repeat_region
-- table       	repeat_region_note
-- id	note
233413000001	REP'-1, len: 315 nt. Equivalent to REP', len: 315 nt, from Mycobacterium tuberculosis strain H37Rv, (100.0% identity in 315 nt overlap). Probable pseudogene fragment, len: 105 aa; similar to many Mycobacterium tuberculosis proteins inside REP13E12 elements eg. TR:Q50655 (EMBL:Z95390) MTCY13E12.20 (317 aa), FASTA scores; opt: 324 z-score: 432.5 E(): 6.8e-17, 43.4% identity in 99 aa overlap, but no possible startsite.
233413000002	REP-2, len: 1504 nt. Equivalent to REP, len: 1503 nt, from Mycobacterium tuberculosis strain H37Rv, (97.0% identity in 1504 nt overlap). REP251, member of REP13E12 family.
233413000003	15 bp perfect inverted repeat, IRR, ATTCGGTGTAAGTGG, flanking IS element IS1554.
233413000004	15 bp perfect inverted repeat, IRL, ATTCGGTGTAAGTGG, flanking IS element IS1554.
233413000005	49 bp imperfect inverted repeat, IRL, GGGTTCAGAGCTGTTGCGTGTTGAGTGTGTTTTAGTGTGCGTTAGTGTG, flanking IS element IS1535.
233413000006	17 bp perfect inverted repeat, IRL, GTTGAGTGTGTTTTAGT, flanking IS element IS1535.
233413000007	49 bp imperfect inverted repeat, IRR, CCGTTGAGTGTGTTTTAGTTGCACTCTCATGCGGCGTCCCCTTTGCGGG, flanking IS element IS1535.
233413000008	17 bp perfect inverted repeat, IRR, GTTGAGTGTGTTTTAGT, flanking IS element IS1535.
233413000009	15 bp perfect inverted repeat, IRL, TCGCGTGATCCTTCG, flanking IS element IS1081.
233413000010	15 bp perfect inverted repeat, IRR, TCGCGTGATCCTTCG, flanking IS element IS1081.
233413000011	REP-3, len: 1356 nt. Equivalent to REP, len: 1325 nt, from Mycobacterium tuberculosis strain H37RV, (99.9% identity in 1325 nt overlap). REP22G8, member of REP13E12 family.
233413000012	REP-4, len: 1362 nt. Equivalent to REP, len: 1362 nt, from Mycobacterium tuberculosis strain H37Rv, (96.4% identity in 1362 nt overlap). REP165, member of REP13E12 family.
233413000013	4 bp direct repeat, CTAG, generated by IS element on insertion. Proposed by Mariani et al. 1993. J. Gen. Microbiol. 139:1767-1772. Note that as the motif is palindromic it could be part of the inverted repeat itself.
233413000014	17 bp imperfect inverted repeat, IRL, GGCGTGTCTCCCAAATT, flanking  IS element. Proposed by Mariani et al. 1993. J. Gen. Microbiol. 139: 1767-1772.
233413000015	17 bp imperfect inverted repeat, IRR, GGCGTGTCTCCCAATTT, flanking  IS element. Proposed by Mariani et al. 1993. J. Gen. Microbiol. 139: 1767-1772.
233413000016	4 bp direct repeat, CTAG, generated by IS element on insertion. Proposed by Mariani et al. 1993. J. Gen. Microbiol. 139 :1767-1772. Note that as motif palindromic could be part of inverted repeat itself.
233413000017	8 bp direct repeat, TGACACCA, flanking IS element IS1081.
233413000018	15 bp perfect inverted repeat, IRR, TCGCGTGATCCTTCG, flanking IS element IS1081.
233413000019	15 bp perfect inverted repeat, IRL, TCGCGTGATCCTTCG, flanking IS element IS1081.
233413000020	8 bp direct repeat, TGACACCA, flanking IS element IS1081.
233413000021	20 bp imperfect inverted repeat, IRR, AGCAGACGCAAAAGCCCCCA, flanking IS element IS1557.
233413000022	20 bp imperfect inverted repeat, IRL, AGCAGACGCGAAAGCCCCCA, flanking IS element IS1557.
233413000023	REP-5, len: 1363 nt. Equivalent to REP, len: 1298 nt, from Mycobacterium tuberculosis strain H37Rv, (96.6% identity in 1363 nt overlap). REP336, member of REP13E12 family.
233413000024	REP-6, len: 1379 nt. Equivalent to REP, len: 1362 nt, from Mycobacterium tuberculosis strain H37RV, (65.3% identity in 1364 nt overlap). REPI125, member of REP13E12 family.
233413000025	14 bp imperfect inverted repeat, IRR, ATCACCCCGCAAAG, flanking IS element ISB9'.
233413000026	14 bp imperfect inverted repeat, IRL, ATCACCCCGGCAAG, flanking IS element ISB9'.
233413000027	REP-7, len: 1362 nt. Equivalent to REP, len: 1362 nt, from Mycobacterium tuberculosis strain H37Rv, (99.9% identity in 1362 nt overlap). REP09F9, member of the REP13E12 family.
233413000028	13 bp imperfect inverted repeat, IRR, GCAGTCGTAAAAG, flanking IS element IS1558.
233413000029	13 bp imperfect inverted repeat, IRL, GCAGTCGCAAAAG, flanking IS element IS1558.
233413000030	15 bp perfect inverted repeat, IRR, TCGCGTGATCCTTCG, flanking IS element IS1081.
233413000031	15 bp perfect inverted repeat, IRL, TCGCGTGATCCTTCG, flanking IS element IS1081.
233413000032	15 bp perfect inverted repeat, IRL, TCGCGTGATCCTTCG, flanking IS element IS1081.
