-- dump date 20120504_161259 -- class Genbank::misc_feature -- table misc_feature_note -- id note 568708000010 9 probable transmembrane helices predicted for STM_MW00051 by TMHMM2.0 at aa 13-35, 75-97, 136-158, 171-193, 203-225, 301-323, 343-365, 386-408 and 413-435 568708000015 6 probable transmembrane helices predicted for STM_MW00081 by TMHMM2.0 at aa 12-34, 38-57, 64-86, 96-118, 125-144 and 148-170 568708000018 Signal peptide predicted for STM_MW00101 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.944 between residues 23 and 24 568708000024 3 probable transmembrane helices predicted for STM_MW00141 by TMHMM2.0 at aa 15-37, 50-72 and 82-101 568708000027 1 probable transmembrane helix predicted for STM_MW00161 by TMHMM2.0 at aa 127-146 568708000030 Signal peptide predicted for STM_MW00201 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.993 between residues 24 and 25 568708000032 Signal peptide predicted for STM_MW00211 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.937 between residues 26 and 27 568708000033 1 probable transmembrane helix predicted for STM_MW00211 by TMHMM2.0 at aa 7-29 568708000036 Signal peptide predicted for STM_MW00221 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.999 between residues 35 and 36 568708000038 Signal peptide predicted for STM_MW00231 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.989 between residues 21 and 22 568708000040 Signal peptide predicted for STM_MW00241 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.758 between residues 23 and 24 568708000042 Signal peptide predicted for STM_MW00251 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.997 between residues 20 and 21 568708000044 1 probable transmembrane helix predicted for STM_MW00261 by TMHMM2.0 at aa 13-35 568708000047 Signal peptide predicted for STM_MW00271 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.986 between residues 27 and 28 568708000049 1 probable transmembrane helix predicted for STM_MW00291 by TMHMM2.0 at aa 128-147 568708000052 1 probable transmembrane helix predicted for STM_MW00311 by TMHMM2.0 at aa 128-145 568708000057 Signal peptide predicted for STM_MW00341 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.798 between residues 29 and 30 568708000059 Signal peptide predicted for STM_MW00351 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 24 and 25 568708000060 Signal peptide predicted for STM_MW00361 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.916 between residues 25 and 26 568708000061 1 probable transmembrane helix predicted for STM_MW00361 by TMHMM2.0 at aa 5-27 568708000066 Signal peptide predicted for STM_MW00401 by SignalP 2.0 HMM (Signal peptide probability 0.985) with cleavage site probability 0.378 between residues 35 and 36 568708000068 11 probable transmembrane helices predicted for STM_MW00401 by TMHMM2.0 at aa 7-29, 59-76, 96-115, 125-147, 154-176, 180-202, 215-237, 257-279, 291-313, 328-350 and 357-379 568708000072 11 probable transmembrane helices predicted for STM_MW00431 by TMHMM2.0 at aa 42-64, 92-109, 124-146, 167-184, 189-211, 240-257, 277-299, 306-326, 336-358, 371-396 and 416-438 568708000081 4 probable transmembrane helices predicted for STM_MW00481 by TMHMM2.0 at aa 13-35, 67-86, 99-121 and 136-158 568708000085 Signal peptide predicted for STM_MW00511 by SignalP 2.0 HMM (Signal peptide probability 0.625) with cleavage site probability 0.364 between residues 22 and 23 568708000088 2 probable transmembrane helices predicted for STM_MW00541 by TMHMM2.0 at aa 20-39 and 173-195 568708000090 9 probable transmembrane helices predicted for STM_MW00551 by TMHMM2.0 at aa 13-35, 42-64, 125-147, 160-182, 214-236, 266-288, 308-327, 339-361 and 409-431 568708000096 1 probable transmembrane helix predicted for STM_MW00571 by TMHMM2.0 at aa 10-32 568708000097 12 probable transmembrane helices predicted for STM_MW00581 by TMHMM2.0 at aa 23-45, 52-69, 79-101, 114-132, 147-169, 176-198, 208-230, 269-286, 296-318, 331-348, 363-385 and 425-444 568708000101 Signal peptide predicted for STM_MW00611 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.975 between residues 25 and 26 568708000108 tmhmm; query 1-116 568708000111 Signal peptide predicted for STM_MW00691 by SignalP 2.0 HMM (Signal peptide probability 0.643) with cleavage site probability 0.569 between residues 23 and 24 568708000124 12 probable transmembrane helices predicted for STM_MW00761 by TMHMM2.0 at aa 13-30, 50-72, 92-114, 144-163, 195-214, 229-251, 264-286, 312-334, 347-366, 410-432, 445-467 and 472-494 568708000130 11 probable transmembrane helices predicted for STM_MW00811 by TMHMM2.0 at aa 47-69, 82-104, 113-132, 137-159, 172-194, 199-221, 272-294, 309-331, 352-374, 400-422 and 427-449 568708000132 Signal peptide predicted for STM_MW00821 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.786 between residues 37 and 38 568708000134 Signal peptide predicted for STM_MW00841 by SignalP 2.0 HMM (Signal peptide probability 0.955) with cleavage site probability 0.672 between residues 18 and 19 568708000136 Signal peptide predicted for STM_MW00851 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.993 between residues 21 and 22 568708000138 1 probable transmembrane helix predicted for STM_MW00871 by TMHMM2.0 at aa 25-47 568708000139 Signal peptide predicted for STM_MW00881 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.874 between residues 38 and 39 568708000143 13 probable transmembrane helices predicted for STM_MW00911 by TMHMM2.0 at aa 5-24, 26-45, 55-74, 86-108, 112-134, 147-169, 179-201, 214-233, 237-254, 267-289, 293-315, 327-349 and 359-378 568708000153 Signal peptide predicted for STM_MW00971 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 20 and 21 568708000156 Signal peptide predicted for STM_MW00981 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.997 between residues 24 and 25 568708000157 1 probable transmembrane helix predicted for STM_MW00991 by TMHMM2.0 at aa 7-29 568708000166 Signal peptide predicted for STM_MW01031 by SignalP 2.0 HMM (Signal peptide probability 0.907) with cleavage site probability 0.613 between residues 27 and 28 568708000167 1 probable transmembrane helix predicted for STM_MW01031 by TMHMM2.0 at aa 5-27 568708000169 1 probable transmembrane helix predicted for STM_MW01051 by TMHMM2.0 at aa 52-74 568708000177 5 probable transmembrane helices predicted for STM_MW01111 by TMHMM2.0 at aa 13-35, 57-79, 140-162, 177-199 and 219-241 568708000180 12 probable transmembrane helices predicted for STM_MW01131 by TMHMM2.0 at aa 13-35, 55-77, 90-112, 127-149, 199-221, 241-260, 293-315, 335-357, 370-392, 407-424, 462-484 and 508-525 568708000182 Signal peptide predicted for STM_MW01131 by SignalP 2.0 HMM (Signal peptide probability 0.995) with cleavage site probability 0.574 between residues 29 and 30 568708000184 Signal peptide predicted for STM_MW01141 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 18 and 19 568708000204 1 probable transmembrane helix predicted for STM_MW01271 by TMHMM2.0 at aa 35-57 568708000205 Signal peptide predicted for STM_MW01281 by SignalP 2.0 HMM (Signal peptide probability 0.994) with cleavage site probability 0.824 between residues 42 and 43 568708000206 1 probable transmembrane helix predicted for STM_MW01281 by TMHMM2.0 at aa 21-43 568708000215 10 probable transmembrane helices predicted for STM_MW01311 by TMHMM2.0 at aa 15-37, 75-92, 97-114, 134-151, 171-193, 200-219, 234-256, 263-285, 289-311 and 338-357 568708000218 1 probable transmembrane helix predicted for STM_MW01321 by TMHMM2.0 at aa 9-31 568708000222 8 probable transmembrane helices predicted for STM_MW01331 by TMHMM2.0 at aa 20-42, 57-74, 81-103, 155-177, 190-212, 278-300, 312-334 and 344-366 568708000223 Signal peptide predicted for STM_MW01341 by SignalP 2.0 HMM (Signal peptide probability 0.680) with cleavage site probability 0.584 between residues 26 and 27 568708000231 1 probable transmembrane helix predicted for STM_MW01371 by TMHMM2.0 at aa 26-48 568708000248 3 probable transmembrane helices predicted for STM_MW01481 by TMHMM2.0 at aa 163-185, 205-227 and 368-390 568708000254 1 probable transmembrane helix predicted for STM_MW01501 by TMHMM2.0 at aa 7-29 568708000259 4 probable transmembrane helices predicted for STM_MW01531 by TMHMM2.0 at aa 36-58, 63-85, 146-168 and 266-283 568708000262 12 probable transmembrane helices predicted for STM_MW01551 by TMHMM2.0 at aa 12-31, 35-57, 81-100, 115-137, 150-172, 182-204, 234-256, 266-288, 295-317, 322-344, 365-387 and 407-429 568708000263 12 probable transmembrane helices predicted for STM_MW01561 by TMHMM2.0 at aa 20-42, 47-66, 87-109, 119-141, 154-176, 199-221, 241-263, 283-305, 332-354, 358-380, 400-422 and 427-446 568708000274 Signal peptide predicted for STM_MW01611 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 21 and 22 568708000276 Signal peptide predicted for STM_MW01621 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.964 between residues 19 and 20 568708000277 pfam_scan;Pfam:PF11737; E()=1.0E-78;score=263.2;query 59-303;description=DUF3300 568708000284 10 probable transmembrane helices predicted for STM_MW01671 by TMHMM2.0 at aa 13-35, 45-64, 71-90, 100-122, 134-156, 160-182, 189-211, 215-237, 244-266 and 281-303 568708000292 Signal peptide predicted for STM_MW01731 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.745 between residues 22 and 23 568708000293 Signal peptide predicted for STM_MW01741 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 28 and 29 568708000299 5 probable transmembrane helices predicted for STM_MW01751 by TMHMM2.0 at aa 13-35, 40-57, 64-81, 96-114 and 121-140 568708000304 6 probable transmembrane helices predicted for STM_MW01791 by TMHMM2.0 at aa 20-42, 62-84, 104-126, 141-163, 170-192 and 226-248 568708000306 Signal peptide predicted for STM_MW01801 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 19 and 20 568708000308 Signal peptide predicted for STM_MW01811 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.990 between residues 30 and 31 568708000311 Signal peptide predicted for STM_MW01821 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 21 and 22 568708000313 Signal peptide predicted for STM_MW01831 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.997 between residues 23 and 24 568708000315 Signal peptide predicted for STM_MW01851 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 19 and 20 568708000330 1 probable transmembrane helix predicted for STM_MW01961 by TMHMM2.0 at aa 60-82 568708000333 Signal peptide predicted for STM_MW01971 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.985 between residues 33 and 34 568708000337 Signal peptide predicted for STM_MW01991 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.989 between residues 30 and 31 568708000339 17 probable transmembrane helices predicted for STM_MW02001 by TMHMM2.0 at aa 35-57, 87-104, 117-136, 140-162, 169-191, 264-286, 298-316, 326-348, 372-394, 414-436, 449-467, 471-493, 505-524, 544-566, 593-615, 630-649 and 656-678 568708000341 Signal peptide predicted for STM_MW02011 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.975 between residues 23 and 24 568708000343 Signal peptide predicted for STM_MW02021 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.964 between residues 29 and 30 568708000345 Signal peptide predicted for STM_MW02031 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.994 between residues 25 and 26 568708000346 1 probable transmembrane helix predicted for STM_MW02031 by TMHMM2.0 at aa 7-29 568708000349 Signal peptide predicted for STM_MW02051 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 18 and 19 568708000351 Signal peptide predicted for STM_MW02061 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.988 between residues 25 and 26 568708000352 1 probable transmembrane helix predicted for STM_MW02061 by TMHMM2.0 at aa 7-26 568708000354 Signal peptide predicted for STM_MW02071 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.997 between residues 21 and 22 568708000357 11 probable transmembrane helices predicted for STM_MW02091 by TMHMM2.0 at aa 31-53, 75-97, 124-146, 179-201, 210-232, 252-274, 291-313, 328-350, 357-379, 389-411 and 418-440 568708000361 6 probable transmembrane helices predicted for STM_MW02111 by TMHMM2.0 at aa 4-23, 30-47, 62-79, 88-105, 115-137 and 149-171 568708000363 1 probable transmembrane helix predicted for STM_MW02121 by TMHMM2.0 at aa 7-29 568708000364 Signal peptide predicted for STM_MW02121 by SignalP 2.0 HMM (Signal peptide probability 0.988) with cleavage site probability 0.875 between residues 22 and 23 568708000367 Signal peptide predicted for STM_MW02151 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.996 between residues 26 and 27 568708000371 11 probable transmembrane helices predicted for STM_MW02181 by TMHMM2.0 at aa 27-46, 51-73, 85-107, 122-144, 151-173, 183-202, 244-266, 276-298, 310-329, 374-396 and 403-425 568708000386 Signal peptide predicted for STM_MW02281 by SignalP 2.0 HMM (Signal peptide probability 0.973) with cleavage site probability 0.760 between residues 29 and 30 568708000388 8 probable transmembrane helices predicted for STM_MW02281 by TMHMM2.0 at aa 7-41, 56-74, 87-106, 121-143, 150-172, 192-211, 218-240 and 260-282 568708000389 4 probable transmembrane helices predicted for STM_MW02291 by TMHMM2.0 at aa 2-21, 98-120, 376-398 and 426-445 568708000392 Signal peptide predicted for STM_MW02301 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.980 between residues 20 and 21 568708000395 Signal peptide predicted for STM_MW02311 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 20 and 21 568708000407 Signal peptide predicted for STM_MW02391 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.990 between residues 25 and 26 568708000408 1 probable transmembrane helix predicted for STM_MW02391 by TMHMM2.0 at aa 7-29 568708000423 Signal peptide predicted for STM_MW02471 by SignalP 2.0 HMM (Signal peptide probability 0.949) with cleavage site probability 0.649 between residues 25 and 26 568708000429 Signal peptide predicted for STM_MW02501 by SignalP 2.0 HMM (Signal peptide probability 0.667) with cleavage site probability 0.306 between residues 19 and 20 568708000431 Signal peptide predicted for STM_MW02511 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.356 between residues 21 and 22 568708000432 5 probable transmembrane helices predicted for STM_MW02521 by TMHMM2.0 at aa 20-42, 55-77, 81-103, 144-166 and 181-203 568708000439 12 probable transmembrane helices predicted for STM_MW02561 by TMHMM2.0 at aa 7-29, 39-61, 70-89, 99-121, 128-150, 160-182, 202-224, 234-256, 263-285, 289-311, 331-353 and 363-382 568708000446 Signal peptide predicted for STM_MW02591 by SignalP 2.0 HMM (Signal peptide probability 0.987) with cleavage site probability 0.403 between residues 21 and 22 568708000461 Signal peptide predicted for STM_MW02771 by SignalP 2.0 HMM (Signal peptide probability 0.996) with cleavage site probability 0.996 between residues 23 and 24 568708000463 Signal peptide predicted for STM_MW02831 by SignalP 2.0 HMM (Signal peptide probability 0.979) with cleavage site probability 0.962 between residues 26 and 27 568708000464 1 probable transmembrane helix predicted for STM_MW02831 by TMHMM2.0 at aa 7-26 568708000466 Signal peptide predicted for STM_MW02851 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.844 between residues 31 and 32 568708000469 1 probable transmembrane helix predicted for STM_MW02871 by TMHMM2.0 at aa 243-265 568708000471 1 probable transmembrane helix predicted for STM_MW02881 by TMHMM2.0 at aa 34-56 568708000472 Signal peptide predicted for STM_MW02891 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.997 between residues 18 and 19 568708000473 Signal peptide predicted for STM_MW02901 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.985 between residues 34 and 35 568708000474 5 probable transmembrane helices predicted for STM_MW02901 by TMHMM2.0 at aa 13-35, 40-62, 69-88, 98-120 and 530-547 568708000478 Signal peptide predicted for STM_MW02921 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.847 between residues 23 and 24 568708000483 1 probable transmembrane helix predicted for STM_MW02961 by TMHMM2.0 at aa 17-39 568708000489 lacks N-terminal region 568708000491 has a frameshift after residue 81; pfam_scan;Pfam:PF08845; E()=3.7E-13;score=48.3;query17-49;description=DUF1813 568708000494 lacks the N-terminal region and has three frameshifts after residues 43, 142 and 148; pfam_scan;Pfam:PF00665; E()=5.8E-19;score=68.1;query10-139;description=rve 568708000496 Signal peptide predicted for STM_MW03091 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.988 between residues 26 and 27 568708000500 Signal peptide predicted for STM_MW03111 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.930 between residues 21 and 22 568708000502 Signal peptide predicted for STM_MW03121 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.996 between residues 30 and 31 568708000504 1 probable transmembrane helix predicted for STM_MW03121 by TMHMM2.0 at aa 12-31 568708000510 Signal peptide predicted for STM_MW03171 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.976 between residues 22 and 23 568708000511 Signal peptide predicted for STM_MW03181 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.733 between residues 23 and 24 568708000516 2 probable transmembrane helices predicted for STM_MW03201 by TMHMM2.0 at aa 10-32 and 39-61 568708000517 Signal peptide predicted for STM_MW03201 by SignalP 2.0 HMM (Signal peptide probability 0.711) with cleavage site probability 0.289 between residues 32 and 33 568708000521 Signal peptide predicted for STM_MW03231 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.831 between residues 19 and 20 568708000525 contains a frameshift after residue 297; pfam_scan;Pfam:PF01139; E()=1.4E-22;score=79.4;query13-108;description=UPF0027 568708000534 Signal peptide predicted for STM_MW03311 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 20 and 21 568708000538 BTP1 568708000546 1 probable transmembrane helix predicted for STM_MW03491 by TMHMM2.0 at aa 15-37 568708000555 1 probable transmembrane helix predicted for STM_MW03601 by TMHMM2.0 at aa 10-32 568708000562 2 probable transmembrane helices predicted for STM_MW03711 by TMHMM2.0 at aa 7-26 and 30-49 568708000563 Signal peptide predicted for STM_MW03721 by SignalP 2.0 HMM (Signal peptide probability 0.625) with cleavage site probability 0.154 between residues 23 and 24 568708000564 1 probable transmembrane helix predicted for STM_MW03721 by TMHMM2.0 at aa 7-29 568708000567 1 probable transmembrane helix predicted for STM_MW03731 by TMHMM2.0 at aa 15-37 568708000580 11 probable transmembrane helices predicted for STM_MW03911 by TMHMM2.0 at aa 13-35, 40-59, 72-94, 135-157, 166-188, 201-218, 225-242, 246-268, 275-294, 314-333 and 345-367 568708000581 1 probable transmembrane helix predicted for STM_MW03921 by TMHMM2.0 at aa 10-32 568708000583 lacks the N-terminal region and has a frameshift after residue 92; pfam_scan;Pfam:PF08841; E()=9.3E-122;score=405.6;query 1-236;description=DDR 568708000586 12 probable transmembrane helices predicted for STM_MW03981 by TMHMM2.0 at aa 16-38, 53-75, 82-104, 108-130, 137-159, 169-191, 221-243, 253-275, 282-304, 308-330, 347-369 and 373-395 568708000594 Signal peptide predicted for STM_MW04051 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.628 between residues 25 and 26 568708000597 Signal peptide predicted for STM_MW04061 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.999 between residues 29 and 30 568708000598 1 probable transmembrane helix predicted for STM_MW04061 by TMHMM2.0 at aa 7-29 568708000599 Signal peptide predicted for STM_MW04071 by SignalP 2.0 HMM (Signal peptide probability 0.933) with cleavage site probability 0.750 between residues 18 and 19 568708000601 Signal peptide predicted for STM_MW04081 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 26 and 27 568708000604 1 probable transmembrane helix predicted for STM_MW04091 by TMHMM2.0 at aa 9-31 568708000605 Signal peptide predicted for STM_MW04091 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.791 between residues 28 and 29 568708000607 Signal peptide predicted for STM_MW04101 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.991 between residues 22 and 23 568708000608 1 probable transmembrane helix predicted for STM_MW04111 by TMHMM2.0 at aa 145-167 568708000609 Signal peptide predicted for STM_MW04121 by SignalP 2.0 HMM (Signal peptide probability 0.903) with cleavage site probability 0.632 between residues 26 and 27 568708000610 1 probable transmembrane helix predicted for STM_MW04121 by TMHMM2.0 at aa 7-29 568708000611 Signal peptide predicted for STM_MW04131 by SignalP 2.0 HMM (Signal peptide probability 0.992) with cleavage site probability 0.958 between residues 26 and 27 568708000612 2 probable transmembrane helices predicted for STM_MW04131 by TMHMM2.0 at aa 7-29 and 223-245 568708000614 Signal peptide predicted for STM_MW04151 by SignalP 2.0 HMM (Signal peptide probability 0.992) with cleavage site probability 0.718 between residues 25 and 26 568708000615 1 probable transmembrane helix predicted for STM_MW04151 by TMHMM2.0 at aa 7-29 568708000616 Signal peptide predicted for STM_MW04161 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 22 and 23 568708000619 Signal peptide predicted for STM_MW04191 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.408 between residues 20 and 21 568708000622 12 probable transmembrane helices predicted for STM_MW04211 by TMHMM2.0 at aa 7-29, 339-361, 368-390, 394-416, 443-465, 475-497, 543-565, 882-899, 906-928, 933-955, 983-1005 and 1015-1037 568708000623 Signal peptide predicted for STM_MW04211 by SignalP 2.0 HMM (Signal peptide probability 0.996) with cleavage site probability 0.452 between residues 30 and 31 568708000625 1 probable transmembrane helix predicted for STM_MW04221 by TMHMM2.0 at aa 7-29 568708000626 Signal peptide predicted for STM_MW04221 by SignalP 2.0 HMM (Signal peptide probability 0.893) with cleavage site probability 0.796 between residues 24 and 25 568708000628 8 probable transmembrane helices predicted for STM_MW04231 by TMHMM2.0 at aa 99-121, 136-156, 169-191, 201-219, 353-375, 380-402, 696-718 and 722-744 568708000634 10 probable transmembrane helices predicted for STM_MW04261 by TMHMM2.0 at aa 13-35, 50-72, 79-101, 105-127, 140-162, 172-194, 215-232, 252-274, 287-309 and 370-392 568708000640 9 probable transmembrane helices predicted for STM_MW04301 by TMHMM2.0 at aa 20-42, 55-77, 97-119, 126-148, 185-207, 220-237, 322-344, 357-379 and 407-429 568708000642 8 probable transmembrane helices predicted for STM_MW04311 by TMHMM2.0 at aa 7-26, 78-100, 121-143, 158-180, 193-215, 230-248, 261-283 and 303-325 568708000643 Signal peptide predicted for STM_MW04341 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 30 and 31 568708000646 6 probable transmembrane helices predicted for STM_MW04351 by TMHMM2.0 at aa 5-27, 39-61, 71-90, 123-140, 150-167 and 187-204 568708000648 Signal peptide predicted for STM_MW04361 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 21 and 22 568708000658 Signal peptide predicted for STM_MW04431 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.920 between residues 27 and 28 568708000662 6 probable transmembrane helices predicted for STM_MW04461 by TMHMM2.0 at aa 23-45, 52-74, 104-126, 172-194, 209-231 and 299-321 568708000664 Signal peptide predicted for STM_MW04471 by SignalP 2.0 HMM (Signal peptide probability 0.959) with cleavage site probability 0.527 between residues 26 and 27 568708000667 2 probable transmembrane helices predicted for STM_MW04481 by TMHMM2.0 at aa 25-47 and 68-90 568708000669 2 probable transmembrane helices predicted for STM_MW04491 by TMHMM2.0 at aa 13-32 and 37-59 568708000672 1 probable transmembrane helix predicted for STM_MW04511 by TMHMM2.0 at aa 13-35 568708000674 10 probable transmembrane helices predicted for STM_MW04521 by TMHMM2.0 at aa 7-29, 44-66, 79-101, 161-183, 204-226, 249-271, 283-302, 307-329, 342-364 and 369-391 568708000677 Signal peptide predicted for STM_MW04541 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.516 between residues 20 and 21 568708000678 1 probable transmembrane helix predicted for STM_MW04541 by TMHMM2.0 at aa 5-22 568708000681 4 probable transmembrane helices predicted for STM_MW04551 by TMHMM2.0 at aa 45-67, 105-127, 140-162 and 177-199 568708000691 12 probable transmembrane helices predicted for STM_MW04641 by TMHMM2.0 at aa 5-27, 42-64, 71-93, 103-120, 125-147, 157-179, 200-222, 237-254, 266-288, 293-315, 320-342 and 352-374 568708000692 Signal peptide predicted for STM_MW04641 by SignalP 2.0 HMM (Signal peptide probability 0.864) with cleavage site probability 0.547 between residues 18 and 19 568708000696 Signal peptide predicted for STM_MW04681 by SignalP 2.0 HMM (Signal peptide probability 0.909) with cleavage site probability 0.844 between residues 37 and 38 568708000697 1 probable transmembrane helix predicted for STM_MW04681 by TMHMM2.0 at aa 12-34 568708000701 Signal peptide predicted for STM_MW04691 by SignalP 2.0 HMM (Signal peptide probability 0.823) with cleavage site probability 0.742 between residues 24 and 25 568708000703 12 probable transmembrane helices predicted for STM_MW04691 by TMHMM2.0 at aa 13-35, 41-63, 76-98, 118-140, 147-169, 189-211, 223-245, 276-298, 305-327, 337-359, 371-393 and 408-426 568708000704 Signal peptide predicted for STM_MW04701 by SignalP 2.0 HMM (Signal peptide probability 0.943) with cleavage site probability 0.472 between residues 36 and 37 568708000706 12 probable transmembrane helices predicted for STM_MW04701 by TMHMM2.0 at aa 16-34, 44-63, 83-105, 120-142, 154-176, 196-218, 239-261, 276-298, 329-351, 356-378, 399-421 and 426-445 568708000713 1 probable transmembrane helix predicted for STM_MW04761 by TMHMM2.0 at aa 20-39 568708000715 Signal peptide predicted for STM_MW04771 by SignalP 2.0 HMM (Signal peptide probability 0.667) with cleavage site probability 0.508 between residues 30 and 31 568708000716 6 probable transmembrane helices predicted for STM_MW04771 by TMHMM2.0 at aa 7-29, 452-471, 476-498, 503-525, 546-568 and 583-605 568708000719 6 probable transmembrane helices predicted for STM_MW04781 by TMHMM2.0 at aa 24-46, 143-162, 169-191, 195-217, 248-270 and 275-297 568708000726 Signal peptide predicted for STM_MW04831 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 22 and 23 568708000728 Signal peptide predicted for STM_MW04841 by SignalP 2.0 HMM (Signal peptide probability 0.986) with cleavage site probability 0.768 between residues 24 and 25 568708000736 Signal peptide predicted for STM_MW04901 by SignalP 2.0 HMM (Signal peptide probability 0.799) with cleavage site probability 0.677 between residues 44 and 45 568708000737 3 probable transmembrane helices predicted for STM_MW04901 by TMHMM2.0 at aa 21-43, 53-75 and 140-162 568708000747 6 probable transmembrane helices predicted for STM_MW04961 by TMHMM2.0 at aa 12-34, 66-88, 101-123, 133-155, 187-209 and 234-253 568708000749 Signal peptide predicted for STM_MW04961 by SignalP 2.0 HMM (Signal peptide probability 0.955) with cleavage site probability 0.445 between residues 29 and 30 568708000750 7 probable transmembrane helices predicted for STM_MW04971 by TMHMM2.0 at aa 15-37, 74-96, 111-133, 140-162, 199-221, 226-245 and 255-277 568708000764 11 probable transmembrane helices predicted for STM_MW05061 by TMHMM2.0 at aa 15-37, 44-66, 76-98, 132-154, 159-181, 212-234, 249-268, 275-297, 301-323, 336-358 and 363-380 568708000766 Signal peptide predicted for STM_MW05081 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.938 between residues 22 and 23 568708000769 9 probable transmembrane helices predicted for STM_MW05101 by TMHMM2.0 at aa 12-34, 38-60, 81-103, 108-127, 134-156, 161-183, 209-231, 235-252 and 264-286 568708000771 3 probable transmembrane helices predicted for STM_MW05111 by TMHMM2.0 at aa 15-37, 44-66 and 76-98 568708000773 5 probable transmembrane helices predicted for STM_MW05121 by TMHMM2.0 at aa 5-24, 34-56, 63-85, 105-127 and 148-170 568708000775 14 probable transmembrane helices predicted for STM_MW05131 by TMHMM2.0 at aa 15-37, 57-79, 105-127, 140-162, 191-213, 233-255, 275-297, 310-332, 347-369, 382-404, 414-436, 456-478, 498-520 and 590-612 568708000778 3 probable transmembrane helices predicted for STM_MW05141 by TMHMM2.0 at aa 12-30, 45-67 and 88-110 568708000780 Signal peptide predicted for STM_MW05141 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.595 between residues 30 and 31 568708000781 14 probable transmembrane helices predicted for STM_MW05151 by TMHMM2.0 at aa 13-35, 50-69, 82-104, 109-131, 144-166, 176-195, 223-245, 260-282, 287-309, 319-341, 354-376, 381-403, 424-446 and 466-485 568708000783 Signal peptide predicted for STM_MW05151 by SignalP 2.0 HMM (Signal peptide probability 0.995) with cleavage site probability 0.787 between residues 37 and 38 568708000798 1 probable transmembrane helix predicted for STM_MW05231 by TMHMM2.0 at aa 13-35 568708000801 Signal peptide predicted for STM_MW05241 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 25 and 26 568708000809 6 probable transmembrane helices predicted for STM_MW05311 by TMHMM2.0 at aa 21-43, 58-77, 129-151, 156-175, 246-268 and 278-300 568708000812 Signal peptide predicted for STM_MW05321 by SignalP 2.0 HMM (Signal peptide probability 0.766) with cleavage site probability 0.336 between residues 37 and 38 568708000813 4 probable transmembrane helices predicted for STM_MW05321 by TMHMM2.0 at aa 27-49, 138-160, 165-185 and 249-271 568708000817 Signal peptide predicted for STM_MW05341 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.954 between residues 27 and 28 568708000818 12 probable transmembrane helices predicted for STM_MW05341 by TMHMM2.0 at aa 9-26, 36-58, 63-85, 120-142, 149-171, 186-205, 218-237, 247-269, 281-303, 307-324, 337-359 and 374-396 568708000821 Signal peptide predicted for STM_MW05361 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.983 between residues 20 and 21 568708000823 2 probable transmembrane helices predicted for STM_MW05381 by TMHMM2.0 at aa 6-28 and 243-265 568708000828 2 probable transmembrane helices predicted for STM_MW05411 by TMHMM2.0 at aa 36-55 and 60-79 568708000833 11 probable transmembrane helices predicted for STM_MW05451 by TMHMM2.0 at aa 10-32, 340-359, 369-391, 438-460, 470-492, 542-564, 873-892, 899-921, 926-948, 975-997 and 1007-1029 568708000835 Signal peptide predicted for STM_MW05461 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.661 between residues 24 and 25 568708000838 Signal peptide predicted for STM_MW05481 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.835 between residues 33 and 34 568708000839 12 probable transmembrane helices predicted for STM_MW05481 by TMHMM2.0 at aa 13-32, 500-522, 557-579, 584-606, 630-647, 658-680, 693-715, 725-747, 795-817, 837-859, 880-902 and 917-939 568708000844 3 probable transmembrane helices predicted for STM_MW05521 by TMHMM2.0 at aa 5-27, 75-92 and 99-118 568708000859 12 probable transmembrane helices predicted for STM_MW05621 by TMHMM2.0 at aa 4-26, 33-52, 56-78, 87-109, 114-136, 149-171, 191-213, 226-248, 280-299, 302-324, 339-361 and 368-387 568708000861 10 probable transmembrane helices predicted for STM_MW05631 by TMHMM2.0 at aa 26-48, 58-80, 101-123, 180-202, 223-245, 265-287, 294-313, 317-339, 351-373 and 377-399 568708000863 Signal peptide predicted for STM_MW05641 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 25 and 26 568708000869 Signal peptide predicted for STM_MW05671 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.993 between residues 19 and 20 568708000871 8 probable transmembrane helices predicted for STM_MW05681 by TMHMM2.0 at aa 188-205, 215-237, 244-266, 281-298, 435-457, 462-484, 777-796 and 801-823 568708000877 3 probable transmembrane helices predicted for STM_MW05701 by TMHMM2.0 at aa 4-23, 30-49 and 53-75 568708000879 1 probable transmembrane helix predicted for STM_MW05711 by TMHMM2.0 at aa 7-29 568708000881 Signal peptide predicted for STM_MW05731 by SignalP 2.0 HMM (Signal peptide probability 0.824) with cleavage site probability 0.719 between residues 27 and 28 568708000883 6 probable transmembrane helices predicted for STM_MW05731 by TMHMM2.0 at aa 7-24, 57-79, 92-114, 118-140, 192-209 and 219-241 568708000887 1 probable transmembrane helix predicted for STM_MW05761 by TMHMM2.0 at aa 7-26 568708000888 Signal peptide predicted for STM_MW05761 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.788 between residues 25 and 26 568708000890 Signal peptide predicted for STM_MW05781 by SignalP 2.0 HMM (Signal peptide probability 0.989) with cleavage site probability 0.640 between residues 33 and 34 568708000891 10 probable transmembrane helices predicted for STM_MW05781 by TMHMM2.0 at aa 13-35, 243-262, 291-313, 333-355, 376-398, 403-425, 451-473, 676-698, 732-754 and 769-791 568708000893 Signal peptide predicted for STM_MW05791 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.899 between residues 25 and 26 568708000894 Signal peptide predicted for STM_MW05801 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.986 between residues 25 and 26 568708000898 6 probable transmembrane helices predicted for STM_MW05821 by TMHMM2.0 at aa 15-37, 50-72, 82-104, 117-139, 149-171 and 183-205 568708000911 12 probable transmembrane helices predicted for STM_MW05901 by TMHMM2.0 at aa 21-40, 55-77, 84-101, 106-128, 141-163, 173-195, 223-245, 260-282, 295-313, 323-342, 355-377 and 387-406 568708000916 11 probable transmembrane helices predicted for STM_MW05921 by TMHMM2.0 at aa 15-37, 42-64, 99-121, 128-150, 170-189, 196-213, 237-259, 280-302, 341-363, 375-397 and 407-426 568708000935 Signal peptide predicted for STM_MW06061 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 19 and 20 568708000936 Signal peptide predicted for STM_MW06071 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.971 between residues 21 and 22 568708000937 4 probable transmembrane helices predicted for STM_MW06081 by TMHMM2.0 at aa 12-34, 54-76, 89-108 and 149-171 568708000941 Signal peptide predicted for STM_MW06111 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.987 between residues 22 and 23 568708000943 Signal peptide predicted for STM_MW06121 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.994 between residues 19 and 20 568708000945 Signal peptide predicted for STM_MW06131 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 23 and 24 568708000946 1 probable transmembrane helix predicted for STM_MW06131 by TMHMM2.0 at aa 7-29 568708000949 Signal peptide predicted for STM_MW06141 by SignalP 2.0 HMM (Signal peptide probability 0.968) with cleavage site probability 0.471 between residues 27 and 28 568708000951 Signal peptide predicted for STM_MW06151 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.997 between residues 22 and 23 568708000952 Signal peptide predicted for STM_MW06161 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.990 between residues 21 and 22 568708000960 9 probable transmembrane helices predicted for STM_MW06231 by TMHMM2.0 at aa 13-32, 77-96, 108-130, 135-157, 201-223, 254-273, 280-302, 307-329 and 336-358 568708000961 Signal peptide predicted for STM_MW06231 by SignalP 2.0 HMM (Signal peptide probability 0.879) with cleavage site probability 0.554 between residues 27 and 28 568708000963 2 probable transmembrane helices predicted for STM_MW06241 by TMHMM2.0 at aa 227-249 and 264-286 568708000964 4 probable transmembrane helices predicted for STM_MW06251 by TMHMM2.0 at aa 12-31, 35-54, 67-84 and 94-116 568708000974 Signal peptide predicted for STM_MW06301 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.996 between residues 22 and 23 568708000977 4 probable transmembrane helices predicted for STM_MW06311 by TMHMM2.0 at aa 13-32, 87-106, 113-135 and 164-183 568708000979 12 probable transmembrane helices predicted for STM_MW06331 by TMHMM2.0 at aa 34-53, 57-74, 107-129, 139-161, 166-188, 210-232, 253-275, 295-317, 344-366, 370-392, 413-435 and 440-459 568708000981 5 probable transmembrane helices predicted for STM_MW06341 by TMHMM2.0 at aa 21-43, 72-89, 102-124, 139-161 and 166-183 568708000982 Signal peptide predicted for STM_MW06351 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.992 between residues 25 and 26 568708000985 Signal peptide predicted for STM_MW06361 by SignalP 2.0 HMM (Signal peptide probability 0.933) with cleavage site probability 0.457 between residues 31 and 32 568708000991 4 probable transmembrane helices predicted for STM_MW06391 by TMHMM2.0 at aa 152-174, 195-217, 237-254 and 261-283 568708000994 6 probable transmembrane helices predicted for STM_MW06401 by TMHMM2.0 at aa 7-29, 34-56, 69-91, 124-146, 153-175 and 190-212 568708001002 2 probable transmembrane helices predicted for STM_MW06472 by TMHMM2.0 at aa 13-35 and 50-72 568708001007 Signal peptide predicted for STM_MW06501 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 25 and 26 568708001015 2 probable transmembrane helices predicted for STM_MW06541 by TMHMM2.0 at aa 43-62 and 338-360 568708001017 8 probable transmembrane helices predicted for STM_MW06561 by TMHMM2.0 at aa 7-26, 57-79, 92-111, 115-137, 144-166, 193-210, 239-261 and 301-323 568708001019 Signal peptide predicted for STM_MW06561 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.876 between residues 30 and 31 568708001020 9 probable transmembrane helices predicted for STM_MW06571 by TMHMM2.0 at aa 10-32, 65-82, 92-114, 121-140, 155-177, 198-220, 240-262, 282-304 and 308-326 568708001022 Signal peptide predicted for STM_MW06571 by SignalP 2.0 HMM (Signal peptide probability 0.989) with cleavage site probability 0.811 between residues 32 and 33 568708001024 12 probable transmembrane helices predicted for STM_MW06581 by TMHMM2.0 at aa 22-44, 54-76, 83-105, 110-132, 153-175, 179-201, 214-236, 256-278, 285-307, 312-331, 351-373 and 377-399 568708001026 Signal peptide predicted for STM_MW06591 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 24 and 25 568708001033 Signal peptide predicted for STM_MW06651 by SignalP 2.0 HMM (Signal peptide probability 0.919) with cleavage site probability 0.540 between residues 22 and 23 568708001034 18 probable transmembrane helices predicted for STM_MW06651 by TMHMM2.0 at aa 7-26, 32-54, 89-111, 116-138, 159-181, 191-213, 218-240, 255-277, 284-306, 326-348, 361-383, 398-420, 441-463, 468-487, 514-533, 548-570, 577-599 and 649-671 568708001038 Signal peptide predicted for STM_MW06681 by SignalP 2.0 HMM (Signal peptide probability 0.626) with cleavage site probability 0.422 between residues 27 and 28 568708001044 Signal peptide predicted for STM_MW06721 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 17 and 18 568708001050 Signal peptide predicted for STM_MW06761 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 38 and 39 568708001051 1 probable transmembrane helix predicted for STM_MW06761 by TMHMM2.0 at aa 13-32 568708001057 8 probable transmembrane helices predicted for STM_MW06781 by TMHMM2.0 at aa 5-27, 39-61, 76-95, 102-124, 134-156, 163-185, 195-214 and 226-248 568708001063 Signal peptide predicted for STM_MW06821 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.997 between residues 23 and 24 568708001064 13 probable transmembrane helices predicted for STM_MW06831 by TMHMM2.0 at aa 7-24, 34-53, 58-75, 95-117, 138-157, 198-220, 233-255, 288-305, 307-329, 339-361, 374-396, 428-450 and 463-485 568708001072 Signal peptide predicted for STM_MW06901 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.927 between residues 38 and 39 568708001073 2 probable transmembrane helices predicted for STM_MW06901 by TMHMM2.0 at aa 20-42 and 180-202 568708001078 10 probable transmembrane helices predicted for STM_MW06921 by TMHMM2.0 at aa 37-59, 80-102, 117-139, 152-174, 194-216, 223-245, 265-287, 299-321, 363-385 and 392-414 568708001079 Signal peptide predicted for STM_MW06931 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.962 between residues 29 and 30 568708001080 1 probable transmembrane helix predicted for STM_MW06931 by TMHMM2.0 at aa 7-29 568708001084 4 probable transmembrane helices predicted for STM_MW06951 by TMHMM2.0 at aa 5-22, 32-54, 67-89 and 99-121 568708001086 1 probable transmembrane helix predicted for STM_MW06971 by TMHMM2.0 at aa 4-21 568708001095 Signal peptide predicted for STM_MW07021 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 29 and 30 568708001098 Signal peptide predicted for STM_MW07031 by SignalP 2.0 HMM (Signal peptide probability 0.967) with cleavage site probability 0.505 between residues 25 and 26 568708001099 9 probable transmembrane helices predicted for STM_MW07041 by TMHMM2.0 at aa 15-37, 50-67, 77-99, 136-155, 160-179, 181-203, 272-294, 306-328 and 338-360 568708001101 Signal peptide predicted for STM_MW07041 by SignalP 2.0 HMM (Signal peptide probability 0.957) with cleavage site probability 0.604 between residues 40 and 41 568708001104 1 probable transmembrane helix predicted for STM_MW07051 by TMHMM2.0 at aa 21-43 568708001105 Signal peptide predicted for STM_MW07051 by SignalP 2.0 HMM (Signal peptide probability 0.673) with cleavage site probability 0.546 between residues 37 and 38 568708001113 Signal peptide predicted for STM_MW07121 by SignalP 2.0 HMM (Signal peptide probability 0.810) with cleavage site probability 0.253 between residues 27 and 28 568708001119 8 probable transmembrane helices predicted for STM_MW07161 by TMHMM2.0 at aa 7-25, 35-57, 70-92, 157-179, 192-211, 216-238, 247-269 and 279-301 568708001120 Signal peptide predicted for STM_MW07171 by SignalP 2.0 HMM (Signal peptide probability 0.989) with cleavage site probability 0.960 between residues 24 and 25 568708001127 1 probable transmembrane helix predicted for STM_MW07211 by TMHMM2.0 at aa 453-472 568708001128 Note the frameshift mutation following codon 46; pfam_scan;Pfam:PF06889; E()=8.6E-120;score=397.7;query 1-231;description=DUF1266 568708001134 5 probable transmembrane helices predicted for STM_MW07281 by TMHMM2.0 at aa 15-37, 58-80, 95-112, 155-177 and 197-219 568708001136 5 probable transmembrane helices predicted for STM_MW07291 by TMHMM2.0 at aa 31-53, 66-88, 108-127, 179-196 and 211-233 568708001139 Signal peptide predicted for STM_MW07301 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 28 and 29 568708001140 8 probable transmembrane helices predicted for STM_MW07311 by TMHMM2.0 at aa 12-29, 33-50, 57-79, 89-111, 124-146, 166-188, 195-213 and 489-507 568708001142 Signal peptide predicted for STM_MW07311 by SignalP 2.0 HMM (Signal peptide probability 0.892) with cleavage site probability 0.839 between residues 27 and 28 568708001151 1 probable transmembrane helix predicted for STM_MW07361 by TMHMM2.0 at aa 7-29 568708001152 4 probable transmembrane helices predicted for STM_MW07371 by TMHMM2.0 at aa 7-28, 33-55, 99-121 and 131-153 568708001153 Signal peptide predicted for STM_MW07371 by SignalP 2.0 HMM (Signal peptide probability 0.730) with cleavage site probability 0.565 between residues 34 and 35 568708001161 11 probable transmembrane helices predicted for STM_MW07431 by TMHMM2.0 at aa 13-30, 40-62, 69-91, 96-118, 131-153, 163-185, 192-214, 229-251, 258-280, 295-317 and 337-359 568708001166 Signal peptide predicted for STM_MW07451 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.848 between residues 32 and 33 568708001167 1 probable transmembrane helix predicted for STM_MW07451 by TMHMM2.0 at aa 9-28 568708001169 Signal peptide predicted for STM_MW07461 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.944 between residues 18 and 19 568708001170 12 probable transmembrane helices predicted for STM_MW07471 by TMHMM2.0 at aa 20-42, 57-79, 88-110, 120-142, 163-185, 189-211, 239-261, 276-298, 305-327, 337-356, 369-391 and 401-423 568708001172 6 probable transmembrane helices predicted for STM_MW07481 by TMHMM2.0 at aa 112-134, 154-176, 230-252, 262-284, 305-322 and 327-349 568708001186 12 probable transmembrane helices predicted for STM_MW07581 by TMHMM2.0 at aa 9-31, 37-59, 89-111, 121-143, 150-172, 187-206, 227-249, 269-291, 325-342, 352-374, 387-405 and 410-429 568708001195 3 probable transmembrane helices predicted for STM_MW07611 by TMHMM2.0 at aa 399-421, 428-450 and 476-498 568708001199 1 probable transmembrane helix predicted for STM_MW07621 by TMHMM2.0 at aa 12-34 568708001200 Signal peptide predicted for STM_MW07621 by SignalP 2.0 HMM (Signal peptide probability 0.916) with cleavage site probability 0.662 between residues 28 and 29 568708001201 7 probable transmembrane helices predicted for STM_MW07631 by TMHMM2.0 at aa 37-59, 63-85, 220-242, 252-274, 578-600, 615-634 and 654-676 568708001205 12 probable transmembrane helices predicted for STM_MW07641 by TMHMM2.0 at aa 5-27, 62-84, 130-152, 173-195, 253-275, 282-301, 325-347, 354-376, 380-399, 419-438, 483-505 and 526-548 568708001206 Signal peptide predicted for STM_MW07641 by SignalP 2.0 HMM (Signal peptide probability 0.982) with cleavage site probability 0.975 between residues 20 and 21 568708001208 1 probable transmembrane helix predicted for STM_MW07651 by TMHMM2.0 at aa 12-33 568708001211 14 probable transmembrane helices predicted for STM_MW07671 by TMHMM2.0 at aa 13-35, 50-67, 72-94, 98-117, 138-157, 167-189, 209-231, 235-254, 267-284, 310-332, 344-366, 376-398, 410-432 and 462-479 568708001218 Signal peptide predicted for STM_MW07761 by SignalP 2.0 HMM (Signal peptide probability 0.990) with cleavage site probability 0.536 between residues 19 and 20 568708001224 6 probable transmembrane helices predicted for STM_MW07791 by TMHMM2.0 at aa 29-51, 66-88, 108-130, 140-162, 169-188 and 224-246 568708001232 6 probable transmembrane helices predicted for STM_MW07861 by TMHMM2.0 at aa 21-43, 53-75, 116-135, 145-167, 234-256 and 289-311 568708001235 3 probable transmembrane helices predicted for STM_MW07891 by TMHMM2.0 at aa 27-49, 69-88 and 109-128 568708001237 3 probable transmembrane helices predicted for STM_MW07901 by TMHMM2.0 at aa 16-38, 48-70 and 91-113 568708001250 9 probable transmembrane helices predicted for STM_MW07971 by TMHMM2.0 at aa 20-42, 54-76, 96-118, 130-152, 184-206, 219-238, 387-409, 421-443 and 472-494 568708001251 8 probable transmembrane helices predicted for STM_MW07981 by TMHMM2.0 at aa 7-24, 77-99, 122-144, 159-181, 202-224, 262-281, 293-315 and 335-357 568708001253 Signal peptide predicted for STM_MW07991 by SignalP 2.0 HMM (Signal peptide probability 0.985) with cleavage site probability 0.695 between residues 23 and 24 568708001255 1 probable transmembrane helix predicted for STM_MW07991 by TMHMM2.0 at aa 2-24 568708001257 3 probable transmembrane helices predicted for STM_MW08001 by TMHMM2.0 at aa 13-32, 42-64 and 69-91 568708001259 3 probable transmembrane helices predicted for STM_MW08021 by TMHMM2.0 at aa 15-37, 133-155 and 170-192 568708001262 1 probable transmembrane helix predicted for STM_MW08031 by TMHMM2.0 at aa 17-39 568708001263 1 probable transmembrane helix predicted for STM_MW08041 by TMHMM2.0 at aa 13-35 568708001265 Signal peptide predicted for STM_MW08051 by SignalP 2.0 HMM (Signal peptide probability 0.995) with cleavage site probability 0.993 between residues 21 and 22 568708001268 peptidoglycan-associated outer membrane lipoprotein; Provisional; Region: PRK10802 568708001269 Peptidoglycan binding domains similar to the C-terminal domain of outer-membrane protein OmpA; Region: OmpA_C-like; cd07185 568708001270 ligand binding site [chemical binding]; other site 568708001271 Signal peptide predicted for STM_MW08061 by SignalP 2.0 HMM (Signal peptide probability 0.961) with cleavage site probability 0.451 between residues 26 and 27 568708001273 Signal peptide predicted for STM_MW08071 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.992 between residues 26 and 27 568708001275 6 probable transmembrane helices predicted for STM_MW08091 by TMHMM2.0 at aa 20-42, 49-68, 72-89, 110-127, 158-177 and 184-206 568708001278 5 probable transmembrane helices predicted for STM_MW08101 by TMHMM2.0 at aa 21-43, 53-71, 84-106, 121-143 and 164-183 568708001279 Signal peptide predicted for STM_MW08111 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 24 and 25 568708001287 12 probable transmembrane helices predicted for STM_MW08171 by TMHMM2.0 at aa 2-19, 23-42, 54-76, 91-124, 137-159, 174-196, 221-240, 250-267, 272-294, 304-326, 360-379 and 399-421 568708001290 1 probable transmembrane helix predicted for STM_MW08181 by TMHMM2.0 at aa 10-32 568708001294 9 probable transmembrane helices predicted for STM_MW08201 by TMHMM2.0 at aa 13-35, 42-64, 125-147, 160-182, 214-236, 266-288, 308-327, 339-361 and 409-431 568708001297 9 probable transmembrane helices predicted for STM_MW08221 by TMHMM2.0 at aa 30-49, 81-103, 115-137, 142-161, 174-196, 216-236, 268-290, 305-324 and 331-353 568708001308 1 probable transmembrane helix predicted for STM_MW08291 by TMHMM2.0 at aa 271-293 568708001310 Signal peptide predicted for STM_MW08291 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 24 and 25 568708001315 1 probable transmembrane helix predicted for STM_MW08321 by TMHMM2.0 at aa 42-64 568708001316 Signal peptide predicted for STM_MW08331 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 24 and 25 568708001318 5 probable transmembrane helices predicted for STM_MW08341 by TMHMM2.0 at aa 15-37, 49-71, 86-108, 136-158 and 197-219 568708001325 Signal peptide predicted for STM_MW08381 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.861 between residues 23 and 24 568708001350 7 probable transmembrane helices predicted for STM_MW08591 by TMHMM2.0 at aa 20-42, 57-76, 88-107, 112-131, 138-160, 165-184 and 209-231 568708001352 7 probable transmembrane helices predicted for STM_MW08601 by TMHMM2.0 at aa 21-43, 48-70, 77-99, 103-125, 132-154, 159-181 and 202-224 568708001353 4 probable transmembrane helices predicted for STM_MW08611 by TMHMM2.0 at aa 64-83, 93-115, 120-142 and 157-179 568708001354 4 probable transmembrane helices predicted for STM_MW08621 by TMHMM2.0 at aa 44-66, 81-103, 115-137 and 147-169 568708001355 8 probable transmembrane helices predicted for STM_MW08631 by TMHMM2.0 at aa 13-30, 50-72, 85-107, 127-149, 162-184, 204-226, 233-255 and 281-303 568708001357 Signal peptide predicted for STM_MW08631 by SignalP 2.0 HMM (Signal peptide probability 0.968) with cleavage site probability 0.923 between residues 31 and 32 568708001361 4 probable transmembrane helices predicted for STM_MW08661 by TMHMM2.0 at aa 13-32, 36-58, 79-96 and 100-119 568708001362 6 probable transmembrane helices predicted for STM_MW08671 by TMHMM2.0 at aa 24-46, 173-195, 223-245, 255-277, 284-303 and 338-360 568708001364 6 probable transmembrane helices predicted for STM_MW08681 by TMHMM2.0 at aa 26-48, 181-203, 230-252, 262-284, 291-313 and 347-369 568708001368 1 probable transmembrane helix predicted for STM_MW08701 by TMHMM2.0 at aa 5-27 568708001369 Signal peptide predicted for STM_MW08701 by SignalP 2.0 HMM (Signal peptide probability 0.994) with cleavage site probability 0.948 between residues 19 and 20 568708001378 Signal peptide predicted for STM_MW08751 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.997 between residues 22 and 23 568708001381 11 probable transmembrane helices predicted for STM_MW08781 by TMHMM2.0 at aa 5-27, 136-158, 179-201, 216-238, 267-284, 294-313, 333-355, 370-392, 427-449, 464-486 and 507-529 568708001383 Signal peptide predicted for STM_MW08781 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.912 between residues 18 and 19 568708001385 5 probable transmembrane helices predicted for STM_MW08801 by TMHMM2.0 at aa 20-42, 55-77, 92-114, 155-177 and 187-209 568708001388 Signal peptide predicted for STM_MW08811 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 22 and 23 568708001390 10 probable transmembrane helices predicted for STM_MW08831 by TMHMM2.0 at aa 7-24, 37-59, 72-89, 93-115, 122-139, 143-165, 177-199, 203-225, 238-257 and 261-283 568708001392 Signal peptide predicted for STM_MW08831 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.891 between residues 31 and 32 568708001393 Signal peptide predicted for STM_MW08841 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 23 and 24 568708001395 1 probable transmembrane helix predicted for STM_MW08841 by TMHMM2.0 at aa 7-29 568708001396 pfam_scan;Pfam:PF00884; E()=1.9E-51;score=174.3;query 219-488;description=Sulfatase; tmhmm; query 1-526 568708001400 Signal peptide predicted for STM_MW08871 by SignalP 2.0 HMM (Signal peptide probability 0.971) with cleavage site probability 0.971 between residues 35 and 36 568708001401 9 probable transmembrane helices predicted for STM_MW08871 by TMHMM2.0 at aa 13-32, 42-64, 84-106, 165-187, 223-242, 246-268, 281-303, 313-335 and 347-369 568708001404 1 probable transmembrane helix predicted for STM_MW08881 by TMHMM2.0 at aa 7-29 568708001405 Signal peptide predicted for STM_MW08881 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.988 between residues 24 and 25 568708001421 Signal peptide predicted for STM_MW09001 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.982 between residues 26 and 27 568708001423 Signal peptide predicted for STM_MW09011 by SignalP 2.0 HMM (Signal peptide probability 0.619) with cleavage site probability 0.435 between residues 29 and 30 568708001424 6 probable transmembrane helices predicted for STM_MW09011 by TMHMM2.0 at aa 9-31, 101-123, 135-157, 172-189, 227-249 and 278-300 568708001426 6 probable transmembrane helices predicted for STM_MW09021 by TMHMM2.0 at aa 39-61, 107-129, 136-158, 163-185, 209-231 and 266-288 568708001443 3 probable transmembrane helices predicted for STM_MW09111 by TMHMM2.0 at aa 7-29, 53-75 and 96-118 568708001448 Signal peptide predicted for STM_MW09141 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 27 and 28 568708001453 4 probable transmembrane helices predicted for STM_MW09161 by TMHMM2.0 at aa 26-48, 60-82, 126-148 and 155-177 568708001455 12 probable transmembrane helices predicted for STM_MW09171 by TMHMM2.0 at aa 16-38, 53-72, 84-101, 111-130, 142-164, 169-188, 220-242, 257-279, 286-308, 313-335, 348-367 and 377-399 568708001458 12 probable transmembrane helices predicted for STM_MW09191 by TMHMM2.0 at aa 13-35, 50-72, 79-101, 105-124, 145-164, 168-190, 211-233, 253-275, 282-301, 305-327, 340-362 and 367-389 568708001460 Signal peptide predicted for STM_MW09191 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.955 between residues 29 and 30 568708001462 9 probable transmembrane helices predicted for STM_MW09211 by TMHMM2.0 at aa 13-35, 64-86, 93-115, 159-181, 383-402, 406-428, 449-471, 476-498 and 535-557 568708001465 Signal peptide predicted for STM_MW09221 by SignalP 2.0 HMM (Signal peptide probability 0.883) with cleavage site probability 0.349 between residues 36 and 37 568708001467 4 probable transmembrane helices predicted for STM_MW09221 by TMHMM2.0 at aa 7-29, 34-56, 61-83 and 93-115 568708001470 2 probable transmembrane helices predicted for STM_MW09241 by TMHMM2.0 at aa 13-35 and 45-67 568708001474 Signal peptide predicted for STM_MW09281 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.946 between residues 26 and 27 568708001478 6 probable transmembrane helices predicted for STM_MW09301 by TMHMM2.0 at aa 31-52, 100-122, 135-157, 185-207, 228-250 and 284-306 568708001480 6 probable transmembrane helices predicted for STM_MW09311 by TMHMM2.0 at aa 13-35, 69-91, 104-126, 141-163, 184-206 and 242-264 568708001482 4 probable transmembrane helices predicted for STM_MW09321 by TMHMM2.0 at aa 13-35, 60-82, 89-111 and 126-148 568708001485 11 probable transmembrane helices predicted for STM_MW09341 by TMHMM2.0 at aa 15-37, 44-66, 103-125, 132-154, 159-181, 233-255, 270-292, 330-352, 356-378, 385-407 and 422-444 568708001490 Signal peptide predicted for STM_MW09371 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.987 between residues 19 and 20 568708001491 5 probable transmembrane helices predicted for STM_MW09381 by TMHMM2.0 at aa 15-37, 46-68, 83-105, 155-174 and 189-211 568708001493 4 probable transmembrane helices predicted for STM_MW09391 by TMHMM2.0 at aa 10-32, 45-67, 101-118 and 201-223 568708001495 Signal peptide predicted for STM_MW09391 by SignalP 2.0 HMM (Signal peptide probability 0.978) with cleavage site probability 0.719 between residues 29 and 30 568708001497 Signal peptide predicted for STM_MW09401 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.997 between residues 19 and 20 568708001499 Signal peptide predicted for STM_MW09421 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.788 between residues 27 and 28 568708001501 Signal peptide predicted for STM_MW09441 by SignalP 2.0 HMM (Signal peptide probability 0.928) with cleavage site probability 0.563 between residues 20 and 21 568708001514 6 probable transmembrane helices predicted for STM_MW09511 by TMHMM2.0 at aa 25-47, 75-97, 102-119, 131-153, 168-190 and 239-261 568708001518 Signal peptide predicted for STM_MW09541 by SignalP 2.0 HMM (Signal peptide probability 0.838) with cleavage site probability 0.809 between residues 25 and 26 568708001519 1 probable transmembrane helix predicted for STM_MW09541 by TMHMM2.0 at aa 13-30 568708001521 pfam_scan;Pfam:PF00005; E()=1.8E-44;score=151.8;query 34-202;description=ABC_tran; pfam_scan;Pfam:PF02687; E()=2.0E-28;score=98.5;query469-640;description=FtsX; tmhmm; query 1-648 568708001537 S1_IF1: Translation Initiation Factor IF1, S1-like RNA-binding domain. IF1 contains an S1-like RNA-binding domain, which is found in a wide variety of RNA-associated proteins. Translation initiation includes a number of interrelated steps preceding the...; Region: S1_IF1; cd04451 568708001538 rRNA binding site [nucleotide binding]; other site 568708001539 predicted 30S ribosome binding site; other site 568708001541 1 probable transmembrane helix predicted for STM_MW09661 by TMHMM2.0 at aa 29-51 568708001544 6 probable transmembrane helices predicted for STM_MW09681 by TMHMM2.0 at aa 20-42, 47-69, 133-155, 160-182, 246-268 and 278-300 568708001546 Signal peptide predicted for STM_MW09681 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.650 between residues 49 and 50 568708001548 6 probable transmembrane helices predicted for STM_MW09691 by TMHMM2.0 at aa 24-46, 61-80, 137-159, 163-185, 245-267 and 282-304 568708001550 Signal peptide predicted for STM_MW09691 by SignalP 2.0 HMM (Signal peptide probability 0.618) with cleavage site probability 0.535 between residues 42 and 43 568708001553 Signal peptide predicted for STM_MW09701 by SignalP 2.0 HMM (Signal peptide probability 0.987) with cleavage site probability 0.968 between residues 25 and 26 568708001554 leucine-responsive transcriptional regulator; Provisional; Region: PRK11169 568708001555 Helix-turn-helix domains; Region: HTH; cl00088 568708001557 5 probable transmembrane helices predicted for STM_MW09721 by TMHMM2.0 at aa 41-63, 94-116, 129-151, 156-177 and 184-206 568708001560 Signal peptide predicted for STM_MW09731 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.994 between residues 22 and 23 568708001565 Signal peptide predicted for STM_MW09761 by SignalP 2.0 HMM (Signal peptide probability 0.961) with cleavage site probability 0.950 between residues 45 and 46 568708001571 8 probable transmembrane helices predicted for STM_MW09781 by TMHMM2.0 at aa 10-32, 44-66, 88-107, 114-134, 149-171, 178-200, 227-246 and 253-275 568708001572 Signal peptide predicted for STM_MW09791 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.629 between residues 23 and 24 568708001573 12 probable transmembrane helices predicted for STM_MW09791 by TMHMM2.0 at aa 7-29, 44-66, 73-95, 100-119, 131-150, 160-182, 204-226, 231-253, 265-284, 289-311, 320-342 and 352-369 568708001575 11 probable transmembrane helices predicted for STM_MW09801 by TMHMM2.0 at aa 10-29, 36-58, 127-146, 158-180, 195-217, 238-260, 287-309, 340-362, 377-399, 412-434 and 444-466 568708001581 6 probable transmembrane helices predicted for STM_MW09851 by TMHMM2.0 at aa 35-57, 77-99, 119-141, 161-183, 195-217 and 256-278 568708001584 3 probable transmembrane helices predicted for STM_MW09871 by TMHMM2.0 at aa 15-37, 50-69 and 74-91 568708001588 Signal peptide predicted for STM_MW09901 by SignalP 2.0 HMM (Signal peptide probability 0.993) with cleavage site probability 0.678 between residues 18 and 19 568708001593 11 probable transmembrane helices predicted for STM_MW09941 by TMHMM2.0 at aa 5-22, 26-43, 50-69, 224-246, 259-281, 301-323, 328-346, 361-383, 390-412, 427-449 and 469-491 568708001596 Signal peptide predicted for STM_MW09951 by SignalP 2.0 HMM (Signal peptide probability 0.612) with cleavage site probability 0.371 between residues 38 and 39 568708001597 5 probable transmembrane helices predicted for STM_MW09951 by TMHMM2.0 at aa 21-43, 63-94, 140-162, 167-186 and 245-267 568708001600 1 probable transmembrane helix predicted for STM_MW09961 by TMHMM2.0 at aa 12-34 568708001607 2 probable transmembrane helices predicted for STM_MW10011 by TMHMM2.0 at aa 10-32 and 41-58 568708001608 Signal peptide predicted for STM_MW10011 by SignalP 2.0 HMM (Signal peptide probability 0.897) with cleavage site probability 0.626 between residues 28 and 29 568708001613 Signal peptide predicted for STM_MW10061 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.991 between residues 30 and 31 568708001616 Signal peptide predicted for STM_MW10071 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 30 and 31 568708001617 1 probable transmembrane helix predicted for STM_MW10071 by TMHMM2.0 at aa 12-34 568708001622 Signal peptide predicted for STM_MW10101 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 