233413000033	4404 bp DR, direct repeat region composed of 42 repeat_units of 36 bases pairs, one of them has been interrupted by the insertion of an IS6110 elements.
233413000034	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000035	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000036	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000037	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000038	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000039	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000040	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000041	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000042	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000043	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000044	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000045	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000046	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000047	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000048	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000049	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000050	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000051	3' part direct repeat, CCCCGAGAGGGGACGGAAAC, of sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000052	3 bp direct repeat, GGG, flanking IS element IS6110.
233413000053	28 bp perfect inverted repeat, IRR, TGAACCGCCCCGGCAATGTCCGGAGACTC, flanking IS element IS6110.
233413000054	28 bp perfect inverted repeat, IRL, TGAACCGCCCCGGCAATGTCCGGAGACTC, flanking IS element IS6110.
233413000055	3 bp direct repeat, GGG, flanking IS element IS6110.
233413000056	5' part direct repeat, GTCGTCAGACCCAAAA, of sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000057	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000058	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000059	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000060	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000061	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000062	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000063	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000064	direct repeat, 32 out of 36 bp identical to sequence CGGATCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000065	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000066	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000067	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000068	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000069	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000070	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000071	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000072	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000073	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000074	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000075	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000076	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000077	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000078	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000079	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000080	direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC
233413000081	5 bp direct repeat, CCGTT, flanking IS element IS1533.
233413000082	54 bp imperfect inverted repeat, IRL, TGTCGACGGCACGTGAAAACTGACCCCGGCGCGGCACCCGAATTTTGACCCCCT, flanking IS element IS1533.
233413000083	54 bp imperfect inverted repeat, IRR, TGTCAACGGCACCCGAAAACTGACCCCCTGACGGCATCTGAAAATTGACCCCCT, flanking IS element IS1533.
233413000084	5 bp direct repeat, CCGTT, flanking IS element IS1533.
233413000085	6 bp perfect inverted repeat, IRR, TGAGTG, flanking IS element IS1538.
233413000086	6 bp perfect inverted repeat, IRL, TGAGTG, flanking IS element IS1538.
233413000087	8 bp direct repeat, CCAGTCGC, flanking IS element IS1081.
233413000088	15 bp perfect inverted repeat, IRR, TCGCGTGATCCTTCG, flanking IS element IS1081.
233413000089	15 bp perfect inverted repeat, IRL, TCGCGTGATCCTTCG, flanking IS element IS1081.
233413000090	8 bp direct repeat, CCAGTCGC, flanking IS element IS1081.
233413000091	8 bp direct repeat, AGGAGGAG, flanking IS element IS1081.
233413000092	15 bp perfect inverted repeat, IRL, TCGCGTGATCCTTCG, flanking IS element IS1081.
233413000093	15 bp perfect inverted repeat, IRR, TCGCGTGATCCTTCG, flanking IS element IS1081.
233413000094	8 bp direct repeat, AGGAGGAG, flanking IS element IS1081.
233413000095	63 bp imperfect inverted repeat, IRR, TGTCAGCGGCAACCGAAAACTGATCAGGTGTCGGCAAGGTGGTTTCTAGGCGGTGTCG C AACA, flanking IS element IS1603.
233413000096	63 bp imperfect inverted repeat, IRL, TGTCGGCGGCAACTGAATACTGACCAGAGCGCGGCAAGGTGGGTTCTAGTCAACGTCG C AACA, flanking IS element IS1603.
233413000097	2 bp direct repeat, GT, flanking IS element IS1560.
233413000098	25 bp inverted repeat, IRL, TAATTACTAGGACCTGAAAAAGTCG, flanking IS element IS1560.
233413000099	25 bp inverted repeat, IRR, TAATTACTAAGACCTGAAAAAGTCG, flanking IS element IS1560.
233413000100	2 bp direct repeat, GT, flanking IS element IS1560.
233413000101	REP-8, len: 1393 nt. Equivalent to REP, len: 1372 nt, from Mycobacterium tuberculosis strain H37Rv, (98.8% identity in 1368 nt overlap). REP13E12, 1371 bp repeat, copies in Mycobacterium tuberculosis cosmids; cY336 from: 14471 to: 15821 (approx. 100% identity); cY251 from: 11693 to: 13109 (approx. 100% identity); cI65 from: 14515 to: 15905 (approx 75% identity); cI125 from: 27240 to: 28597 (approx. 65% Identity); cY22G8 from: 13352 to 14689 (approx. 65% identity); and cY9F9 from: 9019 to: 10451 (approx. 65% identity); also nearly identical to EM_BA :MB35021 U35021 Mycobacterium bovis BCG DNA flanking deletion region 3 from: 56 to: 1466.
233413000102	49 bp imperfect inverted repeat, IRL, CGGCAACTGAATACTGACCAGAGCGCGGCAACTGAAAATTGACCAGCTT, flanking IS element IS1534.
233413000103	49 bp imperfect inverted repeat, IRR, CGGCAACCGAAAACTGATCAGGTGTCGGCAATCGAAAATTGACCAGCTT, flanking IS element IS1534.
233413000104	13 bp imperfect inverted repeat, IRR, GAGTTCGTCGGTG, flanking IS element IS1553.
233413000105	13 bp imperfect inverted repeat, IRL, GAGATCGTCGGTG, flanking IS element IS1553.
233413000106	27 bp imperfect inverted repeat, IRL, CGAGCAGACGTAAAAGCCCCCAATTCG, flanking IS element IS1557'.
233413000107	27 bp imperfect inverted repeat, IRR, CGAGCAGACGTAAAAGCCCCCATTTCG, flanking IS element IS1557'.