22 and 23 568708001628 11 probable transmembrane helices predicted for STM_MW10141 by TMHMM2.0 at aa 13-35, 76-98, 103-125, 152-174, 189-211, 218-240, 250-272, 314-336, 356-378, 399-418 and 422-439 568708001631 BTP2 568708001646 Signal peptide predicted for STM_MW10371 by SignalP 2.0 HMM (Signal peptide probability 0.964) with cleavage site probability 0.767 between residues 31 and 32 568708001647 1 probable transmembrane helix predicted for STM_MW10371 by TMHMM2.0 at aa 9-31 568708001650 2 probable transmembrane helices predicted for STM_MW10392 by TMHMM2.0 at aa 20-37 and 50-72 568708001652 Signal peptide predicted for STM_MW10401 by SignalP 2.0 HMM (Signal peptide probability 0.934) with cleavage site probability 0.701 between residues 24 and 25 568708001668 Signal peptide predicted for STM_MW10541 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.997 between residues 22 and 23 568708001670 1 probable transmembrane helix predicted for STM_MW10541 by TMHMM2.0 at aa 4-25 568708001672 Signal peptide predicted for STM_MW10551 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 20 and 21 568708001676 1 probable transmembrane helix predicted for STM_MW10581 by TMHMM2.0 at aa 50-72 568708001701 8 probable transmembrane helices predicted for STM_MW10761 by TMHMM2.0 at aa 54-76, 100-122, 135-157, 162-184, 255-277, 304-326, 350-372 and 377-399 568708001702 1 probable transmembrane helix predicted for STM_MW10771 by TMHMM2.0 at aa 16-38 568708001704 Signal peptide predicted for STM_MW10781 by SignalP 2.0 HMM (Signal peptide probability 0.995) with cleavage site probability 0.634 between residues 19 and 20 568708001712 Signal peptide predicted for STM_MW10831 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.997 between residues 21 and 22 568708001716 7 probable transmembrane helices predicted for STM_MW10861 by TMHMM2.0 at aa 13-35, 86-108, 115-137, 141-163, 438-460, 484-503 and 510-532 568708001719 3 probable transmembrane helices predicted for STM_MW10871 by TMHMM2.0 at aa 15-37, 77-99 and 104-126 568708001723 Signal peptide predicted for STM_MW10901 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.996 between residues 20 and 21 568708001727 Signal peptide predicted for STM_MW10941 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.602 between residues 21 and 22 568708001733 6 probable transmembrane helices predicted for STM_MW10981 by TMHMM2.0 at aa 15-37, 49-71, 76-98, 105-127, 132-154 and 167-189 568708001741 2 probable transmembrane helices predicted for STM_MW11051 by TMHMM2.0 at aa 10-32 and 162-181 568708001743 Signal peptide predicted for STM_MW11051 by SignalP 2.0 HMM (Signal peptide probability 0.964) with cleavage site probability 0.370 between residues 31 and 32 568708001746 Signal peptide predicted for STM_MW11071 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.936 between residues 22 and 23 568708001747 1 probable transmembrane helix predicted for STM_MW11071 by TMHMM2.0 at aa 5-24 568708001759 12 probable transmembrane helices predicted for STM_MW11171 by TMHMM2.0 at aa 32-54, 69-88, 101-123, 133-155, 162-184, 194-216, 270-292, 305-327, 340-357, 361-383, 396-418 and 428-447 568708001766 Signal peptide predicted for STM_MW11240 by SignalP 2.0 HMM (Signal peptide probability 0.928) with cleavage site probability 0.530 between residues 28 and 29 568708001767 2 probable transmembrane helices predicted for STM_MW11240 by TMHMM2.0 at aa 7-29 and 66-88 568708001768 Signal peptide predicted for STM_MW11241 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.996 between residues 22 and 23 568708001769 6 probable transmembrane helices predicted for STM_MW11241 by TMHMM2.0 at aa 280-302, 323-345, 360-382, 409-431, 436-458 and 479-501 568708001772 Signal peptide predicted for STM_MW11251 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.994 between residues 18 and 19 568708001774 1 probable transmembrane helix predicted for STM_MW11261 by TMHMM2.0 at aa 12-29 568708001776 Signal peptide predicted for STM_MW11271 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 22 and 23 568708001783 Signal peptide predicted for STM_MW11321 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 19 and 20 568708001786 12 probable transmembrane helices predicted for STM_MW11341 by TMHMM2.0 at aa 7-26, 66-88, 125-147, 162-184, 191-213, 233-255, 276-298, 313-335, 372-391, 401-423, 428-450 and 455-473 568708001791 13 probable transmembrane helices predicted for STM_MW11371 by TMHMM2.0 at aa 6-28, 41-63, 78-100, 120-142, 157-179, 186-208, 228-247, 280-299, 314-336, 376-398, 403-425, 432-454 and 458-480 568708001794 Signal peptide predicted for STM_MW11391 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.963 between residues 29 and 30 568708001795 1 probable transmembrane helix predicted for STM_MW11391 by TMHMM2.0 at aa 13-32 568708001797 Signal peptide predicted for STM_MW11401 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 22 and 23 568708001799 12 probable transmembrane helices predicted for STM_MW11411 by TMHMM2.0 at aa 20-42, 57-76, 88-110, 114-136, 143-165, 169-188, 230-252, 267-286, 299-316, 321-343, 360-382 and 387-409 568708001806 6 probable transmembrane helices predicted for STM_MW11461 by TMHMM2.0 at aa 12-31, 36-58, 65-84, 88-110, 115-134 and 144-166 568708001810 1 probable transmembrane helix predicted for STM_MW11481 by TMHMM2.0 at aa 7-26 568708001811 Signal peptide predicted for STM_MW11481 by SignalP 2.0 HMM (Signal peptide probability 0.996) with cleavage site probability 0.995 between residues 19 and 20 568708001813 Signal peptide predicted for STM_MW11491 by SignalP 2.0 HMM (Signal peptide probability 0.903) with cleavage site probability 0.901 between residues 22 and 23 568708001815 Signal peptide predicted for STM_MW11511 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.963 between residues 21 and 22 568708001817 Signal peptide predicted for STM_MW11521 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 20 and 21 568708001820 Signal peptide predicted for STM_MW11541 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.981 between residues 25 and 26 568708001821 1 probable transmembrane helix predicted for STM_MW11541 by TMHMM2.0 at aa 7-29 568708001824 10 probable transmembrane helices predicted for STM_MW11571 by TMHMM2.0 at aa 17-39, 54-76, 88-110, 138-160, 181-203, 213-232, 245-262, 277-299, 306-328 and 338-360 568708001825 Signal peptide predicted for STM_MW11581 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.997 between residues 22 and 23 568708001827 6 probable transmembrane helices predicted for STM_MW11591 by TMHMM2.0 at aa 139-156, 194-216, 512-534, 568-590, 603-625 and 680-702 568708001830 11 probable transmembrane helices predicted for STM_MW11621 by TMHMM2.0 at aa 15-37, 49-68, 83-101, 108-130, 140-162, 169-191, 222-244, 251-273, 288-306, 313-335 and 371-393 568708001832 Signal peptide predicted for STM_MW11621 by SignalP 2.0 HMM (Signal peptide probability 0.641) with cleavage site probability 0.479 between residues 29 and 30 568708001834 2 probable transmembrane helices predicted for STM_MW11631 by TMHMM2.0 at aa 20-42 and 123-145 568708001837 Signal peptide predicted for STM_MW11651 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 22 and 23 568708001839 4 probable transmembrane helices predicted for STM_MW11661 by TMHMM2.0 at aa 13-35, 55-72, 92-114 and 147-169 568708001843 Signal peptide predicted for STM_MW11721 by SignalP 2.0 HMM (Signal peptide probability 0.987) with cleavage site probability 0.483 between residues 18 and 19 568708001845 10 probable transmembrane helices predicted for STM_MW11741 by TMHMM2.0 at aa 13-35, 99-116, 136-158, 163-185, 210-232, 247-264, 277-295, 300-322, 335-357 and 367-389 568708001851 13 probable transmembrane helices predicted for STM_MW11781 by TMHMM2.0 at aa 39-58, 95-117, 143-165, 172-194, 199-221, 250-272, 287-309, 322-341, 361-383, 396-415, 420-442, 454-476 and 491-513 568708001856 Signal peptide predicted for STM_MW11811 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 21 and 22 568708001868 1 probable transmembrane helix predicted for STM_MW11881 by TMHMM2.0 at aa 5-27 568708001870 Signal peptide predicted for STM_MW11891 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.996 between residues 19 and 20 568708001891 Phosphopantetheine attachment site; Region: PP-binding; cl09936 568708001901 9 probable transmembrane helices predicted for STM_MW12121 by TMHMM2.0 at aa 15-37, 49-71, 81-103, 116-138, 153-175, 248-270, 280-302, 309-331 and 354-376 568708001905 Signal peptide predicted for STM_MW12131 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 35 and 36 568708001907 Signal peptide predicted for STM_MW12151 by SignalP 2.0 HMM (Signal peptide probability 0.650) with cleavage site probability 0.635 between residues 20 and 21 568708001909 Signal peptide predicted for STM_MW12161 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.999 between residues 22 and 23 568708001915 Signal peptide predicted for STM_MW12211 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.671 between residues 23 and 24 568708001916 1 probable transmembrane helix predicted for STM_MW12211 by TMHMM2.0 at aa 5-27 568708001919 Signal peptide predicted for STM_MW12231 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.973 between residues 22 and 23 568708001920 1 probable transmembrane helix predicted for STM_MW12231 by TMHMM2.0 at aa 7-29 568708001924 1 probable transmembrane helix predicted for STM_MW12241 by TMHMM2.0 at aa 7-29 568708001925 Signal peptide predicted for STM_MW12241 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.990 between residues 28 and 29 568708001930 4 probable transmembrane helices predicted for STM_MW12261 by TMHMM2.0 at aa 62-84, 303-325, 355-377 and 397-419 568708001933 4 probable transmembrane helices predicted for STM_MW12281 by TMHMM2.0 at aa 21-43, 270-292, 318-340 and 375-397 568708001938 Signal peptide predicted for STM_MW12311 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 23 and 24 568708001939 6 probable transmembrane helices predicted for STM_MW12321 by TMHMM2.0 at aa 5-27, 64-86, 99-121, 126-148, 176-195 and 230-252 568708001942 6 probable transmembrane helices predicted for STM_MW12341 by TMHMM2.0 at aa 9-31, 69-91, 98-120, 151-173, 194-216 and 250-272 568708001948 Signal peptide; signalp; query 1-26;cleavage_site_probability=0.983; 0.983 568708001953 2 probable transmembrane helices predicted for STM_MW12401 by TMHMM2.0 at aa 20-42 and 194-216 568708001955 Signal peptide predicted for STM_MW12401 by SignalP 2.0 HMM (Signal peptide probability 0.982) with cleavage site probability 0.297 between residues 31 and 32 568708001964 Signal peptide predicted for STM_MW12461 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.986 between residues 18 and 19 568708001967 Signal peptide predicted for STM_MW12501 by SignalP 2.0 HMM (Signal peptide probability 0.963) with cleavage site probability 0.957 between residues 25 and 26 568708001970 Signal peptide predicted for STM_MW12521 by SignalP 2.0 HMM (Signal peptide probability 0.921) with cleavage site probability 0.763 between residues 25 and 26 568708001972 Signal peptide predicted for STM_MW12541 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.993 between residues 20 and 21 568708001975 Signal peptide predicted for STM_MW12561 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.928 between residues 24 and 25 568708001978 4 probable transmembrane helices predicted for STM_MW12601 by TMHMM2.0 at aa 9-31, 46-63, 88-110 and 140-162 568708001979 Signal peptide predicted for STM_MW12601 by SignalP 2.0 HMM (Signal peptide probability 0.893) with cleavage site probability 0.892 between residues 24 and 25 568708001980 1 probable transmembrane helix predicted for STM_MW12611 by TMHMM2.0 at aa 7-29 568708001981 Signal peptide predicted for STM_MW12611 by SignalP 2.0 HMM (Signal peptide probability 0.738) with cleavage site probability 0.321 between residues 28 and 29 568708001982 Signal peptide predicted for STM_MW12621 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.976 between residues 39 and 40 568708001983 1 probable transmembrane helix predicted for STM_MW12621 by TMHMM2.0 at aa 21-40 568708001985 Signal peptide predicted for STM_MW12631 by SignalP 2.0 HMM (Signal peptide probability 0.985) with cleavage site probability 0.944 between residues 27 and 28 568708001986 4 probable transmembrane helices predicted for STM_MW12631 by TMHMM2.0 at aa 7-29, 104-126, 139-161 and 291-313 568708001988 Signal peptide predicted for STM_MW12641 by SignalP 2.0 HMM (Signal peptide probability 0.966) with cleavage site probability 0.858 between residues 28 and 29 568708001989 4 probable transmembrane helices predicted for STM_MW12641 by TMHMM2.0 at aa 7-29, 74-96, 117-139 and 236-253 568708001994 5 probable transmembrane helices predicted for STM_MW12671 by TMHMM2.0 at aa 20-42, 74-90, 97-114, 136-158 and 165-187 568708001996 Signal peptide predicted for STM_MW12691 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.968 between residues 22 and 23 568708002002 Signal peptide predicted for STM_MW12751 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.996 between residues 20 and 21 568708002004 6 probable transmembrane helices predicted for STM_MW12761 by TMHMM2.0 at aa 10-32, 45-67, 77-99, 120-142, 157-179 and 191-210 568708002008 Signal peptide predicted for STM_MW12791 by SignalP 2.0 HMM (Signal peptide probability 0.987) with cleavage site probability 0.900 between residues 24 and 25 568708002009 4 probable transmembrane helices predicted for STM_MW12791 by TMHMM2.0 at aa 7-25, 40-59, 71-90 and 100-122 568708002010 3 probable transmembrane helices predicted for STM_MW12811 by TMHMM2.0 at aa 4-21, 28-50 and 60-77 568708002014 12 probable transmembrane helices predicted for STM_MW12851 by TMHMM2.0 at aa 12-31, 46-68, 81-98, 103-125, 137-159, 163-185, 217-239, 249-271, 278-297, 302-324, 333-355 and 365-387 568708002016 Signal peptide predicted for STM_MW12851 by SignalP 2.0 HMM (Signal peptide probability 0.638) with cleavage site probability 0.471 between residues 33 and 34 568708002019 4 probable transmembrane helices predicted for STM_MW12862 by TMHMM2.0 at aa 12-34, 49-71, 76-98 and 124-146 568708002021 Signal peptide predicted for STM_MW12862 by SignalP 2.0 HMM (Signal peptide probability 0.975) with cleavage site probability 0.511 between residues 24 and 25 568708002023 2 probable transmembrane helices predicted for STM_MW12891 by TMHMM2.0 at aa 7-29 and 305-327 568708002028 Signal peptide predicted for STM_MW12921 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.990 between residues 22 and 23 568708002040 1 probable transmembrane helix predicted for STM_MW13021 by TMHMM2.0 at aa 21-43 568708002048 Signal peptide predicted for STM_MW13071 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.921 between residues 19 and 20 568708002057 Signal peptide predicted for STM_MW13151 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 23 and 24 568708002061 Signal peptide predicted for STM_MW13181 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.918 between residues 23 and 24 568708002063 Signal peptide predicted for STM_MW13191 by SignalP 2.0 HMM (Signal peptide probability 0.688) with cleavage site probability 0.538 between residues 27 and 28 568708002066 10 probable transmembrane helices predicted for STM_MW13201 by TMHMM2.0 at aa 31-53, 85-107, 114-133, 143-165, 186-208, 232-254, 302-321, 341-363, 370-392 and 407-429 568708002076 9 probable transmembrane helices predicted for STM_MW13271 by TMHMM2.0 at aa 5-22, 34-51, 71-93, 105-127, 180-202, 260-282, 340-362, 369-391 and 395-417 568708002077 Signal peptide predicted for STM_MW13271 by SignalP 2.0 HMM (Signal peptide probability 0.887) with cleavage site probability 0.343 between residues 20 and 21 568708002079 2 probable transmembrane helices predicted for STM_MW13281 by TMHMM2.0 at aa 72-94 and 109-131 568708002081 3 probable transmembrane helices predicted for STM_MW13301 by TMHMM2.0 at aa 16-38, 79-101 and 150-172 568708002085 Signal peptide predicted for STM_MW13341 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.805 between residues 25 and 26 568708002086 1 probable transmembrane helix predicted for STM_MW13341 by TMHMM2.0 at aa 7-24 568708002089 Signal peptide predicted for STM_MW13351 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.734 between residues 23 and 24 568708002090 2 probable transmembrane helices predicted for STM_MW13361 by TMHMM2.0 at aa 33-55 and 59-81 568708002092 11 probable transmembrane helices predicted for STM_MW13391 by TMHMM2.0 at aa 4-24, 31-53, 63-82, 102-121, 141-163, 168-185, 190-204, 211-233, 321-343, 355-377 and 381-403 568708002099 Ribosomal protein L35; Region: Ribosomal_L35p; cl00392 568708002108 Integration host factor (IHF) and HU are small heterodimeric members of the DNABII protein family that bind and bend DNA, functioning as architectural factors in many cellular processes including transcription, site-specific recombination, and...; Region: HU_IHF; cd00591 568708002109 IHF dimer interface [polypeptide binding]; other site 568708002110 IHF - DNA interface [nucleotide binding]; other site 568708002112 Signal peptide predicted for STM_MW13471 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.950 between residues 36 and 37 568708002113 9 probable transmembrane helices predicted for STM_MW13471 by TMHMM2.0 at aa 20-42, 62-84, 91-110, 114-136, 149-171, 191-208, 245-267, 277-299 and 306-325 568708002117 Signal peptide predicted for STM_MW13501 by SignalP 2.0 HMM (Signal peptide probability 0.714) with cleavage site probability 0.492 between residues 26 and 27 568708002129 Signal peptide predicted for STM_MW13591 by SignalP 2.0 HMM (Signal peptide probability 0.711) with cleavage site probability 0.694 between residues 25 and 26 568708002143 12 probable transmembrane helices predicted for STM_MW13671 by TMHMM2.0 at aa 12-34, 49-71, 78-97, 101-118, 138-160, 164-186, 212-234, 254-273, 280-298, 308-330, 343-365 and 370-392 568708002144 Signal peptide predicted for STM_MW13671 by SignalP 2.0 HMM (Signal peptide probability 0.826) with cleavage site probability 0.803 between residues 33 and 34 568708002146 11 probable transmembrane helices predicted for STM_MW13681 by TMHMM2.0 at aa 9-31, 41-63, 75-97, 133-155, 160-179, 207-229, 250-269, 273-295, 300-322, 337-356 and 363-385 568708002149 8 probable transmembrane helices predicted for STM_MW13701 by TMHMM2.0 at aa 13-32, 36-53, 65-87, 159-181, 202-224, 237-259, 266-288 and 308-330 568708002150 Signal peptide predicted for STM_MW13701 by SignalP 2.0 HMM (Signal peptide probability 0.608) with cleavage site probability 0.597 between residues 41 and 42 568708002155 11 probable transmembrane helices predicted for STM_MW13741 by TMHMM2.0 at aa 4-19, 32-51, 66-88, 101-123, 170-192, 220-242, 252-274, 286-308, 336-353, 358-380 and 384-406 568708002162 Signal peptide predicted for STM_MW13811 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.697 between residues 23 and 24 568708002167 13 probable transmembrane helices predicted for STM_MW13841 by TMHMM2.0 at aa 10-32, 39-61, 71-93, 95-114, 119-138, 147-169, 184-206, 227-249, 273-295, 330-347, 357-379, 386-405 and 409-428 568708002176 9 probable transmembrane helices predicted for STM_MW13891 by TMHMM2.0 at aa 23-45, 58-77, 92-114, 126-148, 163-185, 197-216, 236-255, 267-289 and 309-326 568708002178 Signal peptide predicted for STM_MW13911 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 24 and 25 568708002179 2 probable transmembrane helices predicted for STM_MW13911 by TMHMM2.0 at aa 9-31 and 305-327 568708002194 1 probable transmembrane helix predicted for STM_MW13971 by TMHMM2.0 at aa 20-42 568708002195 Signal peptide predicted for STM_MW13971 by SignalP 2.0 HMM (Signal peptide probability 0.976) with cleavage site probability 0.442 between residues 36 and 37 568708002198 1 probable transmembrane helix predicted for STM_MW14001 by TMHMM2.0 at aa 117-139 568708002205 2 probable transmembrane helices predicted for STM_MW14091 by TMHMM2.0 at aa 64-86 and 90-112 568708002206 2 probable transmembrane helices predicted for STM_MW14101 by TMHMM2.0 at aa 65-87 and 97-116 568708002210 Signal peptide predicted for STM_MW14141 by SignalP 2.0 HMM (Signal peptide probability 0.756) with cleavage site probability 0.748 between residues 18 and 19 568708002212 1 probable transmembrane helix predicted for STM_MW14141 by TMHMM2.0 at aa 223-245 568708002214 6 probable transmembrane helices predicted for STM_MW14191 by TMHMM2.0 at aa 24-41, 48-67, 115-137, 206-228, 248-270 and 291-313 568708002218 4 probable transmembrane helices predicted for STM_MW14241 by TMHMM2.0 at aa 10-31, 52-74, 154-176 and 189-211 568708002221 2 probable transmembrane helices predicted for STM_MW14251 by TMHMM2.0 at aa 13-35 and 55-77 568708002223 6 probable transmembrane helices predicted for STM_MW14261 by TMHMM2.0 at aa 7-29, 34-56, 68-90, 129-151, 183-205 and 215-237 568708002225 4 probable transmembrane helices predicted for STM_MW14271 by TMHMM2.0 at aa 21-43, 86-108, 146-168 and 178-200 568708002227 12 probable transmembrane helices predicted for STM_MW14281 by TMHMM2.0 at aa 12-34, 44-66, 91-113, 128-147, 160-180, 190-212, 241-263, 278-300, 313-335, 350-367, 387-409 and 419-438 568708002228 Signal peptide predicted for STM_MW14281 by SignalP 2.0 HMM (Signal peptide probability 0.836) with cleavage site probability 0.480 between residues 26 and 27 568708002232 11 probable transmembrane helices predicted for STM_MW14311 by TMHMM2.0 at aa 7-29, 39-61, 73-92, 97-119, 132-154, 159-178, 208-230, 235-257, 270-292, 296-318 and 339-361 568708002233 Signal peptide predicted for STM_MW14311 by SignalP 2.0 HMM (Signal peptide probability 0.933) with cleavage site probability 0.917 between residues 30 and 31 568708002241 Signal peptide predicted for STM_MW14351 by SignalP 2.0 HMM (Signal peptide probability 0.985) with cleavage site probability 0.814 between residues 38 and 39 568708002249 Signal peptide predicted for STM_MW14431 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.974 between residues 19 and 20 568708002252 12 probable transmembrane helices predicted for STM_MW14441 by TMHMM2.0 at aa 23-41, 46-65, 72-90, 94-113, 120-142, 157-179, 362-381, 385-404, 411-433, 438-455, 462-481 and 496-515 568708002254 1 probable transmembrane helix predicted for STM_MW14451 by TMHMM2.0 at aa 20-42 568708002255 2 probable transmembrane helices predicted for STM_MW14461 by TMHMM2.0 at aa 18-40 and 53-75 568708002258 Signal peptide predicted for STM_MW14481 by SignalP 2.0 HMM (Signal peptide probability 0.990) with cleavage site probability 0.725 between residues 21 and 22 568708002260 Signal peptide predicted for STM_MW14501 by SignalP 2.0 HMM (Signal peptide probability 0.703) with cleavage site probability 0.553 between residues 22 and 23 568708002269 14 probable transmembrane helices predicted for STM_MW14551 by TMHMM2.0 at aa 22-44, 59-81, 90-107, 112-129, 150-172, 177-199, 220-239, 244-261, 274-296, 323-340, 353-371, 386-408, 415-437 and 457-479 568708002275 5 probable transmembrane helices predicted for STM_MW14571 by TMHMM2.0 at aa 34-56, 69-87, 91-113, 126-148 and 183-205 568708002277 Signal peptide predicted for STM_MW14581 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.958 between residues 24 and 25 568708002279 10 probable transmembrane helices predicted for STM_MW14591 by TMHMM2.0 at aa 20-39, 43-62, 69-91, 95-117, 124-146, 214-236, 243-262, 272-294, 301-318 and 323-342 568708002280 Signal peptide predicted for STM_MW14591 by SignalP 2.0 HMM (Signal peptide probability 0.971) with cleavage site probability 0.568 between residues 33 and 34 568708002285 Signal peptide predicted for STM_MW14611 by SignalP 2.0 HMM (Signal peptide probability 0.995) with cleavage site probability 0.876 between residues 30 and 31 568708002286 1 probable transmembrane helix predicted for STM_MW14611 by TMHMM2.0 at aa 4-26 568708002288 6 probable transmembrane helices predicted for STM_MW14621 by TMHMM2.0 at aa 5-27, 42-64, 69-88, 103-125, 132-154 and 169-191 568708002290 4 probable transmembrane helices predicted for STM_MW14631 by TMHMM2.0 at aa 13-35, 55-77, 90-109 and 114-133 568708002291 Signal peptide predicted for STM_MW14631 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.785 between residues 39 and 40 568708002297 Signal peptide predicted for STM_MW14671 by SignalP 2.0 HMM (Signal peptide probability 0.945) with cleavage site probability 0.863 between residues 19 and 20 568708002305 2 probable transmembrane helices predicted for STM_MW14721 by TMHMM2.0 at aa 5-27 and 139-156 568708002307 Signal peptide predicted for STM_MW14721 by SignalP 2.0 HMM (Signal peptide probability 0.881) with cleavage site probability 0.715 between residues 28 and 29 568708002310 1 probable transmembrane helix predicted for STM_MW14741 by TMHMM2.0 at aa 5-22 568708002311 Signal peptide predicted for STM_MW14741 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 21 and 22 568708002314 4 probable transmembrane helices predicted for STM_MW14761 by TMHMM2.0 at aa 2-21, 25-47, 59-81 and 86-108 568708002316 13 probable transmembrane helices predicted for STM_MW14771 by TMHMM2.0 at aa 5-27, 37-59, 90-112, 127-149, 156-178, 205-222, 235-257, 277-299, 332-351, 356-378, 385-403, 408-427 and 440-459 568708002318 Signal peptide predicted for STM_MW14771 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.401 between residues 31 and 32 568708002320 Signal peptide predicted for STM_MW14781 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 22 and 23 568708002323 5 probable transmembrane helices predicted for STM_MW14791 by TMHMM2.0 at aa 169-191, 402-419, 423-445, 452-471 and 476-498 568708002324 9 probable transmembrane helices predicted for STM_MW14801 by TMHMM2.0 at aa 5-24, 33-50, 55-72, 85-107, 122-144, 164-181, 185-207, 214-236 and 240-259 568708002327 8 probable transmembrane helices predicted for STM_MW14811 by TMHMM2.0 at aa 5-24, 29-51, 63-85, 144-166, 196-218, 222-244, 257-279 and 299-321 568708002328 Signal peptide predicted for STM_MW14811 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.999 between residues 30 and 31 568708002329 4 probable transmembrane helices predicted for STM_MW14821 by TMHMM2.0 at aa 2-19, 29-51, 56-78 and 82-101 568708002332 4 probable transmembrane helices predicted for STM_MW14831 by TMHMM2.0 at aa 10-29, 36-53, 63-85 and 92-106 568708002334 Signal peptide predicted for STM_MW14841 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.625 between residues 19 and 20 568708002336 1 probable transmembrane helix predicted for STM_MW14851 by TMHMM2.0 at aa 16-38 568708002337 Signal peptide predicted for STM_MW14851 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 33 and 34 568708002338 12 probable transmembrane helices predicted for STM_MW14861 by TMHMM2.0 at aa 37-59, 74-95, 102-124, 128-150, 157-179, 189-211, 240-262, 272-291, 304-323, 328-350, 363-385 and 389-411 568708002344 10 probable transmembrane helices predicted for STM_MW14901 by TMHMM2.0 at aa 12-34, 66-83, 158-180, 185-207, 234-256, 271-293, 300-322, 332-354, 361-383 and 398-416 568708002346 Signal peptide predicted for STM_MW14901 by SignalP 2.0 HMM (Signal peptide probability 0.995) with cleavage site probability 0.860 between residues 37 and 38 568708002349 5 probable transmembrane helices predicted for STM_MW14921 by TMHMM2.0 at aa 22-44, 51-73, 78-100, 149-171 and 181-203 568708002352 Signal peptide predicted for STM_MW14931 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 23 and 24 568708002353 6 probable transmembrane helices predicted for STM_MW14941 by TMHMM2.0 at aa 9-31, 46-68, 89-111, 126-145, 173-195 and 205-227 568708002355 Signal peptide predicted for STM_MW14941 by SignalP 2.0 HMM (Signal peptide probability 0.819) with cleavage site probability 0.629 between residues 26 and 27 568708002358 8 probable transmembrane helices predicted for STM_MW14961 by TMHMM2.0 at aa 10-32, 44-66, 88-107, 114-136, 151-173, 180-202, 222-244 and 251-273 568708002363 Signal peptide predicted for STM_MW14981 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.994 between residues 45 and 46 568708002367 Signal peptide predicted for STM_MW14991 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.843 between residues 43 and 44 568708002368 1 probable transmembrane helix predicted for STM_MW14991 by TMHMM2.0 at aa 21-43 568708002370 Signal peptide predicted for STM_MW15001 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 22 and 23 568708002371 Signal peptide predicted for STM_MW15011 by SignalP 2.0 HMM (Signal peptide probability 0.756) with cleavage site probability 0.676 between residues 19 and 20 568708002375 Signal peptide predicted for STM_MW15031 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 28 and 29 568708002377 4 probable transmembrane helices predicted for STM_MW15041 by TMHMM2.0 at aa 7-26, 30-52, 59-78 and 83-105 568708002391 Signal peptide predicted for STM_MW15151 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 19 and 20 568708002393 pfam_scan;Pfam:PF07690; E()=1.1E-27;score=97.0;query13-337;description=MFS_1; tmhmm; query 1-391 568708002395 10 probable transmembrane helices predicted for STM_MW15171 by TMHMM2.0 at aa 7-24, 34-52, 59-81, 91-110, 117-136, 140-162, 174-196, 216-238, 245-264 and 268-290 568708002397 Signal peptide predicted for STM_MW15181 by SignalP 2.0 HMM (Signal peptide probability 0.996) with cleavage site probability 0.994 between residues 21 and 22 568708002401 6 probable transmembrane helices predicted for STM_MW15211 by TMHMM2.0 at aa 10-32, 44-66, 71-93, 117-139, 154-176 and 196-217 568708002402 12 probable transmembrane helices predicted for STM_MW15221 by TMHMM2.0 at aa 12-34, 49-71, 80-99, 109-131, 138-160, 170-189, 210-229, 244-266, 273-292, 302-324, 331-350 and 360-382 568708002409 3 probable transmembrane helices predicted for STM_MW15271 by TMHMM2.0 at aa 39-58, 63-81 and 229-251 568708002411 Signal peptide predicted for STM_MW15281 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.994 between residues 29 and 30 568708002419 4 probable transmembrane helices predicted for STM_MW15361 by TMHMM2.0 at aa 43-62, 82-104, 151-173 and 203-225 568708002423 Signal peptide predicted for STM_MW15381 by SignalP 2.0 HMM (Signal peptide probability 0.974) with cleavage site probability 0.965 between residues 45 and 46 568708002424 1 probable transmembrane helix predicted for STM_MW15381 by TMHMM2.0 at aa 21-43 568708002425 Signal peptide predicted for STM_MW15391 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.793 between residues 24 and 25 568708002432 12 probable transmembrane helices predicted for STM_MW15421 by TMHMM2.0 at aa 7-26, 46-68, 75-97, 101-123, 135-157, 162-184, 228-250, 265-287, 303-325, 329-350, 362-384 and 394-413 568708002434 1 probable transmembrane helix predicted for STM_MW15431 by TMHMM2.0 at aa 26-45 568708002435 11 probable transmembrane helices predicted for STM_MW15441 by TMHMM2.0 at aa 25-47, 57-79, 86-105, 110-132, 144-166, 171-193, 219-241, 261-283, 295-329, 349-371 and 378-400 568708002444 Signal peptide predicted for STM_MW15511 by SignalP 2.0 HMM (Signal peptide probability 0.663) with cleavage site probability 0.221 between residues 27 and 28 568708002445 10 probable transmembrane helices predicted for STM_MW15511 by TMHMM2.0 at aa 13-35, 77-99, 112-134, 139-161, 195-217, 237-256, 263-285, 328-350, 357-379 and 444-466 568708002453 Signal peptide predicted for STM_MW15561 by SignalP 2.0 HMM (Signal peptide probability 0.842) with cleavage site probability 0.371 between residues 19 and 20 568708002454 1 probable transmembrane helix predicted for STM_MW15571 by TMHMM2.0 at aa 4-26 568708002455 Signal peptide predicted for STM_MW15571 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 24 and 25 568708002464 4 probable transmembrane helices predicted for STM_MW15631 by TMHMM2.0 at aa 13-35, 50-72, 112-134 and 149-171 568708002470 Signal peptide predicted for STM_MW15651 by SignalP 2.0 HMM (Signal peptide probability 0.964) with cleavage site probability 0.781 between residues 33 and 34 568708002472 9 probable transmembrane helices predicted for STM_MW15661 by TMHMM2.0 at aa 15-34, 46-68, 72-94, 101-119, 129-151, 163-185, 190-212, 219-241 and 251-270 568708002473 Signal peptide predicted for STM_MW15671 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 21 and 22 568708002476 14 probable transmembrane helices predicted for STM_MW15691 by TMHMM2.0 at aa 7-29, 44-66, 73-92, 97-119, 132-154, 158-180, 193-212, 222-240, 261-283, 298-320, 322-344, 354-376, 389-411 and 468-490 568708002479 1 probable transmembrane helix predicted for STM_MW15701 by TMHMM2.0 at aa 151-170 568708002480 Signal peptide predicted for STM_MW15711 by SignalP 2.0 HMM (Signal peptide probability 0.611) with cleavage site probability 0.599 between residues 57 and 58 568708002481 12 probable transmembrane helices predicted for STM_MW15711 by TMHMM2.0 at aa 36-58, 73-95, 102-121, 131-153, 174-196, 211-233, 254-276, 286-308, 313-335, 345-367, 401-418 and 433-455 568708002486 5 probable transmembrane helices predicted for STM_MW15751 by TMHMM2.0 at aa 5-27, 48-70, 90-112, 128-150 and 185-207 568708002491 12 probable transmembrane helices predicted for STM_MW15791 by TMHMM2.0 at aa 37-59, 64-86, 107-129, 144-166, 171-193, 218-240, 260-282, 302-324, 351-373, 377-399, 420-442 and 446-468 568708002493 1 probable transmembrane helix predicted for STM_MW15801 by TMHMM2.0 at aa 4-26 568708002494 Signal peptide predicted for STM_MW15801 by SignalP 2.0 HMM (Signal peptide probability 0.986) with cleavage site probability 0.417 between residues 19 and 20 568708002495 Signal peptide predicted for STM_MW15811 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.987 between residues 30 and 31 568708002496 Signal peptide predicted for STM_MW15821 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.983 between residues 26 and 27 568708002503 Signal peptide predicted for STM_MW15861 by SignalP 2.0 HMM (Signal peptide probability 0.633) with cleavage site probability 0.255 between residues 21 and 22 568708002504 5 probable transmembrane helices predicted for STM_MW15861 by TMHMM2.0 at aa 5-25, 32-54, 69-88, 95-117 and 122-144 568708002509 2 probable transmembrane helices predicted for STM_MW15911 by TMHMM2.0 at aa 33-55 and 62-84 568708002515 Signal peptide predicted for STM_MW15941 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.991 between residues 20 and 21 568708002516 2 probable transmembrane helices predicted for STM_MW15961 by TMHMM2.0 at aa 33-67 and 82-104 568708002518 Signal peptide predicted for STM_MW15981 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 22 and 23 568708002523 Signal peptide predicted for STM_MW16011 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.663 between residues 35 and 36 568708002525 11 probable transmembrane helices predicted for STM_MW16011 by TMHMM2.0 at aa 10-30, 43-65, 93-112, 119-138, 143-165, 172-194, 209-231, 252-274, 289-311, 318-340 and 360-382 568708002527 Signal peptide predicted for STM_MW16021 by SignalP 2.0 HMM (Signal peptide probability 0.989) with cleavage site probability 0.785 between residues 24 and 25 568708002530 10 probable transmembrane helices predicted for STM_MW16041 by TMHMM2.0 at aa 13-32, 47-69, 82-104, 108-130, 143-165, 169-188, 200-222, 237-254, 261-280 and 290-312 568708002533 Signal peptide predicted for STM_MW16081 by SignalP 2.0 HMM (Signal peptide probability 0.832) with cleavage site probability 0.593 between residues 22 and 23 568708002536 7 probable transmembrane helices predicted for STM_MW16091 by TMHMM2.0 at aa 35-57, 78-100, 169-188, 195-217, 251-273, 302-324 and 361-383 568708002544 Signal peptide predicted for STM_MW16151 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 24 and 25 568708002546 Signal peptide predicted for STM_MW16161 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.995 between residues 23 and 24 568708002548 Signal peptide predicted for STM_MW16171 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 32 and 33 568708002555 2 probable transmembrane helices predicted for STM_MW16211 by TMHMM2.0 at aa 26-48 and 203-225 568708002557 Signal peptide predicted for STM_MW16211 by SignalP 2.0 HMM (Signal peptide probability 0.742) with cleavage site probability 0.234 between residues 50 and 51 568708002561 5 probable transmembrane helices predicted for STM_MW16251 by TMHMM2.0 at aa 12-34, 54-76, 88-110, 114-136 and 155-177 568708002564 3 probable transmembrane helices predicted for STM_MW16271 by TMHMM2.0 at aa 2-21, 25-42 and 89-111 568708002566 Signal peptide predicted for STM_MW16271 by SignalP 2.0 HMM (Signal peptide probability 0.941) with cleavage site probability 0.622 between residues 26 and 27 568708002567 Signal peptide predicted for STM_MW16281 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 22 and 23 568708002569 4 probable transmembrane helices predicted for STM_MW16291 by TMHMM2.0 at aa 20-42, 55-74, 79-101 and 186-208 568708002572 5 probable transmembrane helices predicted for STM_MW16311 by TMHMM2.0 at aa 30-49, 61-83, 93-115, 136-158 and 192-214 568708002574 contains an internal stop codon; tmhmm; query 1-516 568708002577 4 probable transmembrane helices predicted for STM_MW16341 by TMHMM2.0 at aa 5-27, 40-62, 83-105 and 140-162 568708002586 1 probable transmembrane helix predicted for STM_MW16391 by TMHMM2.0 at aa 5-24 568708002587 Signal peptide predicted for STM_MW16391 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 21 and 22 568708002588 Signal peptide predicted for STM_MW16401 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.526 between residues 18 and 19 568708002590 Signal peptide predicted for STM_MW16411 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.652 between residues 34 and 35 568708002591 1 probable transmembrane helix predicted for STM_MW16411 by TMHMM2.0 at aa 7-29 568708002594 Signal peptide predicted for STM_MW16431 by SignalP 2.0 HMM (Signal peptide probability 0.986) with cleavage site probability 0.429 between residues 20 and 21 568708002603 4 probable transmembrane helices predicted for STM_MW16481 by TMHMM2.0 at aa 5-22, 32-51, 58-80 and 85-107 568708002610 2 probable transmembrane helices predicted for STM_MW16521 by TMHMM2.0 at aa 272-294 and 299-321 568708002613 2 probable transmembrane helices predicted for STM_MW16531 by TMHMM2.0 at aa 7-29 and 33-55 568708002621 2 probable transmembrane helices predicted for STM_MW16581 by TMHMM2.0 at aa 13-35 and 60-82 568708002622 Signal peptide predicted for STM_MW16581 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.822 between residues 32 and 33 568708002623 5 probable transmembrane helices predicted for STM_MW16591 by TMHMM2.0 at aa 10-30, 39-61, 76-98, 117-134 and 138-160 568708002629 1 probable transmembrane helix predicted for STM_MW16631 by TMHMM2.0 at aa 7-29 568708002630 Signal peptide predicted for STM_MW16631 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.639 between residues 24 and 25 568708002631 Signal peptide predicted for STM_MW16651 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.535 between residues 21 and 22 568708002632 pfam_scan;Pfam:PF06445; E()=1.1E-16;score=60.6;query125- 282;description=AraC_E_bind; pfam_scan;Pfam:PF00165; E()=1.4E-10;score=40.5;query66-104;description=HTH_AraC 568708002636 1 probable transmembrane helix predicted for STM_MW16681 by TMHMM2.0 at aa 12-34 568708002637 Signal peptide predicted for STM_MW16681 by SignalP 2.0 HMM (Signal peptide probability 0.933) with cleavage site probability 0.580 between residues 31 and 32 568708002643 1 probable transmembrane helix predicted for STM_MW16731 by TMHMM2.0 at aa 12-34 568708002646 Signal peptide predicted for STM_MW16741 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.961 between residues 22 and 23 568708002652 3 probable transmembrane helices predicted for STM_MW16791 by TMHMM2.0 at aa 70-89, 99-121 and 210-232 568708002656 1 probable transmembrane helix predicted for STM_MW16811 by TMHMM2.0 at aa 5-24 568708002657 Signal peptide predicted for STM_MW16811 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 19 and 20 568708002660 1 probable transmembrane helix predicted for STM_MW16831 by TMHMM2.0 at aa 39-61 568708002662 1 probable transmembrane helix predicted for STM_MW16841 by TMHMM2.0 at aa 4-26 568708002666 Signal peptide predicted for STM_MW16871 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 21 and 22 568708002668 4 probable transmembrane helices predicted for STM_MW16881 by TMHMM2.0 at aa 23-45, 57-79, 194-216 and 229-251 568708002670 6 probable transmembrane helices predicted for STM_MW16891 by TMHMM2.0 at aa 30-52, 99-121, 134-156, 198-217, 224-243 and 258-280 568708002687 Signal peptide predicted for STM_MW17021 by SignalP 2.0 HMM (Signal peptide probability 0.780) with cleavage site probability 0.772 between residues 20 and 21 568708002689 2 probable transmembrane helices predicted for STM_MW17041 by TMHMM2.0 at aa 5-23 and 43-65 568708002690 Signal peptide predicted for STM_MW17041 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.704 between residues 22 and 23 568708002691 6 probable transmembrane helices predicted for STM_MW17051 by TMHMM2.0 at aa 9-31, 51-68, 75-92, 157-179, 186-208 and 212-229 568708002693 Signal peptide predicted for STM_MW17051 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.977 between residues 24 and 25 568708002705 2 probable transmembrane helices predicted for STM_MW17121 by TMHMM2.0 at aa 10-32 and 189-206 568708002727 Signal peptide predicted for STM_MW17271 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 21 and 22 568708002729 Signal peptide predicted for STM_MW17291 by SignalP 2.0 HMM (Signal peptide probability 0.946) with cleavage site probability 0.435 between residues 38 and 39 568708002731 6 probable transmembrane helices predicted for STM_MW17291 by TMHMM2.0 at aa 20-42, 89-111, 118-140, 144-166, 187-209 and 219-241 568708002733 5 probable transmembrane helices predicted for STM_MW17301 by TMHMM2.0 at aa 20-42, 51-68, 78-95, 119-141 and 151-170 568708002737 2 probable transmembrane helices predicted for STM_MW17341 by TMHMM2.0 at aa 10-29 and 36-58 568708002740 6 probable transmembrane helices predicted for STM_MW17361 by TMHMM2.0 at aa 12-34, 44-66, 73-95, 139-161, 166-188 and 198-220 568708002742 Signal peptide predicted for STM_MW17361 by SignalP 2.0 HMM (Signal peptide probability 0.899) with cleavage site probability 0.369 between residues 28 and 29 568708002747 6 probable transmembrane helices predicted for STM_MW17391 by TMHMM2.0 at aa 40-62, 103-125, 138-160, 164-183, 214-236 and 268-290 568708002749 6 probable transmembrane helices predicted for STM_MW17401 by TMHMM2.0 at aa 13-30, 102-121, 134-156, 166-188, 228-250 and 278-300 568708002752 1 probable transmembrane helix predicted for STM_MW17411 by TMHMM2.0 at aa 48-70 568708002753 6 probable transmembrane helices predicted for STM_MW17431 by TMHMM2.0 at aa 10-32, 52-74, 78-100, 120-142, 146-168 and 189-211 568708002767 5 probable transmembrane helices predicted for STM_MW17531 by TMHMM2.0 at aa 4-26, 47-69, 89-108, 127-149 and 184-206 568708002771 12 probable transmembrane helices predicted for STM_MW17571 by TMHMM2.0 at aa 38-60, 75-97, 104-123, 133-155, 176-198, 213-235, 256-278, 288-310, 322-344, 348-370, 404-421 and 436-458 568708002773 Signal peptide predicted for STM_MW17581 by SignalP 2.0 HMM (Signal peptide probability 0.990) with cleavage site probability 0.674 between residues 33 and 34 568708002774 2 probable transmembrane helices predicted for STM_MW17581 by TMHMM2.0 at aa 15-37 and 154-176 568708002780 Signal peptide predicted for STM_MW17601 by SignalP 2.0 HMM (Signal peptide probability 0.990) with cleavage site probability 0.839 between residues 40 and 41 568708002783 11 probable transmembrane helices predicted for STM_MW17631 by TMHMM2.0 at aa 13-32, 36-58, 71-93, 108-127, 139-161, 166-188, 220-237, 247-269, 290-312, 317-339 and 346-365 568708002787 4 probable transmembrane helices predicted for STM_MW17661 by TMHMM2.0 at aa 5-27, 39-60, 70-92 and 104-123 568708002788 Signal peptide predicted for STM_MW17661 by SignalP 2.0 HMM (Signal peptide probability 0.644) with cleavage site probability 0.455 between residues 22 and 23 568708002795 Signal peptide predicted for STM_MW17701 by SignalP 2.0 HMM (Signal peptide probability 0.782) with cleavage site probability 0.633 between residues 28 and 29 568708002800 11 probable transmembrane helices predicted for STM_MW17731 by TMHMM2.0 at aa 25-47, 54-76, 91-113, 122-144, 169-191, 204-226, 269-291, 311-333, 338-360, 362-380 and 400-431 568708002804 2 probable transmembrane helices predicted for STM_MW17741 by TMHMM2.0 at aa 7-29 and 39-61 568708002805 Signal peptide predicted for STM_MW17741 by SignalP 2.0 HMM (Signal peptide probability 0.830) with cleavage site probability 0.300 between residues 24 and 25 568708002811 Signal peptide predicted for STM_MW17781 by SignalP 2.0 HMM (Signal peptide probability 0.931) with cleavage site probability 0.921 between residues 45 and 46 568708002812 2 probable transmembrane helices predicted for STM_MW17781 by TMHMM2.0 at aa 20-39 and 326-348 568708002816 4 probable transmembrane helices predicted for STM_MW17801 by TMHMM2.0 at aa 28-47, 67-89, 141-160 and 194-211 568708002821 9 probable transmembrane helices predicted for STM_MW17841 by TMHMM2.0 at aa 20-42, 54-76, 96-118, 125-147, 186-208, 215-237, 387-409, 421-443 and 471-493 568708002823 8 probable transmembrane helices predicted for STM_MW17851 by TMHMM2.0 at aa 7-24, 80-102, 123-145, 160-182, 203-225, 258-280, 292-314 and 334-356 568708002826 Signal peptide predicted for STM_MW17881 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.996 between residues 34 and 35 568708002828 3 probable transmembrane helices predicted for STM_MW17891 by TMHMM2.0 at aa 4-22, 27-49 and 59-81 568708002833 Signal peptide predicted for STM_MW17911 by SignalP 2.0 HMM (Signal peptide probability 0.861) with cleavage site probability 0.723 between residues 19 and 20 568708002835 11 probable transmembrane helices predicted for STM_MW17931 by TMHMM2.0 at aa 4-26, 31-53, 57-74, 87-109, 119-141, 187-209, 232-254, 267-289, 299-321, 334-356 and 361-383 568708002846 12 probable transmembrane helices predicted for STM_MW17981 by TMHMM2.0 at aa 26-48, 61-83, 93-115, 128-145, 150-169, 197-219, 239-261, 299-331, 346-368, 389-411, 453-472 and 479-501 568708002847 Signal peptide predicted for STM_MW17991 by SignalP 2.0 HMM (Signal peptide probability 0.854) with cleavage site probability 0.827 between residues 24 and 25 568708002849 4 probable transmembrane helices predicted for STM_MW17991 by TMHMM2.0 at aa 13-32, 42-64, 71-93 and 144-166 568708002863 Signal peptide predicted for STM_MW18111 by SignalP 2.0 HMM (Signal peptide probability 0.888) with cleavage site probability 0.393 between residues 25 and 26 568708002876 7 probable transmembrane helices predicted for STM_MW18201 by TMHMM2.0 at aa 13-35, 48-70, 85-102, 123-145, 150-172, 185-207 and 212-231 568708002882 7 probable transmembrane helices predicted for STM_MW18231 by TMHMM2.0 at aa 5-27, 34-56, 66-88, 95-117, 143-165, 178-200 and 215-237 568708002884 5 probable transmembrane helices predicted for STM_MW18241 by TMHMM2.0 at aa 105-127, 142-164, 185-207, 236-258 and 265-284 568708002885 Signal peptide predicted for STM_MW18251 by SignalP 2.0 HMM (Signal peptide probability 0.693) with cleavage site probability 0.613 between residues 19 and 20 568708002887 2 probable transmembrane helices predicted for STM_MW18251 by TMHMM2.0 at aa 7-26 and 65-87 568708002888 Signal peptide predicted for STM_MW18261 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.998 between residues 19 and 20 568708002889 6 probable transmembrane helices predicted for STM_MW18261 by TMHMM2.0 at aa 4-26, 39-61, 71-93, 106-128, 133-155 and 168-187 568708002894 Signal peptide predicted for STM_MW18281 by SignalP 2.0 HMM (Signal peptide probability 0.995) with cleavage site probability 0.700 between residues 38 and 39 568708002895 1 probable transmembrane helix predicted for STM_MW18281 by TMHMM2.0 at aa 16-38 568708002896 Cold-Shock Protein (CSP) contains an S1-like cold-shock domain (CSD) that is found in eukaryotes, prokaryotes, and archaea. CSP's include the major cold-shock proteins CspA and CspB in bacteria and the eukaryotic gene regulatory factor Y-box protein; Region: CSP_CDS; cd04458 568708002897 DNA-binding site [nucleotide binding]; DNA binding site 568708002898 RNA-binding motif; other site 568708002900 Signal peptide predicted for STM_MW18301 by SignalP 2.0 HMM (Signal peptide probability 0.987) with cleavage site probability 0.962 between residues 33 and 34 568708002901 1 probable transmembrane helix predicted for STM_MW18301 by TMHMM2.0 at aa 7-29 568708002904 12 probable transmembrane helices predicted for STM_MW18321 by TMHMM2.0 at aa 21-43, 53-75, 87-109, 113-132, 144-166, 171-193, 205-227, 231-249, 269-291, 306-328, 335-357 and 426-448 568708002907 4 probable transmembrane helices predicted for STM_MW18331 by TMHMM2.0 at aa 5-27, 32-54, 158-180 and 195-217 568708002909 Signal peptide predicted for STM_MW18331 by SignalP 2.0 HMM (Signal peptide probability 0.958) with cleavage site probability 0.237 between residues 32 and 33 568708002912 Signal peptide predicted for STM_MW18341 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 22 and 23 568708002915 8 probable transmembrane helices predicted for STM_MW18371 by TMHMM2.0 at aa 65-84, 119-141, 162-184, 188-210, 268-290, 310-339, 351-373 and 383-405 568708002917 1 probable transmembrane helix predicted for STM_MW18381 by TMHMM2.0 at aa 22-41 568708002926 1 probable transmembrane helix predicted for STM_MW18471 by TMHMM2.0 at aa 55-77 568708002928 pfam_scan;Pfam:PF00872; E()=1.7E-98;score=329.2;query 9-372;description=Transposase_mut 568708002931 prophage 3 remnant 568708002934 Signal peptide predicted for STM_MW18541 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 19 and 20 568708002935 8 probable transmembrane helices predicted for STM_MW18551 by TMHMM2.0 at aa 10-32, 52-74, 94-113, 120-137, 152-174, 195-217, 227-249 and 270-288 568708002938 Signal peptide predicted for STM_MW18561 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.834 between residues 26 and 27 568708002945 1 probable transmembrane helix predicted for STM_MW18611 by TMHMM2.0 at aa 52-74 568708002946 Signal peptide predicted for STM_MW18621 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.995 between residues 21 and 22 568708002958 1 probable transmembrane helix predicted for STM_MW18701 by TMHMM2.0 at aa 21-43 568708002963 Signal peptide predicted for STM_MW18721 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.924 between residues 42 and 43 568708002965 Signal peptide predicted for STM_MW18741 by SignalP 2.0 HMM (Signal peptide probability 0.958) with cleavage site probability 0.581 between residues 18 and 19 568708002967 7 probable transmembrane helices predicted for STM_MW18741 by TMHMM2.0 at aa 5-27, 48-70, 85-107, 127-145, 170-192, 213-235 and 239-256 568708002972 contains a frameshift after residue 80 568708002973 contains two frameshifts after residues 55 and 104; tmhmm; query 1-147 568708002983 4 probable transmembrane helices predicted for STM_MW18871 by TMHMM2.0 at aa 4-22, 43-62, 72-89 and 102-124 568708002992 1 probable transmembrane helix predicted for STM_MW18931 by TMHMM2.0 at aa 12-34 568708002997 Signal peptide predicted for STM_MW18951 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.916 between residues 16 and 17 568708002999 7 probable transmembrane helices predicted for STM_MW18961 by TMHMM2.0 at aa 21-43, 47-64, 76-98, 118-140, 213-235, 250-272 and 293-315 568708003001 4 probable transmembrane helices predicted for STM_MW18971 by TMHMM2.0 at aa 33-50, 93-115, 146-168 and 189-211 568708003010 2 probable transmembrane helices predicted for STM_MW19021 by TMHMM2.0 at aa 85-107 and 271-293 568708003019 1 probable transmembrane helix predicted for STM_MW19051 by TMHMM2.0 at aa 29-51 568708003020 3 probable transmembrane helices predicted for STM_MW19061 by TMHMM2.0 at aa 10-32, 152-171 and 186-208 568708003030 Signal peptide predicted for STM_MW19161 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.508 between residues 24 and 25 568708003033 Signal peptide predicted for STM_MW19191 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.653 between residues 28 and 29 568708003035 11 probable transmembrane helices predicted for STM_MW19191 by TMHMM2.0 at aa 7-29, 33-55, 81-103, 113-135, 148-167, 182-204, 216-235, 273-295, 308-330, 335-357 and 377-399 568708003037 Signal peptide; signalp; query 1-23;cleavage_site_probability=0.249; 0.687 568708003038 1 probable transmembrane helix predicted for STM_MW19231 by TMHMM2.0 at aa 25-47 568708003039 it has a frameshift after residue 17 568708003040 4 probable transmembrane helices predicted for STM_MW19241 by TMHMM2.0 at aa 7-29, 33-52, 121-143 and 147-169 568708003052 3 probable transmembrane helices predicted for STM_MW19311 by TMHMM2.0 at aa 20-42, 54-76 and 185-207 568708003056 Signal peptide predicted for STM_MW19331 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 29 and 30 568708003071 Signal peptide predicted for STM_MW19441 by SignalP 2.0 HMM (Signal peptide probability 0.972) with cleavage site probability 0.835 between residues 19 and 20 568708003072 10 probable transmembrane helices predicted for STM_MW19451 by TMHMM2.0 at aa 30-52, 96-118, 139-161, 166-188, 217-234, 244-266, 279-301, 306-328, 341-360 and 380-402 568708003075 1 probable transmembrane helix predicted for STM_MW19471 by TMHMM2.0 at aa 12-34 568708003077 Signal peptide predicted for STM_MW19491 by SignalP 2.0 HMM (Signal peptide probability 0.955) with cleavage site probability 0.949 between residues 46 and 47 568708003078 1 probable transmembrane helix predicted for STM_MW19491 by TMHMM2.0 at aa 26-45 568708003086 Signal peptide predicted for STM_MW19551 by SignalP 2.0 HMM (Signal peptide probability 0.995) with cleavage site probability 0.450 between residues 30 and 31 568708003087 1 probable transmembrane helix predicted for STM_MW19551 by TMHMM2.0 at aa 13-35 568708003092 1 probable transmembrane helix predicted for STM_MW19581 by TMHMM2.0 at aa 18-40 568708003094 Signal peptide predicted for STM_MW19591 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.511 between residues 20 and 21 568708003095 5 probable transmembrane helices predicted for STM_MW19591 by TMHMM2.0 at aa 5-27, 47-69, 88-105, 185-207 and 214-236 568708003097 Signal peptide predicted for STM_MW19601 by SignalP 2.0 HMM (Signal peptide probability 0.961) with cleavage site probability 0.942 between residues 40 and 41 568708003099 2 probable transmembrane helices predicted for STM_MW19601 by TMHMM2.0 at aa 20-42 and 52-74 568708003101 6 probable transmembrane helices predicted for STM_MW19611 by TMHMM2.0 at aa 15-34, 41-58, 73-95, 132-154, 179-201 and 214-236 568708003106 2 probable transmembrane helices predicted for STM_MW19661 by TMHMM2.0 at aa 20-42 and 358-380 568708003110 5 probable transmembrane helices predicted for STM_MW19681 by TMHMM2.0 at aa 78-100, 150-169, 173-195, 230-252 and 267-289 568708003111 10 probable transmembrane helices predicted for STM_MW19691 by TMHMM2.0 at aa 7-29, 39-57, 69-87, 97-119, 126-145, 149-168, 175-197, 212-234, 241-260 and 270-292 568708003116 2 probable transmembrane helices predicted for STM_MW19731 by TMHMM2.0 at aa 19-41 and 61-80 568708003117 Signal peptide predicted for STM_MW19741 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 21 and 22 568708003124 1 probable transmembrane helix predicted for STM_MW19801 by TMHMM2.0 at aa 21-43 568708003125 BTP3 568708003130 potential frameshift: common BLAST hit: gi|194736844|ref|YP_002117168.1| tail protein 568708003138 1 probable transmembrane helix predicted for STM_MW19921 by TMHMM2.0 at aa 35-57 568708003153 3 probable transmembrane helices predicted for STM_MW20111 by TMHMM2.0 at aa 20-39, 52-69 and 79-101 568708003170 Signal peptide predicted for STM_MW20391 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.547 between residues 22 and 23 568708003174 11 probable transmembrane helices predicted for STM_MW20451 by TMHMM2.0 at aa 49-71, 86-108, 128-150, 160-182, 194-216, 231-253, 266-286, 296-318, 353-375, 390-412 and 434-456 568708003177 1 probable transmembrane helix predicted for STM_MW20461 by TMHMM2.0 at aa 7-26 568708003178 Signal peptide predicted for STM_MW20461 by SignalP 2.0 HMM (Signal peptide probability 0.942) with cleavage site probability 0.772 between residues 21 and 22 568708003181 5 probable transmembrane helices predicted for STM_MW20481 by TMHMM2.0 at aa 33-55, 59-81, 109-131, 136-158 and 185-207 568708003182 Signal peptide predicted for STM_MW20481 by SignalP 2.0 HMM (Signal peptide probability 0.655) with cleavage site probability 0.651 between residues 22 and 23 568708003188 4 probable transmembrane helices predicted for STM_MW20521 by TMHMM2.0 at aa 22-47, 62-84, 91-110 and 120-142 568708003190 2 probable transmembrane helices predicted for STM_MW20531 by TMHMM2.0 at aa 5-22 and 60-82 568708003191 Signal peptide predicted for STM_MW20531 by SignalP 2.0 HMM (Signal peptide probability 0.934) with cleavage site probability 0.796 between residues 24 and 25 568708003192 7 probable transmembrane helices predicted for STM_MW20541 by TMHMM2.0 at aa 15-34, 41-63, 78-100, 107-129, 139-161, 174-193 and 213-235 568708003194 Signal peptide predicted for STM_MW20541 by SignalP 2.0 HMM (Signal peptide probability 0.973) with cleavage site probability 0.732 between residues 35 and 36 568708003202 1 probable transmembrane helix predicted for STM_MW20591 by TMHMM2.0 at aa 58-80 568708003203 Signal peptide predicted for STM_MW20591 by SignalP 2.0 HMM (Signal peptide probability 0.827) with cleavage site probability 0.735 between residues 22 and 23 568708003209 5 probable transmembrane helices predicted for STM_MW20651 by TMHMM2.0 at aa 52-74, 79-101, 155-177, 207-229 and 296-318 568708003216 6 probable transmembrane helices predicted for STM_MW20681 by TMHMM2.0 at aa 13-35, 55-77, 84-106, 143-165, 178-200 and 230-252 568708003224 1 probable transmembrane helix predicted for STM_MW20761 by TMHMM2.0 at aa 12-31 568708003240 6 probable transmembrane helices predicted for STM_MW20901 by TMHMM2.0 at aa 20-42, 47-66, 73-92, 96-113, 118-135 and 140-162 568708003244 Signal peptide predicted for STM_MW20921 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.997 between residues 23 and 24 568708003245 5 probable transmembrane helices predicted for STM_MW20931 by TMHMM2.0 at aa 15-37, 66-88, 93-115, 169-191 and 201-223 568708003251 Signal peptide predicted for STM_MW20951 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.994 between residues 30 and 31 568708003256 12 probable transmembrane helices predicted for STM_MW20991 by TMHMM2.0 at aa 20-38, 53-75, 96-118, 133-151, 158-180, 200-219, 240-262, 289-311, 342-364, 368-385, 398-417 and 422-439 568708003272 2 probable transmembrane helices predicted for STM_MW21101 by TMHMM2.0 at aa 33-52 and 296-315 568708003279 5 probable transmembrane helices predicted for STM_MW21131 by TMHMM2.0 at aa 15-37, 57-74, 89-108, 115-134 and 282-304 568708003289 12 probable transmembrane helices predicted for STM_MW21191 by TMHMM2.0 at aa 12-34, 47-69, 90-112, 132-154, 161-180, 190-212, 233-250, 270-292, 304-326, 341-360, 372-394 and 399-421 568708003303 Signal peptide predicted for STM_MW21291 by SignalP 2.0 HMM (Signal peptide probability 0.730) with cleavage site probability 0.694 between residues 22 and 23 568708003304 Signal peptide predicted for STM_MW21301 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.968 between residues 31 and 32 568708003308 10 probable transmembrane helices predicted for STM_MW21331 by TMHMM2.0 at aa 13-35, 45-67, 80-102, 165-187, 286-308, 323-340, 361-383, 387-409, 416-435 and 450-472 568708003309 Signal peptide predicted for STM_MW21331 by SignalP 2.0 HMM (Signal peptide probability 0.754) with cleavage site probability 0.750 between residues 33 and 34 568708003310 5 probable transmembrane helices predicted for STM_MW21341 by TMHMM2.0 at aa 12-34, 44-66, 79-101, 111-130 and 279-300 568708003323 12 probable transmembrane helices predicted for STM_MW21441 by TMHMM2.0 at aa 7-25, 30-47, 54-76, 81-103, 116-138, 143-165, 172-189, 204-226, 246-268, 283-305, 326-348 and 368-390 568708003327 2 probable transmembrane helices predicted for STM_MW21481 by TMHMM2.0 at aa 31-53 and 426-448 568708003332 7 probable transmembrane helices predicted for STM_MW21511 by TMHMM2.0 at aa 13-35, 48-70, 80-99, 126-148, 153-172, 185-207 and 212-234 568708003337 1 probable transmembrane helix predicted for STM_MW21521 by TMHMM2.0 at aa 7-26 568708003338 Signal peptide predicted for STM_MW21521 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.492 between residues 25 and 26 568708003341 10 probable transmembrane helices predicted for STM_MW21551 by TMHMM2.0 at aa 15-37, 64-86, 90-112, 124-146, 156-177, 189-208, 212-229, 236-258, 268-290 and 310-327 568708003350 Signal peptide predicted for STM_MW21581 by SignalP 2.0 HMM (Signal peptide probability 0.928) with cleavage site probability 0.356 between residues 34 and 35 568708003351 1 probable transmembrane helix predicted for STM_MW21581 by TMHMM2.0 at aa 7-26 568708003354 11 probable transmembrane helices predicted for STM_MW21591 by TMHMM2.0 at aa 15-37, 345-362, 367-389, 396-418, 438-460, 472-494, 535-557, 867-889, 909-931, 968-990 and 1000-1022 568708003356 10 probable transmembrane helices predicted for STM_MW21601 by TMHMM2.0 at aa 7-29, 336-353, 360-382, 434-456, 463-485, 525-547, 853-875, 895-917, 948-970 and 985-1007 568708003357 13 probable transmembrane helices predicted for STM_MW21611 by TMHMM2.0 at aa 12-34, 47-69, 76-98, 102-124, 136-158, 168-190, 197-214, 224-243, 255-277, 287-309, 330-352, 395-417 and 430-452 568708003359 2 probable transmembrane helices predicted for STM_MW21621 by TMHMM2.0 at aa 13-35 and 168-190 568708003368 2 probable transmembrane helices predicted for STM_MW21701 by TMHMM2.0 at aa 48-70 and 85-107 568708003372 12 probable transmembrane helices predicted for STM_MW21731 by TMHMM2.0 at aa 7-29, 39-61, 70-87, 97-119, 132-154, 159-181, 211-233, 243-265, 274-293, 297-319, 339-358 and 378-400 568708003379 Signal peptide predicted for STM_MW21791 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 19 and 20 568708003381 Signal peptide predicted for STM_MW21801 by SignalP 2.0 HMM (Signal peptide probability 0.783) with cleavage site probability 0.726 between residues 19 and 20 568708003383 Signal peptide predicted for STM_MW21811 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.557 between residues 24 and 25 568708003386 1 probable transmembrane helix predicted for STM_MW21821 by TMHMM2.0 at aa 7-29 568708003387 Signal peptide predicted for STM_MW21821 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 18 and 19 568708003389 Signal peptide predicted for STM_MW21831 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 22 and 23 568708003394 Signal peptide predicted for STM_MW21871 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.426 between residues 24 and 25 568708003396 Signal peptide predicted for STM_MW21881 by SignalP 2.0 HMM (Signal peptide probability 0.947) with cleavage site probability 0.839 between residues 22 and 23 568708003404 6 probable transmembrane helices predicted for STM_MW21911 by TMHMM2.0 at aa 4-23, 44-63, 73-95, 107-129, 139-161 and 168-190 568708003407 6 probable transmembrane helices predicted for STM_MW21941 by TMHMM2.0 at aa 46-68, 92-114, 127-149, 159-181, 202-224 and 239-261 568708003411 10 probable transmembrane helices predicted for STM_MW21961 by TMHMM2.0 at aa 13-33, 48-70, 75-97, 107-126, 139-161, 187-209, 216-238, 248-270, 328-350 and 360-382 568708003413 Signal peptide predicted for STM_MW21961 by SignalP 2.0 HMM (Signal peptide probability 0.931) with cleavage site probability 0.866 between residues 26 and 27 568708003415 Signal peptide predicted for STM_MW21971 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 23 and 24 568708003418 Signal peptide predicted for STM_MW21981 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 20 and 21 568708003422 5 probable transmembrane helices predicted for STM_MW22011 by TMHMM2.0 at aa 33-55, 65-87, 108-130, 135-157 and 170-192 568708003424 5 probable transmembrane helices predicted for STM_MW22021 by TMHMM2.0 at aa 21-43, 53-72, 100-122, 137-159 and 172-189 568708003428 Signal peptide predicted for STM_MW22041 by SignalP 2.0 HMM (Signal peptide probability 0.951) with cleavage site probability 0.550 between residues 20 and 21 568708003431 Signal peptide predicted for STM_MW22071 by SignalP 2.0 HMM (Signal peptide probability 0.896) with cleavage site probability 0.421 between residues 24 and 25 568708003432 1 probable transmembrane helix predicted for STM_MW22071 by TMHMM2.0 at aa 7-24 568708003437 12 probable transmembrane helices predicted for STM_MW22111 by TMHMM2.0 at aa 23-45, 60-82, 89-108, 113-135, 148-170, 175-197, 253-275, 290-312, 319-338, 342-364, 385-407 and 412-434 568708003442 4 probable transmembrane helices predicted for STM_MW22131 by TMHMM2.0 at aa 7-29, 34-56, 63-85 and 95-117 568708003444 Signal peptide predicted for STM_MW22141 by SignalP 2.0 HMM (Signal peptide probability 0.908) with cleavage site probability 0.836 between residues 23 and 24 568708003445 5 probable transmembrane helices predicted for STM_MW22141 by TMHMM2.0 at aa 5-24, 34-56, 91-113, 140-162 and 206-228 568708003449 Signal peptide predicted for STM_MW22161 by SignalP 2.0 HMM (Signal peptide probability 0.917) with cleavage site probability 0.904 between residues 22 and 23 568708003450 1 probable transmembrane helix predicted for STM_MW22161 by TMHMM2.0 at aa 5-27 568708003453 2 probable transmembrane helices predicted for STM_MW22171 by TMHMM2.0 at aa 7-26 and 57-79 568708003457 9 probable transmembrane helices predicted for STM_MW22201 by TMHMM2.0 at aa 20-42, 49-68, 100-122, 127-149, 179-201, 222-244, 259-281, 286-308 and 312-330 568708003461 Signal peptide predicted for STM_MW22221 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.967 between residues 23 and 24 568708003464 9 probable transmembrane helices predicted for STM_MW22241 by TMHMM2.0 at aa 12-34, 49-71, 83-102, 107-123, 130-152, 199-221, 233-255, 308-330 and 337-359 568708003472 11 probable transmembrane helices predicted for STM_MW22301 by TMHMM2.0 at aa 29-46, 69-91, 103-125, 160-182, 189-208, 240-262, 295-314, 324-343, 348-370, 385-407 and 412-434 568708003476 Signal peptide predicted for STM_MW22311 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.794 between residues 25 and 26 568708003478 12 probable transmembrane helices predicted for STM_MW22321 by TMHMM2.0 at aa 21-43, 53-75, 103-125, 130-152, 159-181, 196-218, 245-267, 287-309, 343-365, 369-391, 412-434 and 444-466 568708003479 Signal peptide predicted for STM_MW22321 by SignalP 2.0 HMM (Signal peptide probability 0.888) with cleavage site probability 0.755 between residues 46 and 47 568708003482 Signal peptide predicted for STM_MW22341 by SignalP 2.0 HMM (Signal peptide probability 0.940) with cleavage site probability 0.753 between residues 40 and 41 568708003483 8 probable transmembrane helices predicted for STM_MW22341 by TMHMM2.0 at aa 13-35, 39-61, 100-122, 132-151, 163-185, 262-284, 291-313 and 323-345 568708003485 Signal peptide predicted for STM_MW22351 by SignalP 2.0 HMM (Signal peptide probability 0.985) with cleavage site probability 0.981 between residues 21 and 22 568708003487 9 probable transmembrane helices predicted for STM_MW22361 by TMHMM2.0 at aa 236-258, 271-293, 303-325, 345-367, 377-399, 412-434, 464-481, 488-508 and 528-550 568708003493 Signal peptide predicted for STM_MW22391 by SignalP 2.0 HMM (Signal peptide probability 0.639) with cleavage site probability 0.599 between residues 32 and 33 568708003494 12 probable transmembrane helices predicted for STM_MW22391 by TMHMM2.0 at aa 20-42, 52-71, 84-101, 105-124, 145-167, 172-194, 221-243, 253-275, 282-304, 308-330, 350-367 and 371-390 568708003496 2 probable transmembrane helices predicted for STM_MW22401 by TMHMM2.0 at aa 21-43 and 184-203 568708003501 5 probable transmembrane helices predicted for STM_MW22441 by TMHMM2.0 at aa 7-26, 64-83, 95-117, 162-184 and 191-213 568708003503 Signal peptide predicted for STM_MW22451 by SignalP 2.0 HMM (Signal peptide probability 0.929) with cleavage site probability 0.402 between residues 33 and 34 568708003505 2 probable transmembrane helices predicted for STM_MW22461 by TMHMM2.0 at aa 12-34 and 236-258 568708003507 Signal peptide predicted for STM_MW22471 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 19 and 20 568708003509 6 probable transmembrane helices predicted for STM_MW22481 by TMHMM2.0 at aa 9-31, 133-155, 168-190, 224-246, 283-305 and 329-348 568708003511 Signal peptide predicted for STM_MW22491 by SignalP 2.0 HMM (Signal peptide probability 0.788) with cleavage site probability 0.585 between residues 38 and 39 568708003512 6 probable transmembrane helices predicted for STM_MW22491 by TMHMM2.0 at aa 21-43, 142-164, 177-199, 203-222, 254-276 and 306-328 568708003516 12 probable transmembrane helices predicted for STM_MW22521 by TMHMM2.0 at aa 7-26, 41-63, 76-98, 102-124, 137-159, 163-185, 219-241, 251-273, 286-308, 313-332, 344-366 and 370-389 568708003518 Signal peptide predicted for STM_MW22521 by SignalP 2.0 HMM (Signal peptide probability 0.870) with cleavage site probability 0.504 between residues 25 and 26 568708003524 2 probable transmembrane helices predicted for STM_MW22561 by TMHMM2.0 at aa 20-42 and 52-74 568708003526 5 probable transmembrane helices predicted for STM_MW22581 by TMHMM2.0 at aa 21-43, 58-80, 85-103, 135-157 and 169-191 568708003530 9 probable transmembrane helices predicted for STM_MW22611 by TMHMM2.0 at aa 12-31, 35-57, 70-92, 133-155, 162-184, 188-210, 223-245, 299-321 and 334-353 568708003535 2 probable transmembrane helices predicted for STM_MW22671 by TMHMM2.0 at aa 26-48 and 55-74 568708003536 pfam_scan;Pfam:PF07693; E()=3.2E-66;score=223.2;query 15-316;description=KAP_NTPase 568708003545 2 probable transmembrane helices predicted for STM_MW22761 by TMHMM2.0 at aa 7-26 and 108-126 568708003546 Signal peptide predicted for STM_MW22761 by SignalP 2.0 HMM (Signal peptide probability 0.994) with cleavage site probability 0.956 between residues 20 and 21 568708003550 3 probable transmembrane helices predicted for STM_MW22781 by TMHMM2.0 at aa 2-24, 103-125 and 150-169 568708003551 Signal peptide predicted for STM_MW22781 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.985 between residues 22 and 23 568708003553 Signal peptide predicted for ATM_MW22782 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.742 between residues 30 and 31 568708003554 1 probable transmembrane helix predicted for ATM_MW22782 by TMHMM2.0 at aa 5-24 568708003555 15 probable transmembrane helices predicted for STM_MW22783 by TMHMM2.0 at aa 5-27, 40-62, 95-114, 121-143, 176-198, 211-233, 248-265, 277-299, 314-332, 353-375, 390-412, 425-444, 449-468, 481-503 and 610-629 568708003558 Signal peptide predicted for STM_MW22784 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.877 between residues 29 and 30 568708003559 1 probable transmembrane helix predicted for STM_MW22784 by TMHMM2.0 at aa 7-29 568708003561 6 probable transmembrane helices predicted for STM_MW22785 by TMHMM2.0 at aa 24-46, 66-88, 95-117, 132-151, 158-180 and 207-229 568708003563 6 probable transmembrane helices predicted for STM_MW22786 by TMHMM2.0 at aa 20-39, 43-65, 96-118, 128-150, 157-179 and 194-216 568708003566 1 probable transmembrane helix predicted for STM_MW22801 by TMHMM2.0 at aa 21-43 568708003568 Signal peptide predicted for STM_MW22811 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 27 and 28 568708003569 4 probable transmembrane helices predicted for STM_MW22821 by TMHMM2.0 at aa 33-55, 75-97, 138-160 and 170-192 568708003571 Signal peptide predicted for STM_MW22831 by SignalP 2.0 HMM (Signal peptide probability 0.733) with cleavage site probability 0.366 between residues 41 and 42 568708003575 Signal peptide predicted for STM_MW22841 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.977 between residues 31 and 32 568708003578 Signal peptide predicted for STM_MW22871 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 20 and 21 568708003580 6 probable transmembrane helices predicted for STM_MW22881 by TMHMM2.0 at aa 15-37, 50-72, 120-142, 149-171, 238-260 and 272-294 568708003582 Signal peptide predicted for STM_MW22881 by SignalP 2.0 HMM (Signal peptide probability 0.714) with cleavage site probability 0.503 between residues 29 and 30 568708003588 Signal peptide predicted for STM_MW22911 by SignalP 2.0 HMM (Signal peptide probability 0.969) with cleavage site probability 0.796 between residues 19 and 20 568708003590 Signal peptide predicted for STM_MW22931 by SignalP 2.0 HMM (Signal peptide probability 0.980) with cleavage site probability 0.489 between residues 40 and 41 568708003591 2 probable transmembrane helices predicted for STM_MW22931 by TMHMM2.0 at aa 20-42 and 308-330 568708003598 2 probable transmembrane helices predicted for STM_MW22951 by TMHMM2.0 at aa 20-42 and 314-333 568708003601 Signal peptide predicted for STM_MW22951 by SignalP 2.0 HMM (Signal peptide probability 0.907) with cleavage site probability 0.300 between residues 32 and 33 568708003606 12 probable transmembrane helices predicted for STM_MW22981 by TMHMM2.0 at aa 20-42, 55-77, 84-103, 109-131, 144-166, 176-198, 247-269, 284-306, 315-334, 339-361, 368-390 and 400-422 568708003617 12 probable transmembrane helices predicted for STM_MW23041 by TMHMM2.0 at aa 13-35, 45-64, 76-95, 100-122, 135-154, 164-186, 212-234, 239-261, 273-290, 295-317, 330-352 and 357-379 568708003621 1 probable transmembrane helix predicted for STM_MW23061 by TMHMM2.0 at aa 7-26 568708003622 Signal peptide predicted for STM_MW23061 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.882 between residues 25 and 26 568708003623 12 probable transmembrane helices predicted for STM_MW23071 by TMHMM2.0 at aa 28-45, 65-87, 94-116, 120-142, 161-183, 188-207, 254-273, 293-312, 319-341, 351-373, 386-408 and 418-437 568708003630 12 probable transmembrane helices predicted for STM_MW23141 by TMHMM2.0 at aa 13-30, 52-74, 79-101, 107-129, 142-164, 174-196, 241-263, 273-295, 308-325, 329-351, 358-380 and 395-417 568708003640 1 probable transmembrane helix predicted for STM_MW23201 by TMHMM2.0 at aa 13-35 568708003641 Signal peptide predicted for STM_MW23201 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.614 between residues 33 and 34 568708003644 2 probable transmembrane helices predicted for STM_MW23221 by TMHMM2.0 at aa 235-257 and 272-294 568708003650 12 probable transmembrane helices predicted for STM_MW23251 by TMHMM2.0 at aa 7-29, 82-104, 113-135, 139-156, 163-185, 205-227, 258-280, 290-307, 314-331, 346-368, 381-400 and 405-424 568708003652 3 probable transmembrane helices predicted for STM_MW23261 by TMHMM2.0 at aa 36-58, 63-85 and 92-110 568708003653 Signal peptide predicted for STM_MW23271 by SignalP 2.0 HMM (Signal peptide probability 0.940) with cleavage site probability 0.916 between residues 31 and 32 568708003654 4 probable transmembrane helices predicted for STM_MW23271 by TMHMM2.0 at aa 5-27, 42-64, 71-90 and 100-122 568708003668 11 probable transmembrane helices predicted for STM_MW23391 by TMHMM2.0 at aa 12-34, 65-87, 99-121, 141-163, 176-198, 208-230, 237-259, 269-291, 311-333, 348-370 and 390-412 568708003670 14 probable transmembrane helices predicted for STM_MW23401 by TMHMM2.0 at aa 4-18, 30-49, 81-103, 115-134, 139-161, 174-196, 222-244, 251-273, 288-307, 314-336, 341-363, 384-406, 416-438 and 459-481 568708003672 16 probable transmembrane helices predicted for STM_MW23411 by TMHMM2.0 at aa 4-21, 28-50, 84-106, 113-132, 136-158, 171-193, 213-235, 248-267, 277-299, 306-328, 332-354, 375-397, 412-434, 455-477, 492-514 and 590-612 568708003675 Signal peptide predicted for STM_MW23411 by SignalP 2.0 HMM (Signal peptide probability 0.948) with cleavage site probability 0.565 between residues 26 and 27 568708003677 5 probable transmembrane helices predicted for STM_MW23421 by TMHMM2.0 at aa 4-22, 29-51, 56-78, 91-113 and 133-155 568708003679 9 probable transmembrane helices predicted for STM_MW23441 by TMHMM2.0 at aa 13-35, 50-69, 81-103, 113-135, 155-174, 184-206, 235-257, 267-289 and 302-324 568708003694 3 probable transmembrane helices predicted for STM_MW23501 by TMHMM2.0 at aa 15-37, 68-90 and 100-122 568708003699 11 probable transmembrane helices predicted for STM_MW23551 by TMHMM2.0 at aa 5-22, 29-51, 61-83, 96-118, 138-160, 173-195, 427-449, 462-480, 500-522, 542-564 and 584-606 568708003702 Signal peptide predicted for STM_MW23551 by SignalP 2.0 HMM (Signal peptide probability 0.836) with cleavage site probability 0.754 between residues 20 and 21 568708003706 2 probable transmembrane helices predicted for STM_MW23581 by TMHMM2.0 at aa 46-65 and 69-91 568708003711 11 probable transmembrane helices predicted for STM_MW23611 by TMHMM2.0 at aa 19-41, 106-127, 148-165, 175-197, 204-226, 230-252, 287-309, 314-336, 349-371, 398-415 and 481-503 568708003716 11 probable transmembrane helices predicted for STM_MW23641 by TMHMM2.0 at aa 10-32, 39-61, 95-114, 121-143, 147-169, 226-243, 258-280, 310-332, 342-364, 377-399 and 423-445 568708003729 4 probable transmembrane helices predicted for STM_MW23741 by TMHMM2.0 at aa 25-47, 57-79, 167-189 and 199-221 568708003731 5 probable transmembrane helices predicted for STM_MW23751 by TMHMM2.0 at aa 15-37, 58-80, 90-108, 149-171 and 191-213 568708003734 Signal peptide predicted for STM_MW23761 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.993 between residues 22 and 23 568708003736 1 probable transmembrane helix predicted for STM_MW23771 by TMHMM2.0 at aa 5-24 568708003737 Signal peptide predicted for STM_MW23771 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.969 between residues 22 and 23 568708003739 12 probable transmembrane helices predicted for STM_MW23791 by TMHMM2.0 at aa 25-47, 57-79, 86-108, 128-150, 163-185, 209-231, 243-265, 292-314, 334-356, 366-388, 409-431 and 435-457 568708003742 12 probable transmembrane helices predicted for STM_MW23811 by TMHMM2.0 at aa 7-29, 39-61, 82-101, 116-138, 151-173, 193-215, 235-257, 281-303, 332-354, 358-380, 403-425 and 435-457 568708003752 4 probable transmembrane helices predicted for STM_MW23851 by TMHMM2.0 at aa 4-26, 31-53, 63-85 and 98-120 568708003754 1 probable transmembrane helix predicted for STM_MW23861 by TMHMM2.0 at aa 10-27 568708003758 4 probable transmembrane helices predicted for STM_MW23891 by TMHMM2.0 at aa 27-49, 71-93, 158-180 and 190-208 568708003765 1 probable transmembrane helix predicted for STM_MW23931 by TMHMM2.0 at aa 310-332 568708003766 12 probable transmembrane helices predicted for STM_MW23941 by TMHMM2.0 at aa 20-42, 52-71, 83-105, 120-142, 149-171, 176-198, 210-232, 247-269, 276-298, 303-325, 338-360 and 370-389 568708003769 Signal peptide predicted for STM_MW23981 by SignalP 2.0 HMM (Signal peptide probability 0.967) with cleavage site probability 0.546 between residues 24 and 25 568708003770 7 probable transmembrane helices predicted for STM_MW23991 by TMHMM2.0 at aa 12-31, 41-63, 75-97, 117-139, 146-163, 168-187 and 194-216 568708003772 Signal peptide predicted for STM_MW23991 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.858 between residues 36 and 37 568708003779 8 probable transmembrane helices predicted for STM_MW24041 by TMHMM2.0 at aa 7-28, 32-54, 85-104, 108-127, 139-158, 163-182, 195-217 and 237-255 568708003781 Signal peptide predicted for STM_MW24041 by SignalP 2.0 HMM (Signal peptide probability 0.847) with cleavage site probability 0.756 between residues 25 and 26 568708003783 Signal peptide predicted for STM_MW24051 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.995 between residues 19 and 20 568708003794 Signal peptide predicted for STM_MW24131 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 27 and 28 568708003797 Signal peptide predicted for STM_MW24141 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.383 between residues 21 and 22 568708003799 6 probable transmembrane helices predicted for STM_MW24151 by TMHMM2.0 at aa 62-84, 94-116, 137-159, 190-209, 216-235 and 255-277 568708003801 Signal peptide predicted for STM_MW24161 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 20 and 21 568708003805 2 probable transmembrane helices predicted for STM_MW24181 by TMHMM2.0 at aa 20-39 and 335-357 568708003808 Signal peptide predicted for STM_MW24181 by SignalP 2.0 HMM (Signal peptide probability 0.869) with cleavage site probability 0.640 between residues 39 and 40 568708003810 12 probable transmembrane helices predicted for STM_MW24201 by TMHMM2.0 at aa 21-43, 63-85, 98-120, 124-146, 158-180, 190-207, 260-282, 297-315, 327-344, 348-370, 377-399 and 414-436 568708003813 3 probable transmembrane helices predicted for STM_MW24231 by TMHMM2.0 at aa 2-24, 29-48 and 55-77 568708003815 1 probable transmembrane helix predicted for STM_MW24241 by TMHMM2.0 at aa 20-42 568708003818 Signal peptide predicted for STM_MW24281 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.898 between residues 29 and 30 568708003819 11 probable transmembrane helices predicted for STM_MW24281 by TMHMM2.0 at aa 9-31, 57-74, 95-117, 148-170, 186-208, 223-245, 258-280, 295-317, 322-341, 345-363 and 376-398 568708003825 Signal peptide predicted for STM_MW24311 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.992 between residues 21 and 22 568708003827 11 probable transmembrane helices predicted for STM_MW24321 by TMHMM2.0 at aa 17-39, 54-76, 96-118, 123-145, 157-176, 196-218, 239-261, 281-303, 324-343, 348-370 and 390-412 568708003829 Signal peptide predicted for STM_MW24331 by SignalP 2.0 HMM (Signal peptide probability 0.620) with cleavage site probability 0.416 between residues 23 and 24 568708003830 8 probable transmembrane helices predicted for STM_MW24331 by TMHMM2.0 at aa 4-23, 30-48, 86-108, 194-216, 249-271, 278-300, 342-364 and 377-399 568708003836 8 probable transmembrane helices predicted for STM_MW24341 by TMHMM2.0 at aa 10-32, 39-61, 86-108, 121-143, 163-185, 214-236, 246-268 and 289-311 568708003844 12 probable transmembrane helices predicted for STM_MW24391 by TMHMM2.0 at aa 12-30, 40-62, 71-90, 94-116, 128-150, 160-179, 211-233, 253-275, 282-301, 306-328, 348-370 and 380-402 568708003849 Signal peptide predicted for STM_MW24441 by SignalP 2.0 HMM (Signal peptide probability 0.932) with cleavage site probability 0.870 between residues 28 and 29 568708003850 9 probable transmembrane helices predicted for STM_MW24441 by TMHMM2.0 at aa 7-24, 29-48, 69-91, 101-123, 130-152, 167-189, 202-224, 229-251 and 272-294 568708003858 1 probable transmembrane helix predicted for STM_MW24471 by TMHMM2.0 at aa 22-44 568708003859 4 probable transmembrane helices predicted for STM_MW24481 by TMHMM2.0 at aa 31-53, 68-90, 151-173 and 220-242 568708003871 Signal peptide predicted for STM_MW24571 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.990 between residues 25 and 26 568708003872 1 probable transmembrane helix predicted for STM_MW24581 by TMHMM2.0 at aa 7-29 568708003876 6 probable transmembrane helices predicted for STM_MW24611 by TMHMM2.0 at aa 21-43, 66-88, 101-123, 143-162, 201-223 and 246-268 568708003878 7 probable transmembrane helices predicted for STM_MW24621 by TMHMM2.0 at aa 15-37, 62-84, 104-126, 138-160, 188-205, 212-234 and 244-266 568708003880 Signal peptide predicted for STM_MW24621 by SignalP 2.0 HMM (Signal peptide probability 0.987) with cleavage site probability 0.461 between residues 45 and 46 568708003882 Signal peptide predicted for STM_MW24631 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 25 and 26 568708003886 Signal peptide predicted for STM_MW24661 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.566 between residues 27 and 28 568708003888 4 probable transmembrane helices predicted for STM_MW24671 by TMHMM2.0 at aa 19-41, 61-78, 90-112 and 116-135 568708003890 Signal peptide predicted for STM_MW24691 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.900 between residues 34 and 35 568708003893 3 probable transmembrane helices predicted for STM_MW24711 by TMHMM2.0 at aa 19-36, 51-73 and 86-108 568708003902 10 probable transmembrane helices predicted for STM_MW24791 by TMHMM2.0 at aa 7-29, 58-80, 87-109, 124-146, 153-175, 190-212, 231-253, 273-295, 308-330 and 370-392 568708003922 1 probable transmembrane helix predicted for STM_MW24951 by TMHMM2.0 at aa 5-24 568708003923 Signal peptide predicted for STM_MW24951 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.999 between residues 21 and 22 568708003925 Signal peptide predicted for STM_MW24971 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 19 and 20 568708003929 Signal peptide predicted for STM_MW24991 by SignalP 2.0 HMM (Signal peptide probability 0.901) with cleavage site probability 0.731 between residues 40 and 41 568708003930 2 probable transmembrane helices predicted for STM_MW24991 by TMHMM2.0 at aa 15-37 and 147-169 568708003934 Signal peptide predicted for STM_MW25001 by SignalP 2.0 HMM (Signal peptide probability 0.914) with cleavage site probability 0.584 between residues 34 and 35 568708003936 11 probable transmembrane helices predicted for STM_MW25001 by TMHMM2.0 at aa 10-32, 337-359, 364-386, 438-460, 470-492, 538-560, 868-890, 897-919, 924-946, 972-994 and 1004-1026 568708003944 1 probable transmembrane helix predicted for STM_MW25041 by TMHMM2.0 at aa 38-60 568708003950 7 probable transmembrane helices predicted for STM_MW25101 by TMHMM2.0 at aa 25-59, 79-101, 162-184, 224-243, 258-280, 285-307 and 317-339 568708003952 Signal peptide predicted for STM_MW25111 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 27 and 28 568708003957 12 probable transmembrane helices predicted for STM_MW25141 by TMHMM2.0 at aa 13-35, 39-61, 68-85, 89-108, 121-143, 158-180, 185-207, 227-249, 304-326, 331-353, 365-387 and 392-411 568708003965 8 probable transmembrane helices predicted for STM_MW25201 by TMHMM2.0 at aa 15-37, 44-66, 81-103, 124-146, 166-188, 216-238, 253-275 and 295-317 568708003967 Signal peptide predicted for STM_MW25201 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.653 between residues 36 and 37 568708003978 pfam_scan;Pfam:PF05688; E()=9.7E-20;score=69.3;query209-255;description=DUF824; pfam_scan;Pfam:PF05689; E()=6.9E-52;score=175.2;query 278-459;description=DUF823; tmhmm; query 1-2434 568708003983 1 probable transmembrane helix predicted for STM_MW25321 by TMHMM2.0 at aa 13-32 568708003984 Signal peptide predicted for STM_MW25321 by SignalP 2.0 HMM (Signal peptide probability 0.994) with cleavage site probability 0.905 between residues 30 and 31 568708003985 1 probable transmembrane helix predicted for STM_MW25331 by TMHMM2.0 at aa 12-29 568708003986 Signal peptide predicted for STM_MW25331 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.951 between residues 28 and 29 568708003987 Signal peptide predicted for STM_MW25341 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.828 between residues 22 and 23 568708003992 Signal peptide predicted for STM_MW25371 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.942 between residues 24 and 25 568708003994 1 probable transmembrane helix predicted for STM_MW25381 by TMHMM2.0 at aa 21-43 568708003999 1 probable transmembrane helix predicted for STM_MW25411 by TMHMM2.0 at aa 111-133 568708004004 8 probable transmembrane helices predicted for STM_MW25451 by TMHMM2.0 at aa 4-26, 47-69, 84-103, 110-132, 142-164, 171-193, 221-240 and 247-266 568708004009 Signal peptide predicted for STM_MW25471 by SignalP 2.0 HMM (Signal peptide probability 0.981) with cleavage site probability 0.650 between residues 48 and 49 568708004013 1 probable transmembrane helix predicted for STM_MW25481 by TMHMM2.0 at aa 9-28 568708004014 Signal peptide predicted for STM_MW25481 by SignalP 2.0 HMM (Signal peptide probability 0.996) with cleavage site probability 0.996 between residues 27 and 28 568708004017 Signal peptide predicted for STM_MW25491 by SignalP 2.0 HMM (Signal peptide probability 0.715) with cleavage site probability 0.464 between residues 21 and 22 568708004032 1 probable transmembrane helix predicted for STM_MW25641 by TMHMM2.0 at aa 13-35 568708004040 7 probable transmembrane helices predicted for STM_MW25681 by TMHMM2.0 at aa 13-35, 75-97, 110-132, 147-169, 225-247, 251-273 and 294-316 568708004043 1 probable transmembrane helix predicted for STM_MW25691 by TMHMM2.0 at aa 7-24 568708004044 Signal peptide predicted for STM_MW25691 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.957 between residues 22 and 23 568708004047 12 probable transmembrane helices predicted for STM_MW25711 by TMHMM2.0 at aa 9-31, 41-63, 70-89, 93-111, 132-154, 158-180, 207-229, 234-256, 269-288, 293-315, 328-350 and 354-371 568708004053 1 probable transmembrane helix predicted for STM_MW25741 by TMHMM2.0 at aa 162-184 568708004054 Signal peptide predicted for STM_MW25751 by SignalP 2.0 HMM (Signal peptide probability 0.857) with cleavage site probability 0.420 between residues 26 and 27 568708004055 12 probable transmembrane helices predicted for STM_MW25751 by TMHMM2.0 at aa 7-29, 39-58, 93-115, 120-142, 149-171, 186-208, 220-242, 265-287, 322-344, 354-371, 384-403 and 407-424 568708004060 14 probable transmembrane helices predicted for STM_MW25771 by TMHMM2.0 at aa 9-31, 46-68, 71-93, 103-125, 138-160, 164-186, 207-229, 234-251, 264-281, 307-329, 341-363, 373-395, 407-429 and 449-471 568708004065 Signal peptide predicted for STM_MW25801 by SignalP 2.0 HMM (Signal peptide probability 0.780) with cleavage site probability 0.716 between residues 41 and 42 568708004067 2 probable transmembrane helices predicted for STM_MW25811 by TMHMM2.0 at aa 15-37 and 179-201 568708004069 Signal peptide predicted for STM_MW25811 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.921 between residues 34 and 35 568708004072 Signal peptide predicted for STM_MW25831 by SignalP 2.0 HMM (Signal peptide probability 0.941) with cleavage site probability 0.504 between residues 21 and 22 568708004073 1 probable transmembrane helix predicted for STM_MW25831 by TMHMM2.0 at aa 7-29 568708004077 1 probable transmembrane helix predicted for STM_MW25851 by TMHMM2.0 at aa 35-54 568708004078 9 probable transmembrane helices predicted for STM_MW25861 by TMHMM2.0 at aa 116-138, 153-175, 182-204, 214-231, 287-309, 324-346, 359-381, 396-418 and 425-447 568708004086 12 probable transmembrane helices predicted for STM_MW25901 by TMHMM2.0 at aa 10-29, 42-64, 74-93, 98-115, 130-152, 165-184, 213-235, 242-264, 274-296, 301-323, 338-357 and 364-386 568708004100 2 probable transmembrane helices predicted for STM_MW25981 by TMHMM2.0 at aa 5-27 and 60-82 568708004106 BTP4 568708004107 1 probable transmembrane helix predicted for STM_MW26011 by TMHMM2.0 at aa 4-26 568708004111 Signal peptide predicted for STM_MW26071 by SignalP 2.0 HMM (Signal peptide probability 0.769) with cleavage site probability 0.442 between residues 18 and 19 568708004115 Signal peptide predicted for STM_MW26071 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.978 between residues 25 and 26 568708004118 2 probable transmembrane helices predicted for STM_MW26101 by TMHMM2.0 at aa 100-117 and 122-144 568708004139 Signal peptide predicted for STM_MW26301 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.945 between residues 24 and 25 568708004142 Signal peptide predicted for STM_MW26311 by SignalP 2.0 HMM (Signal peptide probability 0.934) with cleavage site probability 0.701 between residues 24 and 25 568708004145 2 probable transmembrane helices predicted for STM_MW26322 by TMHMM2.0 at aa 21-43 and 70-92 568708004151 cggtaggcatcgaatgatttac; Pr21F 568708004152 gtcagaagatagctggtatgac; Pr21R 568708004154 1 probable transmembrane helix predicted for STM_MW26411 by TMHMM2.0 at aa 170-189 568708004166 2 probable transmembrane helices predicted for STM_MW26571 by TMHMM2.0 at aa 78-100 and 104-121 568708004168 Signal peptide predicted for STM_MW26581 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.948 between residues 23 and 24 568708004180 6 probable transmembrane helices predicted for STM_MW26651 by TMHMM2.0 at aa 10-32, 44-66, 70-92, 105-127, 142-164 and 177-194 568708004191 12 probable transmembrane helices predicted for STM_MW26741 by TMHMM2.0 at aa 21-43, 63-85, 97-114, 119-141, 161-183, 198-215, 245-267, 282-304, 311-328, 338-360, 373-395 and 405-424 568708004200 Signal peptide predicted for STM_MW26791 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.476 between residues 23 and 24 568708004208 Signal peptide predicted for STM_MW26851 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 22 and 23 568708004209 Signal peptide predicted for STM_MW26861 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.512 between residues 38 and 39 568708004210 2 probable transmembrane helices predicted for STM_MW26861 by TMHMM2.0 at aa 21-43 and 153-175 568708004220 Signal peptide predicted for STM_MW26921 by SignalP 2.0 HMM (Signal peptide probability 0.764) with cleavage site probability 0.439 between residues 17 and 18 568708004221 8 probable transmembrane helices predicted for STM_MW26921 by TMHMM2.0 at aa 2-24, 34-56, 63-85, 90-109, 129-151, 176-198, 210-227 and 237-254 568708004224 3 probable transmembrane helices predicted for STM_MW26931 by TMHMM2.0 at aa 33-55, 65-83 and 95-117 568708004231 Signal peptide predicted for STM_MW26991 by SignalP 2.0 HMM (Signal peptide probability 0.981) with cleavage site probability 0.424 between residues 22 and 23 568708004236 Signal peptide predicted for STM_MW27041 by SignalP 2.0 HMM (Signal peptide probability 0.774) with cleavage site probability 0.556 between residues 22 and 23 568708004238 5 probable transmembrane helices predicted for STM_MW27051 by TMHMM2.0 at aa 168-190, 205-222, 281-303, 307-324 and 389-411 568708004241 1 probable transmembrane helix predicted for STM_MW27061 by TMHMM2.0 at aa 13-35 568708004243 phage insertion 568708004244 pfam_scan;Pfam:PF00589; E()=2.4E-18;score=66.3;query229- 382;description=Phage_integrase 568708004252 3 probable transmembrane helices predicted for STM_MW27171 by TMHMM2.0 at aa 20-42, 63-85 and 142-164 568708004255 4 probable transmembrane helices predicted for STM_MW27191 by TMHMM2.0 at aa 190-212, 219-241, 256-278 and 299-321 568708004263 10 probable transmembrane helices predicted for STM_MW27261 by TMHMM2.0 at aa 13-35, 61-83, 90-112, 127-149, 170-192, 271-293, 306-324, 328-350, 352-374 and 380-402 568708004265 Signal peptide predicted for STM_MW27261 by SignalP 2.0 HMM (Signal peptide probability 0.983) with cleavage site probability 0.462 between residues 38 and 39 568708004267 4 probable transmembrane helices predicted for STM_MW27301 by TMHMM2.0 at aa 30-52, 110-132, 145-167 and 177-199 568708004269 pfam_scan;Pfam:PF00665; E()=1.2E-19;score=70.3;query61-195;description=rve 568708004280 1 probable transmembrane helix predicted for STM_MW27391 by TMHMM2.0 at aa 165-182 568708004283 11 probable transmembrane helices predicted for STM_MW27411 by TMHMM2.0 at aa 27-49, 64-83, 138-160, 165-182, 243-265, 280-302, 649-671, 686-708, 767-786, 790-809 and 871-893 568708004287 Signal peptide predicted for STM_MW27431 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.992 between residues 28 and 29 568708004288 1 probable transmembrane helix predicted for STM_MW27431 by TMHMM2.0 at aa 13-30 568708004292 Signal peptide predicted for STM_MW27441 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.937 between residues 25 and 26 568708004296 7 probable transmembrane helices predicted for STM_MW27501 by TMHMM2.0 at aa 10-32, 76-98, 118-140, 176-198, 213-235, 256-278 and 306-325 568708004298 Signal peptide predicted for STM_MW27501 by SignalP 2.0 HMM (Signal peptide probability 0.871) with cleavage site probability 0.611 between residues 23 and 24 568708004301 2 probable transmembrane helices predicted for STM_MW27511 by TMHMM2.0 at aa 15-37 and 170-192 568708004303 Signal peptide predicted for STM_MW27511 by SignalP 2.0 HMM (Signal peptide probability 0.996) with cleavage site probability 0.532 between residues 36 and 37 568708004306 Signal peptide predicted for STM_MW27531 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 22 and 23 568708004308 4 probable transmembrane helices predicted for STM_MW27541 by TMHMM2.0 at aa 7-24, 39-56, 69-91 and 106-128 568708004310 12 probable transmembrane helices predicted for STM_MW27551 by TMHMM2.0 at aa 20-42, 47-69, 110-132, 142-164, 171-193, 208-230, 260-282, 321-343, 356-378, 388-410, 415-433 and 470-492 568708004315 Signal peptide predicted for STM_MW27601 by SignalP 2.0 HMM (Signal peptide probability 0.617) with cleavage site probability 0.573 between residues 41 and 42 568708004317 12 probable transmembrane helices predicted for STM_MW27601 by TMHMM2.0 at aa 19-41, 46-65, 86-108, 123-145, 152-174, 202-224, 245-267, 287-309, 335-357, 362-381, 401-423 and 427-449 568708004323 2 probable transmembrane helices predicted for STM_MW27631 by TMHMM2.0 at aa 2-20 and 25-47 568708004327 2 probable transmembrane helices predicted for STM_MW27651 by TMHMM2.0 at aa 117-139 and 143-165 568708004330 4 probable transmembrane helices predicted for STM_MW27671 by TMHMM2.0 at aa 12-34, 44-62, 83-105 and 110-132 568708004344 6 probable transmembrane helices predicted for STM_MW27771 by TMHMM2.0 at aa 94-116, 120-142, 149-171, 197-219, 272-294 and 298-320 568708004346 Signal peptide predicted for STM_MW27781 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 21 and 22 568708004348 Signal peptide predicted for STM_MW27791 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.590 between residues 25 and 26 568708004349 12 probable transmembrane helices predicted for STM_MW27791 by TMHMM2.0 at aa 11-33, 48-70, 77-94, 104-126, 133-155, 160-182, 217-239, 249-271, 278-295, 300-322, 335-357 and 362-384 568708004352 Signal peptide predicted for STM_MW27811 by SignalP 2.0 HMM (Signal peptide probability 0.966) with cleavage site probability 0.948 between residues 37 and 38 568708004353 1 probable transmembrane helix predicted for STM_MW27811 by TMHMM2.0 at aa 23-45 568708004355 13 probable transmembrane helices predicted for STM_MW27821 by TMHMM2.0 at aa 13-35, 50-72, 79-101, 106-128, 140-162, 167-189, 201-218, 228-250, 270-292, 302-324, 336-353, 368-390 and 480-498 568708004357 Signal peptide predicted for STM_MW27831 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 20 and 21 568708004360 4 probable transmembrane helices predicted for STM_MW27861 by TMHMM2.0 at aa 15-37, 42-64, 84-106 and 118-140 568708004362 Signal peptide predicted for STM_MW27861 by SignalP 2.0 HMM (Signal peptide probability 0.965) with cleavage site probability 0.824 between residues 18 and 19 568708004371 Signal peptide predicted for STM_MW27931 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.784 between residues 25 and 26 568708004373 3 probable transmembrane helices predicted for STM_MW27941 by TMHMM2.0 at aa 26-48, 68-90 and 134-156 568708004375 4 probable transmembrane helices predicted for STM_MW27951 by TMHMM2.0 at aa 181-203, 218-240, 247-269 and 300-322 568708004379 Signal peptide predicted for STM_MW27981 by SignalP 2.0 HMM (Signal peptide probability 0.907) with cleavage site probability 0.897 between residues 20 and 21 568708004380 1 probable transmembrane helix predicted for STM_MW27981 by TMHMM2.0 at aa 2-24 568708004397 1 probable transmembrane helix predicted for STM_MW28061 by TMHMM2.0 at aa 13-35 568708004398 Signal peptide predicted for STM_MW28061 by SignalP 2.0 HMM (Signal peptide probability 0.969) with cleavage site probability 0.849 between residues 30 and 31 568708004406 7 probable transmembrane helices predicted for STM_MW28121 by TMHMM2.0 at aa 5-27, 62-84, 94-111, 132-154, 169-188, 252-274 and 289-306 568708004408 15 probable transmembrane helices predicted for STM_MW28131 by TMHMM2.0 at aa 4-26, 31-53, 73-95, 108-125, 129-148, 155-177, 197-219, 231-253, 257-279, 292-311, 326-348, 373-395, 415-437, 457-479 and 499-521 568708004410 Signal peptide predicted for STM_MW28131 by SignalP 2.0 HMM (Signal peptide probability 0.996) with cleavage site probability 0.571 between residues 31 and 32 568708004423 Signal peptide predicted for STM_MW28231 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 26 and 27 568708004424 1 probable transmembrane helix predicted for STM_MW28231 by TMHMM2.0 at aa 7-26 568708004428 7 probable transmembrane helices predicted for STM_MW28251 by TMHMM2.0 at aa 15-37, 50-72, 92-114, 121-143, 182-204, 217-239 and 249-271 568708004430 8 probable transmembrane helices predicted for STM_MW28261 by TMHMM2.0 at aa 21-43, 58-80, 93-115, 130-152, 169-191, 196-215, 222-244 and 248-267 568708004435 1 probable transmembrane helix predicted for STM_MW28331 by TMHMM2.0 at aa 207-229 568708004439 1 probable transmembrane helix predicted for STM_MW28361 by TMHMM2.0 at aa 141-163 568708004451 2 probable transmembrane helices predicted for STM_MW28471 by TMHMM2.0 at aa 320-342 and 408-430 568708004455 4 probable transmembrane helices predicted for STM_MW28491 by TMHMM2.0 at aa 29-51, 72-94, 136-153 and 178-200 568708004457 6 probable transmembrane helices predicted for STM_MW28501 by TMHMM2.0 at aa 10-32, 37-59, 79-101, 128-150, 181-203 and 210-232 568708004459 2 probable transmembrane helices predicted for STM_MW28511 by TMHMM2.0 at aa 12-34 and 49-71 568708004461 3 probable transmembrane helices predicted for STM_MW28521 by TMHMM2.0 at aa 15-37, 50-69 and 161-183 568708004468 8 probable transmembrane helices predicted for STM_MW28581 by TMHMM2.0 at aa 13-30, 35-57, 69-91, 106-128, 197-219, 239-261, 274-291 and 296-315 568708004472 Signal peptide predicted for STM_MW28601 by SignalP 2.0 HMM (Signal peptide probability 0.992) with cleavage site probability 0.635 between residues 24 and 25 568708004473 Signal peptide predicted for STM_MW28621 by SignalP 2.0 HMM (Signal peptide probability 0.697) with cleavage site probability 0.323 between residues 26 and 27 568708004486 12 probable transmembrane helices predicted for STM_MW28741 by TMHMM2.0 at aa 7-29, 42-64, 69-88, 98-120, 129-151, 161-183, 203-225, 235-257, 270-289, 299-321, 342-361 and 366-388 568708004487 Signal peptide predicted for STM_MW28751 by SignalP 2.0 HMM (Signal peptide probability 0.838) with cleavage site probability 0.374 between residues 30 and 31 568708004491 12 probable transmembrane helices predicted for STM_MW28761 by TMHMM2.0 at aa 4-23, 30-48, 58-80, 104-126, 176-198, 241-263, 278-300, 320-337, 357-379, 392-414, 434-456 and 463-485 568708004508 Signal peptide predicted for STM_MW28881 by SignalP 2.0 HMM (Signal peptide probability 0.964) with cleavage site probability 0.522 between residues 30 and 31 568708004515 tmhmm; query 1-118 568708004520 Signal peptide predicted for STM_MW28991 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 24 and 25 568708004542 1 probable transmembrane helix predicted for STM_MW29161 by TMHMM2.0 at aa 7-29 568708004543 Signal peptide predicted for STM_MW29161 by SignalP 2.0 HMM (Signal peptide probability 0.616) with cleavage site probability 0.525 between residues 26 and 27 568708004552 2 probable transmembrane helices predicted for STM_MW29211 by TMHMM2.0 at aa 10-32 and 177-199 568708004563 12 probable transmembrane helices predicted for STM_MW29251 by TMHMM2.0 at aa 20-42, 57-79, 86-105, 110-132, 152-174, 179-201, 256-278, 293-315, 328-348, 352-374, 387-409 and 414-436 568708004571 11 probable transmembrane helices predicted for STM_MW29331 by TMHMM2.0 at aa 24-41, 45-67, 103-125, 140-157, 164-186, 206-228, 249-271, 300-322, 351-373, 377-394 and 406-428 568708004579 12 probable transmembrane helices predicted for STM_MW29381 by TMHMM2.0 at aa 24-41, 61-83, 88-110, 120-142, 155-177, 212-234, 260-282, 292-314, 327-346, 351-373, 382-404 and 414-431 568708004590 4 probable transmembrane helices predicted for STM_MW29441 by TMHMM2.0 at aa 5-27, 37-59, 66-88 and 98-120 568708004592 Signal peptide predicted for STM_MW29441 by SignalP 2.0 HMM (Signal peptide probability 0.993) with cleavage site probability 0.682 between residues 24 and 25 568708004596 1 probable transmembrane helix predicted for STM_MW29461 by TMHMM2.0 at aa 5-27 568708004597 Signal peptide predicted for STM_MW29461 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.586 between residues 21 and 22 568708004600 10 probable transmembrane helices predicted for STM_MW29491 by TMHMM2.0 at aa 2-19, 29-48, 61-83, 88-110, 115-137, 141-158, 165-187, 197-219, 226-248 and 253-275 568708004605 Signal peptide predicted for STM_MW29511 by SignalP 2.0 HMM (Signal peptide probability 0.911) with cleavage site probability 0.584 between residues 23 and 24 568708004608 Signal peptide predicted for STM_MW29521 by SignalP 2.0 HMM (Signal peptide probability 0.969) with cleavage site probability 0.946 between residues 31 and 32 568708004616 Signal peptide predicted for STM_MW29561 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.986 between residues 23 and 24 568708004618 1 probable transmembrane helix predicted for STM_MW29581 by TMHMM2.0 at aa 15-37 568708004620 1 probable transmembrane helix predicted for STM_MW29591 by TMHMM2.0 at aa 10-27 568708004621 Signal peptide predicted for STM_MW29591 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.819 between residues 26 and 27 568708004622 1 probable transmembrane helix predicted for STM_MW29601 by TMHMM2.0 at aa 7-26 568708004623 1 probable transmembrane helix predicted for STM_MW29611 by TMHMM2.0 at aa 7-29 568708004625 5 probable transmembrane helices predicted for STM_MW29631 by TMHMM2.0 at aa 15-37, 58-80, 95-117, 223-245 and 260-282 568708004633 7 probable transmembrane helices predicted for STM_MW29671 by TMHMM2.0 at aa 20-42, 55-77, 90-107, 128-145, 160-182, 189-208 and 218-236 568708004635 Signal peptide predicted for STM_MW29681 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.678 between residues 19 and 20 568708004636 1 probable transmembrane helix predicted for STM_MW29681 by TMHMM2.0 at aa 4-26 568708004639 12 probable transmembrane helices predicted for STM_MW29701 by TMHMM2.0 at aa 19-41, 51-73, 94-116, 136-158, 163-185, 195-213, 220-242, 257-279, 286-305, 309-331, 344-366 and 371-393 568708004641 Signal peptide predicted for STM_MW29701 by SignalP 2.0 HMM (Signal peptide probability 0.668) with cleavage site probability 0.639 between residues 29 and 30 568708004646 pfam_scan;Pfam:PF00356; E()=1.3E-18;score=66.2;query4-49;description=LacI; pfam_scan;Pfam:PF00532; E()=8.3E-31;score=106.7;query 61-286;description=Peripla_BP_1 568708004655 12 probable transmembrane helices predicted for STM_MW29781 by TMHMM2.0 at aa 24-46, 61-83, 90-112, 116-138, 150-167, 177-199, 259-281, 296-318, 325-347, 362-384, 397-419 and 424-446 568708004663 4 probable transmembrane helices predicted for STM_MW29831 by TMHMM2.0 at aa 24-46, 56-75, 95-117 and 121-143 568708004665 10 probable transmembrane helices predicted for STM_MW29841 by TMHMM2.0 at aa 20-42, 86-108, 123-145, 152-174, 194-216, 236-258, 287-309, 334-356, 360-382 and 389-408 568708004668 Signal peptide predicted for STM_MW29881 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 29 and 30 568708004671 Signal peptide predicted for STM_MW29891 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.677 between residues 27 and 28 568708004673 Signal peptide predicted for STM_MW29901 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.994 between residues 21 and 22 568708004675 2 probable transmembrane helices predicted for STM_MW29911 by TMHMM2.0 at aa 15-34 and 47-69 568708004676 Signal peptide predicted for STM_MW29911 by SignalP 2.0 HMM (Signal peptide probability 0.981) with cleavage site probability 0.981 between residues 64 and 65 568708004678 Signal peptide predicted for STM_MW29921 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 22 and 23 568708004680 Signal peptide predicted for STM_MW29931 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 24 and 25 568708004682 Signal peptide predicted for STM_MW29961 by SignalP 2.0 HMM (Signal peptide probability 0.676) with cleavage site probability 0.628 between residues 28 and 29 568708004686 Signal peptide predicted for STM_MW29981 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.446 between residues 32 and 33 568708004699 1 probable transmembrane helix predicted for STM_MW30061 by TMHMM2.0 at aa 20-51 568708004702 7 probable transmembrane helices predicted for STM_MW30091 by TMHMM2.0 at aa 20-42, 46-68, 89-107, 112-134, 139-161, 165-187 and 194-216 568708004712 Signal peptide predicted for STM_MW30171 by SignalP 2.0 HMM (Signal peptide probability 0.954) with cleavage site probability 0.777 between residues 25 and 26 568708004725 Signal peptide predicted for STM_MW30261 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 21 and 22 568708004726 6 probable transmembrane helices predicted for STM_MW30271 by TMHMM2.0 at aa 4-26, 39-61, 66-88, 111-133, 148-170 and 182-199 568708004730 3 probable transmembrane helices predicted for STM_MW30281 by TMHMM2.0 at aa 26-48, 68-90 and 105-127 568708004736 5 probable transmembrane helices predicted for STM_MW30331 by TMHMM2.0 at aa 10-29, 42-64, 74-96, 103-125 and 152-174 568708004737 Signal peptide predicted for STM_MW30341 by SignalP 2.0 HMM (Signal peptide probability 0.990) with cleavage site probability 0.463 between residues 24 and 25 568708004739 4 probable transmembrane helices predicted for STM_MW30341 by TMHMM2.0 at aa 15-37, 50-72, 82-104 and 215-234 568708004741 pfam_scan;Pfam:PF00005; E()=4.9E-31;score=107.9;query 29-197;description=ABC_tran 568708004749 1 probable transmembrane helix predicted for STM_MW30401 by TMHMM2.0 at aa 7-26 568708004750 Signal peptide predicted for STM_MW30401 by SignalP 2.0 HMM (Signal peptide probability 0.815) with cleavage site probability 0.482 between residues 23 and 24 568708004759 Signal peptide predicted for STM_MW30461 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.301 between residues 25 and 26 568708004764 2 probable transmembrane helices predicted for STM_MW30501 by TMHMM2.0 at aa 21-43 and 63-77 568708004768 Signal peptide predicted for STM_MW30521 by SignalP 2.0 HMM (Signal peptide probability 0.986) with cleavage site probability 0.892 between residues 30 and 31 568708004769 12 probable transmembrane helices predicted for STM_MW30521 by TMHMM2.0 at aa 13-35, 55-77, 84-103, 108-130, 142-159, 169-191, 252-274, 289-311, 318-340, 350-372, 385-407 and 417-436 568708004772 Signal peptide predicted for STM_MW30541 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 22 and 23 568708004781 4 probable transmembrane helices predicted for STM_MW30621 by TMHMM2.0 at aa 5-24, 63-85, 89-111 and 153-175 568708004788 Signal peptide predicted for STM_MW30661 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.997 between residues 21 and 22 568708004790 1 probable transmembrane helix predicted for STM_MW30671 by TMHMM2.0 at aa 7-29 568708004791 Signal peptide predicted for STM_MW30671 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 22 and 23 568708004793 Signal peptide predicted for STM_MW30681 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.735 between residues 20 and 21 568708004800 Signal peptide predicted for STM_MW30731 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.564 between residues 23 and 24 568708004803 12 probable transmembrane helices predicted for STM_MW30741 by TMHMM2.0 at aa 9-31, 41-63, 70-87, 92-114, 135-152, 162-184, 211-233, 253-275, 282-301, 311-333, 346-365 and 380-402 568708004808 6 probable transmembrane helices predicted for STM_MW30761 by TMHMM2.0 at aa 4-23, 36-58, 102-124, 145-167, 177-199 and 211-233 568708004815 Signal peptide predicted for STM_MW30821 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.993 between residues 20 and 21 568708004819 12 probable transmembrane helices predicted for STM_MW30861 by TMHMM2.0 at aa 13-35, 48-70, 90-121, 136-158, 165-187, 202-224, 236-258, 293-315, 345-362, 372-394, 407-429 and 439-456 568708004828 9 probable transmembrane helices predicted for STM_MW30941 by TMHMM2.0 at aa 7-29, 75-97, 137-159, 169-191, 236-258, 268-290, 311-333, 362-384 and 393-415 568708004829 Signal peptide predicted for STM_MW30941 by SignalP 2.0 HMM (Signal peptide probability 0.887) with cleavage site probability 0.627 between residues 31 and 32 568708004837 1 probable transmembrane helix predicted for STM_MW30991 by TMHMM2.0 at aa 65-84 568708004841 Signal peptide predicted for STM_MW31021 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.913 between residues 23 and 24 568708004846 10 probable transmembrane helices predicted for STM_MW31081 by TMHMM2.0 at aa 13-32, 52-74, 86-108, 128-150, 171-193, 208-227, 246-268, 283-302, 315-337 and 352-374 568708004849 Signal peptide predicted for STM_MW31091 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.995 between residues 26 and 27 568708004850 1 probable transmembrane helix predicted for STM_MW31101 by TMHMM2.0 at aa 332-354 568708004852 Signal peptide predicted for STM_MW31101 by SignalP 2.0 HMM (Signal peptide probability 0.995) with cleavage site probability 0.857 between residues 37 and 38 568708004855 2 probable transmembrane helices predicted for STM_MW31121 by TMHMM2.0 at aa 10-32 and 190-212 568708004856 Signal peptide predicted for STM_MW31121 by SignalP 2.0 HMM (Signal peptide probability 0.973) with cleavage site probability 0.645 between residues 36 and 37 568708004858 3 probable transmembrane helices predicted for STM_MW31131 by TMHMM2.0 at aa 10-32, 53-75 and 136-155 568708004859 1 probable transmembrane helix predicted for STM_MW31141 by TMHMM2.0 at aa 7-29 568708004862 1 probable transmembrane helix predicted for STM_MW31181 by TMHMM2.0 at aa 20-42 568708004863 3 probable transmembrane helices predicted for STM_MW31191 by TMHMM2.0 at aa 20-42, 131-153 and 177-199 568708004866 4 probable transmembrane helices predicted for STM_MW31221 by TMHMM2.0 at aa 16-38, 66-88, 158-180 and 190-212 568708004873 12 probable transmembrane helices predicted for STM_MW31261 by TMHMM2.0 at aa 13-30, 45-77, 90-112, 127-149, 192-214, 229-251, 281-300, 304-323, 336-358, 373-395, 402-424 and 461-483 568708004877 Signal peptide predicted for STM_MW31291 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 26 and 27 568708004878 1 probable transmembrane helix predicted for STM_MW31291 by TMHMM2.0 at aa 7-26 568708004880 Signal peptide predicted for STM_MW31301 by SignalP 2.0 HMM (Signal peptide probability 0.993) with cleavage site probability 0.401 between residues 28 and 29 568708004881 4 probable transmembrane helices predicted for STM_MW31301 by TMHMM2.0 at aa 11-33, 48-66, 89-111 and 131-151 568708004883 11 probable transmembrane helices predicted for STM_MW31311 by TMHMM2.0 at aa 7-29, 62-84, 105-127, 147-169, 176-198, 229-258, 279-301, 321-338, 343-360, 370-392 and 404-426 568708004887 Signal peptide predicted for STM_MW31321 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.992 between residues 27 and 28 568708004889 1 probable transmembrane helix predicted for STM_MW31331 by TMHMM2.0 at aa 2-24 568708004895 Signal peptide predicted for STM_MW31361 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.996 between residues 20 and 21 568708004898 Signal peptide predicted for STM_MW31381 by SignalP 2.0 HMM (Signal peptide probability 0.984) with cleavage site probability 0.861 between residues 31 and 32 568708004899 2 probable transmembrane helices predicted for STM_MW31381 by TMHMM2.0 at aa 13-32 and 159-181 568708004912 Signal peptide predicted for STM_MW31461 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.991 between residues 24 and 25 568708004914 Signal peptide predicted for STM_MW31471 by SignalP 2.0 HMM (Signal peptide probability 0.971) with cleavage site probability 0.413 between residues 36 and 37 568708004918 Signal peptide predicted for STM_MW31501 by SignalP 2.0 HMM (Signal peptide probability 0.962) with cleavage site probability 0.814 between residues 25 and 26 568708004919 8 probable transmembrane helices predicted for STM_MW31501 by TMHMM2.0 at aa 5-24, 31-50, 65-87, 108-130, 140-162, 169-191, 195-217 and 234-256 568708004921 1 probable transmembrane helix predicted for STM_MW31511 by TMHMM2.0 at aa 4-21 568708004922 Signal peptide predicted for STM_MW31521 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.985 between residues 27 and 28 568708004923 1 probable transmembrane helix predicted for STM_MW31521 by TMHMM2.0 at aa 9-31 568708004925 Signal peptide predicted for STM_MW31541 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.751 between residues 27 and 28 568708004928 4 probable transmembrane helices predicted for STM_MW31551 by TMHMM2.0 at aa 27-49, 59-78, 83-105 and 197-219 568708004933 3 probable transmembrane helices predicted for STM_MW31591 by TMHMM2.0 at aa 13-35, 63-85 and 98-117 568708004934 2 probable transmembrane helices predicted for STM_MW31601 by TMHMM2.0 at aa 11-33 and 46-68 568708004940 Signal peptide predicted for STM_MW31641 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.989 between residues 22 and 23 568708004942 1 probable transmembrane helix predicted for STM_MW31641 by TMHMM2.0 at aa 167-189 568708004945 7 probable transmembrane helices predicted for STM_MW31661 by TMHMM2.0 at aa 7-29, 49-71, 91-110, 120-137, 188-210, 225-247 and 254-273 568708004948 5 probable transmembrane helices predicted for STM_MW31681 by TMHMM2.0 at aa 4-26, 53-75, 80-102, 109-131 and 136-158 568708004951 Ribosomal protein S21; Region: Ribosomal_S21; cl00529 568708004965 BTP5 568708004969 4 probable transmembrane helices predicted for STM_MW31771 by TMHMM2.0 at aa 538-560, 567-589, 593-612 and 619-638 568708004977 Signal peptide predicted for STM_MW31841 by SignalP 2.0 HMM (Signal peptide probability 0.894) with cleavage site probability 0.829 between residues 19 and 20 568708004992 2 probable transmembrane helices predicted for STM_MW32031 by TMHMM2.0 at aa 4-21 and 34-53 568708005006 2 probable transmembrane helices predicted for STM_MW32171 by TMHMM2.0 at aa 12-34 and 191-210 568708005008 Signal peptide predicted for STM_MW32171 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.408 between residues 33 and 34 568708005017 Signal peptide predicted for STM_MW32231 by SignalP 2.0 HMM (Signal peptide probability 0.792) with cleavage site probability 0.231 between residues 43 and 44 568708005018 1 probable transmembrane helix predicted for STM_MW32231 by TMHMM2.0 at aa 19-41 568708005021 9 probable transmembrane helices predicted for STM_MW32251 by TMHMM2.0 at aa 10-29, 42-64, 79-101, 114-136, 142-161, 198-220, 235-257, 264-286 and 290-312 568708005023 8 probable transmembrane helices predicted for STM_MW32261 by TMHMM2.0 at aa 13-35, 50-72, 84-106, 141-163, 191-213, 218-240, 292-314 and 329-351 568708005025 6 probable transmembrane helices predicted for STM_MW32271 by TMHMM2.0 at aa 19-38, 42-64, 71-93, 126-148, 153-175 and 190-212 568708005027 Signal peptide predicted for STM_MW32281 by SignalP 2.0 HMM (Signal peptide probability 0.928) with cleavage site probability 0.396 between residues 34 and 35 568708005028 1 probable transmembrane helix predicted for STM_MW32281 by TMHMM2.0 at aa 12-31 568708005029 Signal peptide predicted for STM_MW32291 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.959 between residues 20 and 21 568708005032 2 probable transmembrane helices predicted for STM_MW32301 by TMHMM2.0 at aa 50-72 and 82-104 568708005034 4 probable transmembrane helices predicted for STM_MW32321 by TMHMM2.0 at aa 40-62, 77-99, 104-121 and 136-153 568708005037 3 probable transmembrane helices predicted for STM_MW32341 by TMHMM2.0 at aa 24-46, 51-70 and 82-101 568708005042 11 probable transmembrane helices predicted for STM_MW32391 by TMHMM2.0 at aa 38-60, 65-87, 112-134, 149-171, 184-206, 221-243, 264-286, 318-340, 363-385, 389-411 and 423-442 568708005048 11 probable transmembrane helices predicted for STM_MW32431 by TMHMM2.0 at aa 23-40, 44-66, 97-119, 134-156, 163-185, 212-234, 255-277, 315-337, 358-380, 390-409 and 422-440 568708005065 8 probable transmembrane helices predicted for STM_MW32551 by TMHMM2.0 at aa 133-155, 175-197, 209-231, 251-270, 291-310, 330-352, 391-413 and 428-450 568708005070 Signal peptide predicted for STM_MW32591 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 19 and 20 568708005072 9 probable transmembrane helices predicted for STM_MW32601 by TMHMM2.0 at aa 4-26, 39-61, 91-113, 134-156, 225-247, 299-321, 331-348, 353-375 and 411-433 568708005079 Signal peptide predicted for STM_MW32641 by SignalP 2.0 HMM (Signal peptide probability 0.840) with cleavage site probability 0.396 between residues 30 and 31 568708005083 Signal peptide predicted for STM_MW32671 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.540 between residues 22 and 23 568708005084 1 probable transmembrane helix predicted for STM_MW32671 by TMHMM2.0 at aa 7-29 568708005095 1 probable transmembrane helix predicted for STM_MW32771 by TMHMM2.0 at aa 5-27 568708005097 10 probable transmembrane helices predicted for STM_MW32791 by TMHMM2.0 at aa 10-32, 59-81, 96-118, 125-147, 162-184, 197-219, 256-278, 290-312, 317-339 and 360-382 568708005102 Signal peptide predicted for STM_MW32811 by SignalP 2.0 HMM (Signal peptide probability 0.996) with cleavage site probability 0.958 between residues 22 and 23 568708005123 2 probable transmembrane helices predicted for STM_MW32911 by TMHMM2.0 at aa 5-22 and 51-73 568708005133 2 probable transmembrane helices predicted for STM_MW32951 by TMHMM2.0 at aa 5-24 and 97-119 568708005134 Signal peptide predicted for STM_MW32951 by SignalP 2.0 HMM (Signal peptide probability 0.701) with cleavage site probability 0.380 between residues 27 and 28 568708005139 Signal peptide predicted for STM_MW32991 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.997 between residues 20 and 21 568708005144 10 probable transmembrane helices predicted for STM_MW33011 by TMHMM2.0 at aa 20-39, 54-73, 86-108, 118-135, 144-166, 170-192, 205-227, 232-254, 261-283 and 293-315 568708005153 Signal peptide predicted for STM_MW33091 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.861 between residues 21 and 22 568708005155 1 probable transmembrane helix predicted for STM_MW33101 by TMHMM2.0 at aa 9-31 568708005156 Signal peptide predicted for STM_MW33101 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.870 between residues 28 and 29 568708005157 5 probable transmembrane helices predicted for STM_MW33111 by TMHMM2.0 at aa 48-70, 85-107, 148-170, 197-219 and 239-258 568708005161 9 probable transmembrane helices predicted for STM_MW33131 by TMHMM2.0 at aa 13-35, 55-77, 86-105, 115-137, 158-180, 190-212, 225-247, 257-276 and 283-305 568708005165 Signal peptide predicted for STM_MW33161 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.708 between residues 25 and 26 568708005166 1 probable transmembrane helix predicted for STM_MW33161 by TMHMM2.0 at aa 7-25 568708005168 Signal peptide predicted for STM_MW33171 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.984 between residues 27 and 28 568708005180 Signal peptide predicted for STM_MW33251 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.755 between residues 46 and 47 568708005181 1 probable transmembrane helix predicted for STM_MW33251 by TMHMM2.0 at aa 19-41 568708005188 2 probable transmembrane helices predicted for STM_MW33271 by TMHMM2.0 at aa 20-42 and 55-77 568708005189 Signal peptide predicted for STM_MW33271 by SignalP 2.0 HMM (Signal peptide probability 0.907) with cleavage site probability 0.597 between residues 41 and 42 568708005199 12 probable transmembrane helices predicted for STM_MW33321 by TMHMM2.0 at aa 21-43, 53-75, 96-118, 128-150, 152-174, 189-211, 223-245, 255-277, 296-318, 323-345, 358-375 and 380-402 568708005205 14 probable transmembrane helices predicted for STM_MW33371 by TMHMM2.0 at aa 20-42, 57-79, 86-108, 112-134, 147-166, 171-190, 224-243, 248-267, 280-302, 312-334, 347-369, 373-395, 404-426 and 431-453 568708005217 1 probable transmembrane helix predicted for STM_MW33461 by TMHMM2.0 at aa 4-26 568708005219 Signal peptide predicted for STM_MW33471 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 27 and 28 568708005220 1 probable transmembrane helix predicted for STM_MW33471 by TMHMM2.0 at aa 7-29 568708005223 Signal peptide predicted for STM_MW33481 by SignalP 2.0 HMM (Signal peptide probability 0.600) with cleavage site probability 0.341 between residues 21 and 22 568708005224 1 probable transmembrane helix predicted for STM_MW33481 by TMHMM2.0 at aa 5-27 568708005228 9 probable transmembrane helices predicted for STM_MW33501 by TMHMM2.0 at aa 13-35, 122-144, 159-178, 180-202, 222-244, 266-288, 308-327, 339-361 and 413-432 568708005234 pfam_scan;Pfam:PF05681; E()=4.0E-78;score=261.8;query 10-281;description=Fumerase 568708005236 11 probable transmembrane helices predicted for STM_MW33541 by TMHMM2.0 at aa 4-20, 25-44, 49-71, 92-121, 136-158, 171-193, 244-266, 279-301, 316-338, 359-378 and 398-420 568708005246 Signal peptide predicted for STM_MW33591 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 22 and 23 568708005248 Signal peptide predicted for STM_MW33601 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.961 between residues 22 and 23 568708005249 1 probable transmembrane helix predicted for STM_MW33601 by TMHMM2.0 at aa 5-24 568708005253 10 probable transmembrane helices predicted for STM_MW33621 by TMHMM2.0 at aa 13-33, 38-60, 67-89, 93-112, 119-136, 151-168, 370-392, 407-426, 433-452 and 481-503 568708005255 1 probable transmembrane helix predicted for STM_MW33631 by TMHMM2.0 at aa 12-31 568708005256 Signal peptide predicted for STM_MW33631 by SignalP 2.0 HMM (Signal peptide probability 0.989) with cleavage site probability 0.885 between residues 30 and 31 568708005257 2 probable transmembrane helices predicted for STM_MW33641 by TMHMM2.0 at aa 7-29 and 44-66 568708005266 5 probable transmembrane helices predicted for STM_MW33701 by TMHMM2.0 at aa 11-28, 32-51, 58-80, 100-122 and 135-152 568708005268 1 probable transmembrane helix predicted for STM_MW33711 by TMHMM2.0 at aa 13-35 568708005269 rod shape-determining protein MreB; Provisional; Region: PRK13927 568708005270 Actin; An ubiquitous protein involved in the formation of filaments that are a major component of the cytoskeleton. Interaction with myosin provides the basis of muscular contraction and many aspects of cell motility. Each actin protomer binds one...; Region: ACTIN; cl11528 568708005271 ATP binding site [chemical binding]; other site 568708005272 profilin binding site; other site 568708005276 2 probable transmembrane helices predicted for STM_MW33731 by TMHMM2.0 at aa 10-32 and 130-152 568708005277 Signal peptide predicted for STM_MW33731 by SignalP 2.0 HMM (Signal peptide probability 0.951) with cleavage site probability 0.693 between residues 33 and 34 568708005281 6 probable transmembrane helices predicted for STM_MW33761 by TMHMM2.0 at aa 13-30, 45-67, 80-102, 117-139, 151-168 and 172-189 568708005288 2 probable transmembrane helices predicted for STM_MW33791 by TMHMM2.0 at aa 13-32 and 42-64 568708005289 13 probable transmembrane helices predicted for STM_MW33801 by TMHMM2.0 at aa 5-24, 37-59, 72-94, 123-145, 160-182, 189-211, 233-255, 268-290, 319-341, 369-386, 391-413, 420-442 and 447-466 568708005293 Helix-turn-helix domains; Region: HTH; cl00088 568708005297 1 probable transmembrane helix predicted for STM_MW33851 by TMHMM2.0 at aa 7-29 568708005298 7 probable transmembrane helices predicted for STM_MW33861 by TMHMM2.0 at aa 10-27, 40-62, 77-99, 112-134, 139-161, 174-193 and 213-235 568708005304 Signal peptide predicted for STM_MW33891 by SignalP 2.0 HMM (Signal peptide probability 0.989) with cleavage site probability 0.671 between residues 22 and 23 568708005306 Signal peptide predicted for STM_MW33901 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.692 between residues 26 and 27 568708005308 12 probable transmembrane helices predicted for STM_MW33901 by TMHMM2.0 at aa 9-31, 337-359, 366-388, 392-414, 438-460, 470-492, 541-563, 872-891, 898-920, 925-947, 974-996 and 1006-1028 568708005309 Signal peptide predicted for STM_MW33911 by SignalP 2.0 HMM (Signal peptide probability 0.904) with cleavage site probability 0.903 between residues 18 and 19 568708005311 1 probable transmembrane helix predicted for STM_MW33911 by TMHMM2.0 at aa 50-72 568708005327 2 probable transmembrane helices predicted for STM_MW34031 by TMHMM2.0 at aa 20-42 and 77-99 568708005341 10 probable transmembrane helices predicted for STM_MW34131 by TMHMM2.0 at aa 22-44, 76-98, 119-138, 153-175, 182-204, 215-237, 274-296, 316-338, 373-392 and 397-414 568708005353 50S ribosomal protein L24; Reviewed; Region: rplX; PRK00004 568708005354 KOW motif; Region: KOW; cl00354 568708005359 30S ribosomal protein S3; Reviewed; Region: rpsC; PRK00310 568708005360 K homology RNA-binding (KH) domain of the prokaryotic 30S small ribosomal subunit protein S3. S3 is part of the head region of the 30S ribosomal subunit and is believed to interact with mRNA as it threads its way from the latch into the channel. The KH...; Region: 30S_S3_KH; cd02412 568708005361 G-X-X-G motif; other site 568708005362 Ribosomal protein S3, C-terminal domain; Region: Ribosomal_S3_C; pfam00189 568708005367 Ribosomal protein S19; Region: Ribosomal_S19; cl00350 568708005371 Ribosomal protein L23; Region: Ribosomal_L23; cl00326 568708005375 Ribosomal protein S10p/S20e; Region: Ribosomal_S10; cl00314 568708005377 4 probable transmembrane helices predicted for STM_MW34341 by TMHMM2.0 at aa 4-21, 55-74, 101-123 and 130-152 568708005396 Signal peptide predicted for STM_MW34451 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.976 between residues 25 and 26 568708005401 10 probable transmembrane helices predicted for STM_MW34491 by TMHMM2.0 at aa 6-25, 32-51, 56-75, 87-109, 113-135, 148-170, 180-202, 223-245, 265-287 and 294-316 568708005403 Signal peptide predicted for STM_MW34491 by SignalP 2.0 HMM (Signal peptide probability 0.876) with cleavage site probability 0.309 between residues 19 and 20 568708005409 Signal peptide predicted for STM_MW34551 by SignalP 2.0 HMM (Signal peptide probability 0.637) with cleavage site probability 0.588 between residues 24 and 25 568708005412 DNA-binding transcriptional dual regulator Crp; Provisional; Region: PRK11753 568708005413 effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038 568708005414 ligand binding site [chemical binding]; other site 568708005415 flexible hinge region; other site 568708005416 helix_turn_helix, cAMP Regulatory protein C-terminus; DNA binding domain of prokaryotic regulatory proteins belonging to the catabolite activator protein family; Region: HTH_CRP; cd00092 568708005417 putative switch regulator; other site 568708005418 non-specific DNA interactions [nucleotide binding]; other site 568708005419 DNA binding site [nucleotide binding] 568708005420 sequence specific DNA binding site [nucleotide binding]; other site 568708005421 putative cAMP binding site [chemical binding]; other site 568708005424 8 probable transmembrane helices predicted for STM_MW34581 by TMHMM2.0 at aa 21-43, 78-100, 107-129, 134-156, 411-433, 437-453, 458-477 and 487-506 568708005430 Signal peptide predicted for STM_MW34631 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.985 between residues 24 and 25 568708005431 Signal peptide predicted for STM_MW34641 by SignalP 2.0 HMM (Signal peptide probability 0.995) with cleavage site probability 0.985 between residues 32 and 33 568708005432 12 probable transmembrane helices predicted for STM_MW34641 by TMHMM2.0 at aa 12-34, 49-66, 78-95, 99-121, 134-156, 161-183, 204-226, 246-268, 273-292, 297-319, 332-354 and 359-381 568708005440 6 probable transmembrane helices predicted for STM_MW34671 by TMHMM2.0 at aa 26-48, 58-80, 101-123, 150-172, 184-206 and 226-248 568708005443 Signal peptide predicted for STM_MW34691 by SignalP 2.0 HMM (Signal peptide probability 0.987) with cleavage site probability 0.960 between residues 27 and 28 568708005449 1 probable transmembrane helix predicted for STM_MW34751 by TMHMM2.0 at aa 93-115 568708005457 Signal peptide predicted for STM_MW34781 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.903 between residues 18 and 19 568708005458 1 probable transmembrane helix predicted for STM_MW34801 by TMHMM2.0 at aa 15-37 568708005460 1 probable transmembrane helix predicted for STM_MW34811 by TMHMM2.0 at aa 21-43 568708005461 Signal peptide predicted for STM_MW34831 by SignalP 2.0 HMM (Signal peptide probability 0.636) with cleavage site probability 0.493 between residues 32 and 33 568708005462 1 probable transmembrane helix predicted for STM_MW34831 by TMHMM2.0 at aa 12-34 568708005467 4 probable transmembrane helices predicted for STM_MW34851 by TMHMM2.0 at aa 157-176, 180-202, 291-313 and 607-629 568708005471 11 probable transmembrane helices predicted for STM_MW34891 by TMHMM2.0 at aa 12-34, 39-61, 66-84, 99-118, 138-160, 183-200, 213-235, 250-268, 281-303, 318-340 and 353-375 568708005474 1 probable transmembrane helix predicted for STM_MW34911 by TMHMM2.0 at aa 121-140 568708005476 osmolarity response regulator; Provisional; Region: ompR; PRK09468 568708005477 Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156 568708005478 active site 568708005479 phosphorylation site [posttranslational modification] 568708005480 intermolecular recognition site; other site 568708005481 dimerization interface [polypeptide binding]; other site 568708005482 Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383 568708005483 DNA binding site [nucleotide binding] 568708005493 10 probable transmembrane helices predicted for STM_MW34961 by TMHMM2.0 at aa 277-299, 309-331, 344-366, 386-408, 429-447, 451-473, 510-532, 663-685, 692-714 and 720-742 568708005502 Signal peptide predicted for STM_MW35021 by SignalP 2.0 HMM (Signal peptide probability 0.918) with cleavage site probability 0.567 between residues 23 and 24 568708005504 10 probable transmembrane helices predicted for STM_MW35021 by TMHMM2.0 at aa 7-27, 37-59, 80-98, 103-125, 159-181, 242-264, 277-296, 333-355, 362-384 and 399-421 568708005506 Signal peptide predicted for STM_MW35031 by SignalP 2.0 HMM (Signal peptide probability 0.964) with cleavage site probability 0.898 between residues 22 and 23 568708005519 6 probable transmembrane helices predicted for STM_MW35131 by TMHMM2.0 at aa 98-120, 140-162, 169-188, 192-214, 223-245 and 250-272 568708005523 5 probable transmembrane helices predicted for STM_MW35171 by TMHMM2.0 at aa 27-58, 73-95, 108-127, 160-182 and 195-217 568708005525 12 probable transmembrane helices predicted for STM_MW35191 by TMHMM2.0 at aa 13-30, 50-72, 85-104, 109-131, 144-166, 176-193, 239-261, 271-293, 305-324, 328-350, 363-385 and 395-417 568708005542 13 probable transmembrane helices predicted for STM_MW35301 by TMHMM2.0 at aa 4-21, 28-47, 57-79, 104-126, 146-168, 175-197, 228-250, 262-284, 299-321, 328-350, 354-373, 386-408 and 423-445 568708005544 Signal peptide predicted for STM_MW35301 by SignalP 2.0 HMM (Signal peptide probability 0.669) with cleavage site probability 0.493 between residues 23 and 24 568708005555 Signal peptide predicted for STM_MW35381 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.734 between residues 27 and 28 568708005556 10 probable transmembrane helices predicted for STM_MW35381 by TMHMM2.0 at aa 7-26, 41-60, 80-97, 107-125, 138-157, 161-183, 196-218, 233-252, 257-276 and 286-308 568708005560 Signal peptide predicted for STM_MW35401 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 24 and 25 568708005561 Signal peptide predicted for STM_MW35411 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.988 between residues 17 and 18 568708005566 7 probable transmembrane helices predicted for STM_MW35441 by TMHMM2.0 at aa 7-29, 82-104, 111-130, 145-167, 188-210, 215-237 and 250-272 568708005568 Signal peptide predicted for STM_MW35441 by SignalP 2.0 HMM (Signal peptide probability 0.642) with cleavage site probability 0.418 between residues 34 and 35 568708005569 6 probable transmembrane helices predicted for STM_MW35451 by TMHMM2.0 at aa 12-34, 71-93, 106-128, 157-179, 206-228 and 266-288 568708005572 1 probable transmembrane helix predicted for STM_MW35461 by TMHMM2.0 at aa 7-29 568708005573 Signal peptide predicted for STM_MW35461 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 23 and 24 568708005578 10 probable transmembrane helices predicted for STM_MW35511 by TMHMM2.0 at aa 4-26, 47-66, 91-108, 120-142, 162-184, 193-210, 261-283, 315-337, 352-374 and 381-400 568708005580 Signal peptide predicted for STM_MW35511 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.989 between residues 20 and 21 568708005581 8 probable transmembrane helices predicted for STM_MW35521 by TMHMM2.0 at aa 15-37, 44-66, 70-92, 105-124, 153-175, 207-229, 244-266 and 282-301 568708005584 Signal peptide predicted for STM_MW35531 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 23 and 24 568708005587 Signal peptide predicted for STM_MW35561 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 21 and 22 568708005590 4 probable transmembrane helices predicted for STM_MW35581 by TMHMM2.0 at aa 71-93, 223-245, 266-288 and 323-342 568708005597 2 probable transmembrane helices predicted for STM_MW35621 by TMHMM2.0 at aa 4-23 and 30-52 568708005599 1 probable transmembrane helix predicted for STM_MW35631 by TMHMM2.0 at aa 5-24 568708005600 Signal peptide predicted for STM_MW35631 by SignalP 2.0 HMM (Signal peptide probability 0.916) with cleavage site probability 0.574 between residues 18 and 19 568708005602 6 probable transmembrane helices predicted for STM_MW35641 by TMHMM2.0 at aa 28-45, 50-72, 77-96, 101-123, 130-152 and 156-178 568708005604 5 probable transmembrane helices predicted for STM_MW35651 by TMHMM2.0 at aa 147-169, 189-211, 350-372, 387-409 and 690-712 568708005607 Signal peptide predicted for STM_MW35661 by SignalP 2.0 HMM (Signal peptide probability 0.963) with cleavage site probability 0.427 between residues 31 and 32 568708005608 2 probable transmembrane helices predicted for STM_MW35661 by TMHMM2.0 at aa 10-32 and 195-217 568708005613 6 probable transmembrane helices predicted for STM_MW35681 by TMHMM2.0 at aa 13-35, 45-64, 71-93, 108-130, 142-164 and 179-201 568708005616 12 probable transmembrane helices predicted for STM_MW35701 by TMHMM2.0 at aa 33-55, 65-87, 99-121, 136-158, 163-185, 189-211, 232-254, 264-283, 290-312, 322-344, 351-373 and 378-400 568708005618 8 probable transmembrane helices predicted for STM_MW35711 by TMHMM2.0 at aa 12-29, 33-55, 62-84, 141-163, 198-220, 224-246, 253-275 and 295-317 568708005623 6 probable transmembrane helices predicted for STM_MW35741 by TMHMM2.0 at aa 25-47, 174-196, 230-252, 256-278, 285-302 and 344-366 568708005625 Signal peptide predicted for STM_MW35741 by SignalP 2.0 HMM (Signal peptide probability 0.882) with cleavage site probability 0.803 between residues 40 and 41 568708005626 5 probable transmembrane helices predicted for STM_MW35751 by TMHMM2.0 at aa 702-724, 752-774, 779-801, 808-830 and 869-891 568708005630 1 probable transmembrane helix predicted for STM_MW35761 by TMHMM2.0 at aa 7-26 568708005631 Signal peptide predicted for STM_MW35761 by SignalP 2.0 HMM (Signal peptide probability 0.921) with cleavage site probability 0.747 between residues 23 and 24 568708005633 Signal peptide predicted for STM_MW35771 by SignalP 2.0 HMM (Signal peptide probability 0.991) with cleavage site probability 0.912 between residues 22 and 23 568708005634 Signal peptide predicted for STM_MW35781 by SignalP 2.0 HMM (Signal peptide probability 0.699) with cleavage site probability 0.429 between residues 32 and 33 568708005636 8 probable transmembrane helices predicted for STM_MW35781 by TMHMM2.0 at aa 13-35, 53-75, 82-104, 114-136, 166-183, 193-215, 339-361 and 431-453 568708005638 2 probable transmembrane helices predicted for STM_MW35791 by TMHMM2.0 at aa 5-24 and 90-109 568708005640 14 probable transmembrane helices predicted for STM_MW35811 by TMHMM2.0 at aa 20-42, 52-74, 83-102, 107-124, 145-167, 171-193, 214-233, 237-255, 268-290, 314-336, 349-371, 386-408, 415-437 and 457-479 568708005650 1 probable transmembrane helix predicted for STM_MW35871 by TMHMM2.0 at aa 7-29 568708005651 Signal peptide predicted for STM_MW35871 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.988 between residues 20 and 21 568708005652 11 probable transmembrane helices predicted for STM_MW35881 by TMHMM2.0 at aa 20-42, 52-74, 87-109, 163-185, 227-249, 264-281, 294-316, 331-350, 357-374, 379-398 and 419-438 568708005659 1 probable transmembrane helix predicted for STM_MW35931 by TMHMM2.0 at aa 337-359 568708005664 6 probable transmembrane helices predicted for STM_MW35971 by TMHMM2.0 at aa 80-102, 135-157, 191-213, 233-255, 267-289 and 304-326 568708005666 11 probable transmembrane helices predicted for STM_MW35981 by TMHMM2.0 at aa 32-54, 69-88, 109-131, 166-188, 195-217, 247-269, 290-312, 322-341, 348-370, 380-402 and 409-431 568708005669 1 probable transmembrane helix predicted for STM_MW35991 by TMHMM2.0 at aa 7-29 568708005674 Signal peptide predicted for STM_MW36021 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.997 between residues 24 and 25 568708005676 9 probable transmembrane helices predicted for STM_MW36031 by TMHMM2.0 at aa 5-27, 47-64, 77-99, 141-163, 184-206, 216-238, 289-311, 326-348 and 353-375 568708005679 1 probable transmembrane helix predicted for STM_MW36041 by TMHMM2.0 at aa 127-149 568708005681 Signal peptide predicted for STM_MW36051 by SignalP 2.0 HMM (Signal peptide probability 0.990) with cleavage site probability 0.523 between residues 46 and 47 568708005683 1 probable transmembrane helix predicted for STM_MW36061 by TMHMM2.0 at aa 7-29 568708005684 Signal peptide predicted for STM_MW36061 by SignalP 2.0 HMM (Signal peptide probability 0.991) with cleavage site probability 0.850 between residues 22 and 23 568708005686 1 probable transmembrane helix predicted for STM_MW36071 by TMHMM2.0 at aa 603-625 568708005687 10 probable transmembrane helices predicted for STM_MW36081 by TMHMM2.0 at aa 28-50, 150-169, 173-190, 197-216, 229-251, 522-541, 545-567, 588-610, 633-655 and 668-690 568708005694 1 probable transmembrane helix predicted for STM_MW36121 by TMHMM2.0 at aa 7-29 568708005695 pfam_scan;Pfam:PF11658; E()=2.2E-226;score=751.8;query 24-553;description=DUF3260 568708005697 pfam_scan;Pfam:PF01053; E()=6.9E-19;score=67.3;query7- 77;description=Cys_Met_Meta_PP 568708005699 11 probable transmembrane helices predicted for STM_MW36161 by TMHMM2.0 at aa 29-51, 56-73, 105-127, 147-169, 176-194, 214-236, 256-278, 303-325, 351-373, 377-399 and 412-431 568708005705 5 probable transmembrane helices predicted for STM_MW36191 by TMHMM2.0 at aa 31-53, 103-125, 140-162, 210-232 and 265-287 568708005707 6 probable transmembrane helices predicted for STM_MW36201 by TMHMM2.0 at aa 9-31, 99-121, 134-156, 202-221, 258-280 and 309-331 568708005710 13 probable transmembrane helices predicted for STM_MW36221 by TMHMM2.0 at aa 20-42, 47-69, 76-98, 103-125, 132-154, 169-191, 196-218, 233-255, 287-309, 319-341, 348-370, 380-402 and 409-431 568708005714 1 probable transmembrane helix predicted for STM_MW36241 by TMHMM2.0 at aa 67-89 568708005718 5 probable transmembrane helices predicted for STM_MW36251 by TMHMM2.0 at aa 12-31, 46-68, 81-103, 118-140 and 161-178 568708005719 Signal peptide predicted for STM_MW36251 by SignalP 2.0 HMM (Signal peptide probability 0.813) with cleavage site probability 0.796 between residues 37 and 38 568708005721 Signal peptide predicted for STM_MW36261 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 20 and 21 568708005722 Signal peptide; signalp; query 1-25;cleavage_site_probability=0.992; 1.000 568708005724 Signal peptide predicted for STM_MW36281 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 32 and 33 568708005727 1 probable transmembrane helix predicted for STM_MW36291 by TMHMM2.0 at aa 7-29 568708005728 Signal peptide predicted for STM_MW36291 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 23 and 24 568708005730 Signal peptide predicted for STM_MW36301 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 24 and 25 568708005732 1 probable transmembrane helix predicted for STM_MW36311 by TMHMM2.0 at aa 12-31 568708005733 Signal peptide predicted for STM_MW36311 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.667 between residues 30 and 31 568708005738 2 probable transmembrane helices predicted for STM_MW36351 by TMHMM2.0 at aa 25-44 and 51-73 568708005743 1 probable transmembrane helix predicted for STM_MW36371 by TMHMM2.0 at aa 10-27 568708005751 Signal peptide predicted for STM_MW36461 by SignalP 2.0 HMM (Signal peptide probability 0.990) with cleavage site probability 0.657 between residues 27 and 28 568708005753 10 probable transmembrane helices predicted for STM_MW36471 by TMHMM2.0 at aa 13-30, 45-67, 79-101, 114-136, 143-160, 175-194, 201-223, 233-255, 268-288 and 303-321 568708005759 Signal peptide predicted for STM_MW36511 by SignalP 2.0 HMM (Signal peptide probability 0.995) with cleavage site probability 0.961 between residues 27 and 28 568708005760 Signal peptide predicted for STM_MW36521 by SignalP 2.0 HMM (Signal peptide probability 0.987) with cleavage site probability 0.643 between residues 17 and 18 568708005768 4 probable transmembrane helices predicted for STM_MW36591 by TMHMM2.0 at aa 7-29, 44-66, 79-98 and 113-135 568708005770 Signal peptide predicted for STM_MW36601 by SignalP 2.0 HMM (Signal peptide probability 0.748) with cleavage site probability 0.369 between residues 33 and 34 568708005771 11 probable transmembrane helices predicted for STM_MW36601 by TMHMM2.0 at aa 4-26, 47-69, 93-124, 137-159, 169-191, 212-230, 234-256, 277-299, 314-347, 354-376 and 396-418 568708005773 Signal peptide predicted for STM_MW36611 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.986 between residues 24 and 25 568708005793 8 probable transmembrane helices predicted for STM_MW36731 by TMHMM2.0 at aa 20-42, 52-74, 87-109, 129-151, 212-234, 244-263, 270-292 and 312-334 568708005800 Signal peptide predicted for STM_MW36781 by SignalP 2.0 HMM (Signal peptide probability 0.821) with cleavage site probability 0.749 between residues 21 and 22 568708005802 Signal peptide predicted for STM_MW36791 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.470 between residues 50 and 51 568708005806 12 probable transmembrane helices predicted for STM_MW36801 by TMHMM2.0 at aa 10-32, 39-58, 68-90, 119-141, 156-178, 199-218, 244-266, 299-321, 368-387, 407-424, 434-456 and 528-550 568708005816 Signal peptide predicted for STM_MW36861 by SignalP 2.0 HMM (Signal peptide probability 0.800) with cleavage site probability 0.782 between residues 27 and 28 568708005817 12 probable transmembrane helices predicted for STM_MW36861 by TMHMM2.0 at aa 13-35, 50-72, 79-101, 105-127, 140-162, 172-189, 240-262, 277-299, 311-333, 338-360, 372-394 and 404-426 568708005822 Signal peptide predicted for STM_MW36881 by SignalP 2.0 HMM (Signal peptide probability 0.796) with cleavage site probability 0.748 between residues 21 and 22 568708005826 1 probable transmembrane helix predicted for STM_MW36911 by TMHMM2.0 at aa 7-29 568708005829 Signal peptide predicted for STM_MW36931 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 42 and 43 568708005831 Signal peptide predicted for STM_MW36941 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 23 and 24 568708005832 1 probable transmembrane helix predicted for STM_MW36941 by TMHMM2.0 at aa 7-29 568708005842 10 probable transmembrane helices predicted for STM_MW37021 by TMHMM2.0 at aa 21-53, 68-85, 126-145, 160-182, 189-206, 210-225, 230-247, 325-347, 360-379 and 383-401 568708005845 Signal peptide predicted for STM_MW37031 by SignalP 2.0 HMM (Signal peptide probability 0.986) with cleavage site probability 0.880 between residues 22 and 23 568708005875 Signal peptide predicted for STM_MW37261 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 21 and 22 568708005878 7 probable transmembrane helices predicted for STM_MW37271 by TMHMM2.0 at aa 5-22, 29-51, 64-81, 88-109, 114-136, 148-167 and 172-189 568708005881 Signal peptide predicted for STM_MW37281 by SignalP 2.0 HMM (Signal peptide probability 0.761) with cleavage site probability 0.676 between residues 30 and 31 568708005893 9 probable transmembrane helices predicted for STM_MW37351 by TMHMM2.0 at aa 70-87, 94-116, 157-179, 213-235, 245-267, 274-292, 302-324, 336-358 and 368-390 568708005895 11 probable transmembrane helices predicted for STM_MW37361 by TMHMM2.0 at aa 43-65, 90-112, 127-149, 156-178, 193-212, 219-241, 261-283, 346-368, 378-400, 407-429 and 439-458 568708005896 Signal peptide predicted for STM_MW37371 by SignalP 2.0 HMM (Signal peptide probability 0.708) with cleavage site probability 0.479 between residues 31 and 32 568708005898 1 probable transmembrane helix predicted for STM_MW37371 by TMHMM2.0 at aa 7-26 568708005900 11 probable transmembrane helices predicted for STM_MW37391 by TMHMM2.0 at aa 32-54, 81-100, 115-137, 150-170, 180-202, 232-254, 264-286, 293-315, 319-341, 362-384 and 399-421 568708005903 Signal peptide predicted for STM_MW37461 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.997 between residues 27 and 28 568708005904 1 probable transmembrane helix predicted for STM_MW37461 by TMHMM2.0 at aa 7-29 568708005908 1 probable transmembrane helix predicted for STM_MW37481 by TMHMM2.0 at aa 170-192 568708005910 2 probable transmembrane helices predicted for STM_MW37511 by TMHMM2.0 at aa 7-26 and 135-157 568708005911 Signal peptide predicted for STM_MW37511 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.977 between residues 26 and 27 568708005912 8 probable transmembrane helices predicted for STM_MW37521 by TMHMM2.0 at aa 87-105, 115-134, 293-315, 325-347, 719-741, 779-801, 844-866 and 876-893 568708005918 4 probable transmembrane helices predicted for STM_MW37531 by TMHMM2.0 at aa 5-27, 34-56, 66-83 and 90-112 568708005919 Signal peptide predicted for STM_MW37541 by SignalP 2.0 HMM (Signal peptide probability 0.968) with cleavage site probability 0.960 between residues 25 and 26 568708005920 10 probable transmembrane helices predicted for STM_MW37541 by TMHMM2.0 at aa 7-29, 39-59, 72-94, 98-120, 127-144, 154-176, 183-205, 215-237, 250-272 and 276-293 568708005924 pfam_scan;Pfam:PF03841; E()=1.3E-20;score=73.1;query14-280;description=SelA 568708005926 5 probable transmembrane helices predicted for STM_MW37581 by TMHMM2.0 at aa 129-148, 152-174, 198-217, 237-259 and 266-285 568708005929 5 probable transmembrane helices predicted for STM_MW37591 by TMHMM2.0 at aa 21-43, 93-110, 141-163, 178-200 and 207-239 568708005934 Signal peptide predicted for STM_MW37631 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 21 and 22 568708005936 12 probable transmembrane helices predicted for STM_MW37651 by TMHMM2.0 at aa 20-42, 57-79, 86-105, 110-132, 145-167, 177-196, 217-239, 254-276, 283-302, 307-329, 341-363 and 367-389 568708005944 11 probable transmembrane helices predicted for STM_MW37711 by TMHMM2.0 at aa 13-35, 42-64, 98-120, 141-163, 178-200, 225-247, 251-270, 305-327, 337-356, 363-385 and 421-443 568708005947 Signal peptide predicted for STM_MW37721 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.954 between residues 20 and 21 568708005952 1 probable transmembrane helix predicted for STM_MW37751 by TMHMM2.0 at aa 4-21 568708005953 12 probable transmembrane helices predicted for STM_MW37761 by TMHMM2.0 at aa 28-45, 67-89, 96-118, 123-145, 158-180, 190-212, 254-276, 296-318, 325-347, 357-379, 392-411 and 426-445 568708005955 12 probable transmembrane helices predicted for STM_MW37771 by TMHMM2.0 at aa 26-45, 67-89, 96-118, 122-144, 156-178, 183-205, 245-267, 287-309, 322-344, 348-370, 377-399 and 409-431 568708005958 7 probable transmembrane helices predicted for STM_MW37781 by TMHMM2.0 at aa 7-29, 78-100, 112-130, 140-162, 186-205, 220-242 and 255-274 568708005961 Signal peptide predicted for STM_MW37781 by SignalP 2.0 HMM (Signal peptide probability 0.855) with cleavage site probability 0.579 between residues 32 and 33 568708005964 12 probable transmembrane helices predicted for STM_MW37811 by TMHMM2.0 at aa 20-42, 57-79, 86-105, 109-128, 149-171, 205-227, 256-275, 290-312, 319-336, 340-362, 375-397 and 401-423 568708005974 Signal peptide predicted for STM_MW37852 by SignalP 2.0 HMM (Signal peptide probability 0.836) with cleavage site probability 0.795 between residues 18 and 19 568708005975 1 probable transmembrane helix predicted for STM_MW37871 by TMHMM2.0 at aa 6-28 568708005976 Signal peptide predicted for STM_MW37881 by SignalP 2.0 HMM (Signal peptide probability 0.998) with cleavage site probability 0.987 between residues 26 and 27 568708005977 10 probable transmembrane helices predicted for STM_MW37881 by TMHMM2.0 at aa 10-32, 39-61, 66-85, 98-117, 121-143, 150-167, 177-199, 216-235, 239-261 and 266-285 568708005980 11 probable transmembrane helices predicted for STM_MW37891 by TMHMM2.0 at aa 15-34, 41-60, 65-87, 100-122, 132-149, 170-192, 207-229, 242-264, 268-290, 297-319 and 329-351 568708005984 12 probable transmembrane helices predicted for STM_MW37921 by TMHMM2.0 at aa 4-23, 30-49, 54-76, 104-126, 146-168, 175-197, 226-248, 261-283, 303-322, 343-365, 385-407 and 420-442 568708005987 3 probable transmembrane helices predicted for STM_MW37951 by TMHMM2.0 at aa 21-43, 48-70 and 91-113 568708005988 3 probable transmembrane helices predicted for STM_MW37961 by TMHMM2.0 at aa 21-40, 50-72 and 92-114 568708005990 11 probable transmembrane helices predicted for STM_MW37971 by TMHMM2.0 at aa 4-21, 28-46, 61-83, 95-117, 160-182, 374-396, 400-419, 431-448, 463-485, 492-514 and 529-551 568708005995 Signal peptide predicted for STM_MW38001 by SignalP 2.0 HMM (Signal peptide probability 0.993) with cleavage site probability 0.839 between residues 27 and 28 568708005998 3 probable transmembrane helices predicted for STM_MW38021 by TMHMM2.0 at aa 2-24, 103-125 and 150-172 568708005999 Signal peptide predicted for STM_MW38021 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.985 between residues 22 and 23 568708006002 1 probable transmembrane helix predicted for STM_MW38041 by TMHMM2.0 at aa 7-29 568708006006 Signal peptide predicted for STM_MW38061 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 39 and 40 568708006008 1 probable transmembrane helix predicted for STM_MW38071 by TMHMM2.0 at aa 12-34 568708006012 Signal peptide predicted for STM_MW38091 by SignalP 2.0 HMM (Signal peptide probability 0.850) with cleavage site probability 0.727 between residues 22 and 23 568708006013 Signal peptide predicted for STM_MW38101 by SignalP 2.0 HMM (Signal peptide probability 0.996) with cleavage site probability 0.595 between residues 36 and 37 568708006014 2 probable transmembrane helices predicted for STM_MW38101 by TMHMM2.0 at aa 10-32 and 332-354 568708006019 12 probable transmembrane helices predicted for STM_MW38111 by TMHMM2.0 at aa 31-53, 68-90, 97-117, 122-144, 156-178, 182-203, 257-278, 293-315, 322-344, 354-376, 389-411 and 416-438 568708006028 12 probable transmembrane helices predicted for STM_MW38171 by TMHMM2.0 at aa 13-35, 55-77, 89-111, 115-132, 145-167, 172-194, 239-261, 276-298, 305-324, 334-353, 366-388 and 393-415 568708006047 Signal peptide predicted for STM_MW38271 by SignalP 2.0 HMM (Signal peptide probability 0.983) with cleavage site probability 0.707 between residues 24 and 25 568708006048 4 probable transmembrane helices predicted for STM_MW38271 by TMHMM2.0 at aa 7-24, 346-368, 419-441 and 497-519 568708006053 pfam_scan;Pfam:PF00589; E()=1.0E-19;score=70.7;query219- 368;description=Phage_integrase 568708006056 Signal peptide predicted for STM_MW38321 by SignalP 2.0 HMM (Signal peptide probability 0.661) with cleavage site probability 0.498 between residues 30 and 31 568708006057 12 probable transmembrane helices predicted for STM_MW38321 by TMHMM2.0 at aa 5-24, 39-58, 70-89, 99-116, 129-151, 156-178, 210-232, 242-264, 271-290, 294-316, 328-350 and 355-377 568708006062 13 probable transmembrane helices predicted for STM_MW38361 by TMHMM2.0 at aa 72-94, 104-126, 128-150, 155-177, 184-203, 218-240, 247-264, 295-317, 337-359, 369-391, 398-416, 431-453 and 466-484 568708006067 6 probable transmembrane helices predicted for STM_MW38401 by TMHMM2.0 at aa 29-51, 88-110, 123-145, 150-169, 201-223 and 268-290 568708006069 6 probable transmembrane helices predicted for STM_MW38411 by TMHMM2.0 at aa 21-43, 78-100, 112-134, 166-188, 227-249 and 282-304 568708006071 1 probable transmembrane helix predicted for STM_MW38421 by TMHMM2.0 at aa 7-29 568708006072 Signal peptide predicted for STM_MW38421 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.935 between residues 25 and 26 568708006074 9 probable transmembrane helices predicted for STM_MW38431 by TMHMM2.0 at aa 134-156, 166-188, 201-223, 245-267, 279-301, 324-346, 359-381, 396-418 and 430-448 568708006076 Signal peptide predicted for STM_MW38431 by SignalP 2.0 HMM (Signal peptide probability 0.947) with cleavage site probability 0.486 between residues 24 and 25 568708006083 6 probable transmembrane helices predicted for STM_MW38481 by TMHMM2.0 at aa 25-47, 62-81, 94-116, 120-142, 158-192 and 207-229 568708006096 1 probable transmembrane helix predicted for STM_MW38541 by TMHMM2.0 at aa 5-27 568708006097 5 probable transmembrane helices predicted for STM_MW38551 by TMHMM2.0 at aa 36-58, 100-122, 142-164, 211-233 and 243-265 568708006099 4 probable transmembrane helices predicted for STM_MW38561 by TMHMM2.0 at aa 15-31, 36-58, 73-95 and 100-122 568708006109 Signal peptide predicted for STM_MW38641 by SignalP 2.0 HMM (Signal peptide probability 0.744) with cleavage site probability 0.744 between residues 22 and 23 568708006110 12 probable transmembrane helices predicted for STM_MW38641 by TMHMM2.0 at aa 7-29, 49-71, 102-124, 134-156, 168-190, 210-232, 245-267, 287-309, 335-357, 363-385, 392-414 and 419-441 568708006114 8 probable transmembrane helices predicted for STM_MW38671 by TMHMM2.0 at aa 21-43, 53-72, 74-93, 97-119, 126-145, 165-187, 221-243 and 275-297 568708006116 Signal peptide predicted for STM_MW38681 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.949 between residues 25 and 26 568708006122 14 probable transmembrane helices predicted for STM_MW38711 by TMHMM2.0 at aa 11-33, 48-70, 77-99, 103-125, 137-159, 164-181, 201-218, 222-244, 264-286, 291-313, 325-347, 351-373, 394-416 and 431-450 568708006123 Signal peptide predicted for STM_MW38711 by SignalP 2.0 HMM (Signal peptide probability 0.992) with cleavage site probability 0.952 between residues 27 and 28 568708006153 11 probable transmembrane helices predicted for STM_MW38931 by TMHMM2.0 at aa 5-24, 45-65, 69-88, 105-127, 131-153, 160-179, 184-206, 213-232, 242-261, 294-311 and 321-338 568708006156 2 probable transmembrane helices predicted for STM_MW38941 by TMHMM2.0 at aa 29-51 and 323-342 568708006158 Signal peptide predicted for STM_MW38961 by SignalP 2.0 HMM (Signal peptide probability 0.938) with cleavage site probability 0.852 between residues 23 and 24 568708006167 12 probable transmembrane helices predicted for STM_MW39011 by TMHMM2.0 at aa 13-35, 45-67, 80-102, 117-139, 146-165, 175-195, 216-238, 253-275, 296-318, 333-355, 362-384 and 390-412 568708006170 11 probable transmembrane helices predicted for STM_MW39031 by TMHMM2.0 at aa 4-26, 33-55, 70-89, 116-138, 153-175, 182-201, 205-224, 226-245, 338-360, 381-398 and 408-430 568708006173 12 probable transmembrane helices predicted for STM_MW39051 by TMHMM2.0 at aa 19-36, 40-59, 93-115, 125-147, 154-176, 191-213, 240-262, 277-299, 331-353, 358-380, 401-423 and 428-450 568708006176 1 probable transmembrane helix predicted for STM_MW39061 by TMHMM2.0 at aa 21-43 568708006178 1 probable transmembrane helix predicted for STM_MW39071 by TMHMM2.0 at aa 35-57 568708006183 3 probable transmembrane helices predicted for STM_MW39111 by TMHMM2.0 at aa 4-23, 25-47 and 81-103 568708006184 2 probable transmembrane helices predicted for STM_MW39121 by TMHMM2.0 at aa 28-45 and 49-71 568708006186 4 probable transmembrane helices predicted for STM_MW39151 by TMHMM2.0 at aa 20-42, 47-64, 71-93 and 103-125 568708006188 Signal peptide; signalp; query 1-22;cleavage_site_probability=0.937; 0.973 568708006189 Signal peptide predicted for STM_MW39171 by SignalP 2.0 HMM (Signal peptide probability 0.906) with cleavage site probability 0.578 between residues 23 and 24 568708006190 1 probable transmembrane helix predicted for STM_MW39171 by TMHMM2.0 at aa 7-29 568708006198 2 probable transmembrane helices predicted for STM_MW39231 by TMHMM2.0 at aa 255-273 and 288-310 568708006200 2 probable transmembrane helices predicted for STM_MW39241 by TMHMM2.0 at aa 50-72 and 76-107 568708006201 4 probable transmembrane helices predicted for STM_MW39251 by TMHMM2.0 at aa 42-59, 63-85, 98-120 and 124-143 568708006202 10 probable transmembrane helices predicted for STM_MW39261 by TMHMM2.0 at aa 12-34, 38-60, 73-95, 100-122, 129-146, 150-167, 180-197, 212-234, 239-261 and 271-290 568708006210 6 probable transmembrane helices predicted for STM_MW39301 by TMHMM2.0 at aa 4-26, 42-64, 68-87, 119-141, 151-173 and 186-205 568708006212 6 probable transmembrane helices predicted for STM_MW39311 by TMHMM2.0 at aa 5-27, 39-61, 71-88, 115-137, 147-169 and 188-205 568708006214 Signal peptide predicted for STM_MW39311 by SignalP 2.0 HMM (Signal peptide probability 0.874) with cleavage site probability 0.541 between residues 24 and 25 568708006217 Signal peptide predicted for STM_MW39341 by SignalP 2.0 HMM (Signal peptide probability 0.655) with cleavage site probability 0.614 between residues 19 and 20 568708006218 10 probable transmembrane helices predicted for STM_MW39341 by TMHMM2.0 at aa 2-24, 28-47, 54-76, 80-102, 109-128, 138-157, 170-192, 202-224, 231-253 and 258-275 568708006222 Signal peptide predicted for STM_MW39351 by SignalP 2.0 HMM (Signal peptide probability 0.934) with cleavage site probability 0.662 between residues 34 and 35 568708006229 Signal peptide predicted for STM_MW39401 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.973 between residues 28 and 29 568708006230 1 probable transmembrane helix predicted for STM_MW39401 by TMHMM2.0 at aa 5-24 568708006235 1 probable transmembrane helix predicted for STM_MW39431 by TMHMM2.0 at aa 523-542 568708006236 1 probable transmembrane helix predicted for STM_MW39441 by TMHMM2.0 at aa 4-21 568708006238 1 probable transmembrane helix predicted for STM_MW39451 by TMHMM2.0 at aa 4-21 568708006240 6 probable transmembrane helices predicted for STM_MW39461 by TMHMM2.0 at aa 20-42, 74-96, 116-138, 158-180, 193-210 and 215-237 568708006246 Signal peptide predicted for STM_MW39511 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.644 between residues 26 and 27 568708006256 Signal peptide predicted for STM_MW39561 by SignalP 2.0 HMM (Signal peptide probability 0.648) with cleavage site probability 0.408 between residues 27 and 28 568708006257 10 probable transmembrane helices predicted for STM_MW39561 by TMHMM2.0 at aa 9-31, 35-57, 69-91, 133-155, 185-207, 238-260, 273-295, 332-354, 396-418 and 456-478 568708006263 Signal peptide predicted for STM_MW39621 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.894 between residues 19 and 20 568708006266 3 probable transmembrane helices predicted for STM_MW39631 by TMHMM2.0 at aa 12-34, 49-66 and 122-140 568708006267 Signal peptide predicted for STM_MW39631 by SignalP 2.0 HMM (Signal peptide probability 0.652) with cleavage site probability 0.424 between residues 25 and 26 568708006293 Signal peptide predicted for STM_MW39801 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.908 between residues 20 and 21 568708006294 12 probable transmembrane helices predicted for STM_MW39811 by TMHMM2.0 at aa 20-42, 52-74, 86-108, 119-141, 154-176, 186-208, 237-259, 274-296, 303-325, 329-351, 380-402 and 415-437 568708006295 11 probable transmembrane helices predicted for STM_MW39821 by TMHMM2.0 at aa 46-68, 89-111, 121-143, 156-178, 188-210, 244-266, 276-295, 308-328, 333-355, 387-409 and 419-441 568708006306 6 probable transmembrane helices predicted for STM_MW39911 by TMHMM2.0 at aa 39-61, 101-120, 140-162, 177-199, 212-234 and 244-266 568708006316 4 probable transmembrane helices predicted for STM_MW39991 by TMHMM2.0 at aa 21-40, 55-77, 114-136 and 151-173 568708006322 Signal peptide predicted for STM_MW40011 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.993 between residues 33 and 34 568708006323 1 probable transmembrane helix predicted for STM_MW40011 by TMHMM2.0 at aa 11-33 568708006325 Signal peptide predicted for STM_MW40031 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.997 between residues 21 and 22 568708006326 4 probable transmembrane helices predicted for STM_MW40051 by TMHMM2.0 at aa 4-26, 38-60, 65-82 and 87-106 568708006328 5 probable transmembrane helices predicted for STM_MW40061 by TMHMM2.0 at aa 21-43, 58-80, 127-149, 159-178 and 191-213 568708006330 Signal peptide predicted for STM_MW40061 by SignalP 2.0 HMM (Signal peptide probability 0.996) with cleavage site probability 0.979 between residues 36 and 37 568708006344 10 probable transmembrane helices predicted for STM_MW40151 by TMHMM2.0 at aa 4-26, 38-55, 70-92, 99-121, 136-155, 175-192, 212-234, 254-276, 291-309 and 321-343 568708006345 Signal peptide predicted for STM_MW40161 by SignalP 2.0 HMM (Signal peptide probability 0.993) with cleavage site probability 0.975 between residues 22 and 23 568708006347 12 probable transmembrane helices predicted for STM_MW40171 by TMHMM2.0 at aa 10-41, 61-83, 103-125, 146-168, 178-200, 221-243, 248-267, 280-302, 312-334, 341-360, 370-392 and 404-426 568708006349 Signal peptide predicted for STM_MW40171 by SignalP 2.0 HMM (Signal peptide probability 0.981) with cleavage site probability 0.885 between residues 22 and 23 568708006350 4 probable transmembrane helices predicted for STM_MW40181 by TMHMM2.0 at aa 10-32, 48-66, 86-108 and 129-151 568708006352 Signal peptide predicted for STM_MW40181 by SignalP 2.0 HMM (Signal peptide probability 0.976) with cleavage site probability 0.932 between residues 27 and 28 568708006354 Signal peptide predicted for STM_MW40191 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.995 between residues 24 and 25 568708006361 2 probable transmembrane helices predicted for STM_MW40231 by TMHMM2.0 at aa 5-27 and 165-187 568708006365 Signal peptide predicted for STM_MW40251 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 21 and 22 568708006366 Signal peptide predicted for STM_MW40261 by SignalP 2.0 HMM (Signal peptide probability 0.913) with cleavage site probability 0.343 between residues 30 and 31 568708006367 6 probable transmembrane helices predicted for STM_MW40261 by TMHMM2.0 at aa 12-34, 38-60, 80-102, 117-139, 158-175 and 180-199 568708006370 Signal peptide predicted for STM_MW40281 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 19 and 20 568708006372 Signal peptide predicted for STM_MW40291 by SignalP 2.0 HMM (Signal peptide probability 0.923) with cleavage site probability 0.355 between residues 18 and 19 568708006374 1 probable transmembrane helix predicted for STM_MW40291 by TMHMM2.0 at aa 5-23 568708006375 12 probable transmembrane helices predicted for STM_MW40301 by TMHMM2.0 at aa 12-34, 44-66, 79-96, 106-128, 149-171, 176-198, 228-247, 262-284, 291-310, 320-342, 362-384 and 399-421 568708006378 Signal peptide predicted for STM_MW40321 by SignalP 2.0 HMM (Signal peptide probability 0.959) with cleavage site probability 0.788 between residues 22 and 23 568708006389 Signal peptide predicted for STM_MW40401 by SignalP 2.0 HMM (Signal peptide probability 0.959) with cleavage site probability 0.607 between residues 29 and 30 568708006390 9 probable transmembrane helices predicted for STM_MW40401 by TMHMM2.0 at aa 13-32, 36-58, 65-87, 91-113, 118-135, 155-177, 210-232, 250-272 and 279-301 568708006392 9 probable transmembrane helices predicted for STM_MW40411 by TMHMM2.0 at aa 7-29, 39-61, 66-88, 92-114, 119-141, 161-183, 214-236, 251-282 and 295-314 568708006394 Signal peptide predicted for STM_MW40421 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.994 between residues 26 and 27 568708006397 1 probable transmembrane helix predicted for STM_MW40451 by TMHMM2.0 at aa 12-34 568708006401 Signal peptide predicted for STM_MW40471 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.989 between residues 23 and 24 568708006403 4 probable transmembrane helices predicted for STM_MW40481 by TMHMM2.0 at aa 20-37, 41-63, 75-97 and 101-123 568708006410 6 probable transmembrane helices predicted for STM_MW40521 by TMHMM2.0 at aa 12-34, 44-66, 86-108, 145-167, 180-202 and 232-251 568708006413 9 probable transmembrane helices predicted for STM_MW40551 by TMHMM2.0 at aa 21-40, 45-64, 99-121, 125-144, 151-173, 178-200, 230-249, 253-270 and 291-308 568708006415 Signal peptide predicted for STM_MW40551 by SignalP 2.0 HMM (Signal peptide probability 0.900) with cleavage site probability 0.900 between residues 36 and 37 568708006420 1 probable transmembrane helix predicted for STM_MW40581 by TMHMM2.0 at aa 35-57 568708006421 Signal peptide predicted for STM_MW40581 by SignalP 2.0 HMM (Signal peptide probability 0.697) with cleavage site probability 0.325 between residues 45 and 46 568708006429 1 probable transmembrane helix predicted for STM_MW40631 by TMHMM2.0 at aa 7-26 568708006430 Signal peptide predicted for STM_MW40631 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.991 between residues 22 and 23 568708006438 3 probable transmembrane helices predicted for STM_MW40671 by TMHMM2.0 at aa 25-44, 64-86 and 96-118 568708006439 9 probable transmembrane helices predicted for STM_MW40681 by TMHMM2.0 at aa 21-40, 60-82, 89-111, 121-143, 148-170, 175-194, 215-237, 252-274 and 295-314 568708006452 8 probable transmembrane helices predicted for STM_MW40771 by TMHMM2.0 at aa 21-40, 60-82, 95-117, 132-154, 175-194, 214-236, 283-305 and 315-334 568708006453 Signal peptide predicted for STM_MW40781 by SignalP 2.0 HMM (Signal peptide probability 0.962) with cleavage site probability 0.795 between residues 20 and 21 568708006458 Signal peptide predicted for STM_MW40811 by SignalP 2.0 HMM (Signal peptide probability 0.801) with cleavage site probability 0.752 between residues 24 and 25 568708006462 5 probable transmembrane helices predicted for STM_MW40831 by TMHMM2.0 at aa 13-35, 50-67, 69-91, 118-140 and 153-170 568708006463 Signal peptide predicted for STM_MW40831 by SignalP 2.0 HMM (Signal peptide probability 0.695) with cleavage site probability 0.641 between residues 33 and 34 568708006477 Signal peptide predicted for STM_MW40921 by SignalP 2.0 HMM (Signal peptide probability 0.988) with cleavage site probability 0.938 between residues 26 and 27 568708006479 3 probable transmembrane helices predicted for STM_MW40921 by TMHMM2.0 at aa 25-47, 60-82 and 86-108 568708006481 Signal peptide predicted for STM_MW40941 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 20 and 21 568708006494 3 probable transmembrane helices predicted for STM_MW41001 by TMHMM2.0 at aa 34-51, 55-77 and 109-131 568708006514 3 probable transmembrane helices predicted for STM_MW41081 by TMHMM2.0 at aa 20-42, 52-74 and 86-105 568708006520 1 probable transmembrane helix predicted for STM_MW41151 by TMHMM2.0 at aa 26-48 568708006532 1 probable transmembrane helix predicted for STM_MW41251 by TMHMM2.0 at aa 7-29 568708006533 Signal peptide predicted for STM_MW41251 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.971 between residues 26 and 27 568708006534 2 probable transmembrane helices predicted for STM_MW41261 by TMHMM2.0 at aa 13-35 and 204-223 568708006558 Signal peptide predicted for STM_MW41381 by SignalP 2.0 HMM (Signal peptide probability 0.977) with cleavage site probability 0.919 between residues 38 and 39 568708006560 7 probable transmembrane helices predicted for STM_MW41381 by TMHMM2.0 at aa 42-64, 74-96, 108-130, 150-172, 177-199, 214-236 and 249-271 568708006566 9 probable transmembrane helices predicted for STM_MW41441 by TMHMM2.0 at aa 7-24, 29-51, 64-86, 92-114, 119-141, 156-178, 191-213, 217-239 and 260-282 568708006568 ATPase domain 568708006569 1 probable transmembrane helix predicted for STM_MW41461 by TMHMM2.0 at aa 15-37 568708006570 BTP6 568708006575 9 probable transmembrane helices predicted for STM_MW41531 by TMHMM2.0 at aa 7-29, 73-92, 99-118, 128-150, 206-228, 256-275, 288-310, 315-334 and 341-363 568708006577 2 probable transmembrane helices predicted for STM_MW41541 by TMHMM2.0 at aa 227-249 and 264-286 568708006578 4 probable transmembrane helices predicted for STM_MW41551 by TMHMM2.0 at aa 9-31, 35-54, 67-84 and 94-116 568708006580 Signal peptide predicted for STM_MW41551 by SignalP 2.0 HMM (Signal peptide probability 0.762) with cleavage site probability 0.712 between residues 37 and 38 568708006588 Signal peptide predicted for STM_MW41651 by SignalP 2.0 HMM (Signal peptide probability 0.655) with cleavage site probability 0.343 between residues 30 and 31 568708006589 1 probable transmembrane helix predicted for STM_MW41651 by TMHMM2.0 at aa 10-29 568708006591 Signal peptide predicted for STM_MW41661 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.993 between residues 19 and 20 568708006592 3 probable transmembrane helices predicted for STM_MW41671 by TMHMM2.0 at aa 5-24, 29-51 and 71-93 568708006593 Signal peptide predicted for STM_MW41671 by SignalP 2.0 HMM (Signal peptide probability 0.992) with cleavage site probability 0.941 between residues 29 and 30 568708006598 Signal peptide predicted for STM_MW41711 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.986 between residues 22 and 23 568708006600 1 probable transmembrane helix predicted for STM_MW41711 by TMHMM2.0 at aa 5-27 568708006601 Signal peptide predicted for STM_MW41721 by SignalP 2.0 HMM (Signal peptide probability 0.990) with cleavage site probability 0.351 between residues 30 and 31 568708006603 Signal peptide predicted for STM_MW41731 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.977 between residues 20 and 21 568708006604 1 probable transmembrane helix predicted for STM_MW41731 by TMHMM2.0 at aa 5-27 568708006606 Signal peptide predicted for STM_MW41741 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 20 and 21 568708006608 4 probable transmembrane helices predicted for STM_MW41751 by TMHMM2.0 at aa 13-35, 55-77, 84-103 and 113-130 568708006610 6 probable transmembrane helices predicted for STM_MW41761 by TMHMM2.0 at aa 13-35, 89-111, 124-143, 153-175, 205-227 and 258-280 568708006612 8 probable transmembrane helices predicted for STM_MW41771 by TMHMM2.0 at aa 17-36, 40-57, 70-92, 284-306, 319-341, 370-392, 413-435 and 484-506 568708006615 Signal peptide predicted for STM_MW41781 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 29 and 30 568708006616 1 probable transmembrane helix predicted for STM_MW41781 by TMHMM2.0 at aa 7-29 568708006619 Signal peptide predicted for STM_MW41811 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.972 between residues 25 and 26 568708006621 Signal peptide predicted for STM_MW41821 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.994 between residues 26 and 27 568708006622 1 probable transmembrane helix predicted for STM_MW41821 by TMHMM2.0 at aa 7-26 568708006625 7 probable transmembrane helices predicted for STM_MW41841 by TMHMM2.0 at aa 23-40, 45-67, 99-132, 160-182, 203-225, 229-251 and 272-289 568708006629 2 probable transmembrane helices predicted for STM_MW41861 by TMHMM2.0 at aa 57-79 and 99-121 568708006632 12 probable transmembrane helices predicted for STM_MW41881 by TMHMM2.0 at aa 11-33, 43-65, 89-111, 131-153, 160-182, 187-209, 241-263, 267-289, 321-343, 353-375, 388-405 and 409-428 568708006636 Signal peptide predicted for STM_MW41921 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.991 between residues 24 and 25 568708006638 Signal peptide predicted for STM_MW41941 by SignalP 2.0 HMM (Signal peptide probability 0.967) with cleavage site probability 0.416 between residues 31 and 32 568708006640 2 probable transmembrane helices predicted for STM_MW41941 by TMHMM2.0 at aa 7-29 and 39-61 568708006648 Signal peptide predicted for STM_MW41991 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.961 between residues 23 and 24 568708006652 1 probable transmembrane helix predicted for STM_MW42031 by TMHMM2.0 at aa 7-29 568708006653 Signal peptide predicted for STM_MW42031 by SignalP 2.0 HMM (Signal peptide probability 0.969) with cleavage site probability 0.519 between residues 21 and 22 568708006656 1 probable transmembrane helix predicted for STM_MW42081 by TMHMM2.0 at aa 15-37 568708006657 Signal peptide predicted for STM_MW42091 by SignalP 2.0 HMM (Signal peptide probability 0.992) with cleavage site probability 0.992 between residues 25 and 26 568708006658 4 probable transmembrane helices predicted for STM_MW42091 by TMHMM2.0 at aa 7-26, 41-63, 131-153 and 186-208 568708006659 Signal peptide predicted for STM_MW42101 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 19 and 20 568708006661 1 probable transmembrane helix predicted for STM_MW42111 by TMHMM2.0 at aa 12-34 568708006662 5 probable transmembrane helices predicted for STM_MW42131 by TMHMM2.0 at aa 157-179, 189-208, 262-284, 288-310 and 376-398 568708006664 2 probable transmembrane helices predicted for STM_MW42141 by TMHMM2.0 at aa 10-29 and 36-58 568708006665 Signal peptide predicted for STM_MW42151 by SignalP 2.0 HMM (Signal peptide probability 0.874) with cleavage site probability 0.414 between residues 34 and 35 568708006666 2 probable transmembrane helices predicted for STM_MW42151 by TMHMM2.0 at aa 10-32 and 239-261 568708006674 12 probable transmembrane helices predicted for STM_MW42191 by TMHMM2.0 at aa 29-51, 56-78, 85-107, 112-134, 146-165, 175-197, 202-224, 244-266, 329-351, 356-378, 391-413 and 428-447 568708006675 9 probable transmembrane helices predicted for STM_MW42201 by TMHMM2.0 at aa 4-26, 86-108, 113-135, 181-203, 233-255, 276-298, 313-335, 361-383 and 398-420 568708006679 4 probable transmembrane helices predicted for STM_MW42221 by TMHMM2.0 at aa 20-42, 47-66, 73-95 and 100-122 568708006681 6 probable transmembrane helices predicted for STM_MW42231 by TMHMM2.0 at aa 4-21, 33-54, 64-86, 93-115, 149-171 and 203-225 568708006683 13 probable transmembrane helices predicted for STM_MW42241 by TMHMM2.0 at aa 33-55, 76-98, 103-125, 146-168, 183-205, 212-234, 261-283, 303-325, 362-384, 404-423, 428-450, 462-484 and 494-516 568708006685 Signal peptide predicted for STM_MW42241 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 18 and 19 568708006687 2 probable transmembrane helices predicted for STM_MW42251 by TMHMM2.0 at aa 25-47 and 62-84 568708006689 Signal peptide predicted for STM_MW42281 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 26 and 27 568708006692 Signal peptide predicted for STM_MW42301 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.998 between residues 27 and 28 568708006695 8 probable transmembrane helices predicted for STM_MW42311 by TMHMM2.0 at aa 15-37, 57-76, 91-113, 144-166, 181-203, 224-241, 256-278 and 290-312 568708006696 15 probable transmembrane helices predicted for STM_MW42321 by TMHMM2.0 at aa 13-35, 56-78, 93-115, 127-149, 183-205, 212-234, 254-271, 283-305, 315-337, 357-379, 394-416, 429-448, 552-571, 608-627 and 708-727 568708006699 1 probable transmembrane helix predicted for STM_MW42331 by TMHMM2.0 at aa 20-37 568708006700 8 probable transmembrane helices predicted for STM_MW42341 by TMHMM2.0 at aa 7-29, 49-71, 84-106, 163-185, 206-228, 233-255, 354-376 and 391-409 568708006706 pfam_scan;Pfam:PF05118; E()=1.6E-62;score=209.3;query 68-222;description=Asp_Arg_Hydrox; tmhmm; query 1-302 568708006713 12 probable transmembrane helices predicted for STM_MW42411 by TMHMM2.0 at aa 30-52, 67-89, 98-120, 124-146, 167-189, 199-221, 260-282, 297-319, 326-346, 351-373, 386-408 and 418-437 568708006717 2 probable transmembrane helices predicted for STM_MW42421 by TMHMM2.0 at aa 13-35 and 66-88 568708006722 5 probable transmembrane helices predicted for STM_MW42441 by TMHMM2.0 at aa 11-33, 48-70, 77-99, 119-141 and 154-176 568708006724 11 probable transmembrane helices predicted for STM_MW42451 by TMHMM2.0 at aa 10-32, 39-61, 94-116, 123-142, 152-173, 228-250, 274-296, 324-341, 356-378, 385-407 and 411-428 568708006731 12 probable transmembrane helices predicted for STM_MW42501 by TMHMM2.0 at aa 9-31, 36-58, 78-100, 110-132, 145-167, 177-199, 236-258, 268-290, 297-319, 324-346, 378-400 and 410-432 568708006734 11 probable transmembrane helices predicted for STM_MW42521 by TMHMM2.0 at aa 21-43, 53-75, 88-110, 142-164, 171-193, 236-253, 266-288, 303-325, 346-368, 378-400 and 421-443 568708006738 2 probable transmembrane helices predicted for STM_MW42551 by TMHMM2.0 at aa 20-42 and 183-202 568708006740 Signal peptide predicted for STM_MW42551 by SignalP 2.0 HMM (Signal peptide probability 0.942) with cleavage site probability 0.539 between residues 36 and 37 568708006741 Signal peptide predicted for STM_MW42561 by SignalP 2.0 HMM (Signal peptide probability 0.995) with cleavage site probability 0.988 between residues 43 and 44 568708006747 8 probable transmembrane helices predicted for STM_MW42581 by TMHMM2.0 at aa 10-32, 39-61, 81-100, 107-129, 139-161, 166-188, 203-221 and 228-250 568708006750 Signal peptide predicted for STM_MW42601 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 23 and 24 568708006751 1 probable transmembrane helix predicted for STM_MW42611 by TMHMM2.0 at aa 13-35 568708006758 Signal peptide predicted for STM_MW42691 by SignalP 2.0 HMM (Signal peptide probability 0.856) with cleavage site probability 0.814 between residues 20 and 21 568708006763 8 probable transmembrane helices predicted for STM_MW42721 by TMHMM2.0 at aa 5-22, 170-192, 212-234, 246-268, 297-319, 326-348, 358-380 and 387-409 568708006766 Signal peptide predicted for STM_MW42721 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 19 and 20 568708006769 10 probable transmembrane helices predicted for STM_MW42741 by TMHMM2.0 at aa 7-29, 49-71, 91-113, 123-145, 187-204, 219-238, 245-267, 287-306, 319-341 and 371-393 568708006770 Signal peptide predicted for STM_MW42741 by SignalP 2.0 HMM (Signal peptide probability 0.795) with cleavage site probability 0.617 between residues 27 and 28 568708006773 3 probable transmembrane helices predicted for STM_MW42761 by TMHMM2.0 at aa 15-34, 39-61 and 92-114 568708006775 10 probable transmembrane helices predicted for STM_MW42771 by TMHMM2.0 at aa 7-29, 44-66, 87-109, 146-168, 181-203, 223-245, 258-280, 314-336, 343-362 and 372-406 568708006777 Signal peptide predicted for STM_MW42771 by SignalP 2.0 HMM (Signal peptide probability 0.710) with cleavage site probability 0.417 between residues 33 and 34 568708006780 Signal peptide predicted for STM_MW42801 by SignalP 2.0 HMM (Signal peptide probability 0.996) with cleavage site probability 0.593 between residues 28 and 29 568708006785 Signal peptide predicted for STM_MW42841 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.992 between residues 21 and 22 568708006787 1 probable transmembrane helix predicted for STM_MW42841 by TMHMM2.0 at aa 7-29 568708006790 4 probable transmembrane helices predicted for STM_MW42861 by TMHMM2.0 at aa 2-19, 29-48, 55-77 and 87-104 568708006792 Signal peptide predicted for STM_MW42871 by SignalP 2.0 HMM (Signal peptide probability 0.989) with cleavage site probability 0.691 between residues 18 and 19 568708006793 3 probable transmembrane helices predicted for STM_MW42881 by TMHMM2.0 at aa 13-42, 57-79 and 99-118 568708006796 3 probable transmembrane helices predicted for STM_MW42891 by TMHMM2.0 at aa 28-50, 60-82 and 108-130 568708006799 Signal peptide predicted for STM_MW42911 by SignalP 2.0 HMM (Signal peptide probability 0.907) with cleavage site probability 0.351 between residues 27 and 28 568708006801 Signal peptide predicted for STM_MW42931 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.891 between residues 25 and 26 568708006802 12 probable transmembrane helices predicted for STM_MW42931 by TMHMM2.0 at aa 12-34, 38-57, 95-117, 132-154, 161-183, 208-230, 243-265, 310-332, 364-383, 393-415, 435-457 and 467-484 568708006804 Signal peptide predicted for STM_MW42941 by SignalP 2.0 HMM (Signal peptide probability 0.911) with cleavage site probability 0.512 between residues 21 and 22 568708006806 3 probable transmembrane helices predicted for STM_MW42941 by TMHMM2.0 at aa 7-26, 55-72 and 79-98 568708006807 11 probable transmembrane helices predicted for STM_MW42951 by TMHMM2.0 at aa 475-492, 521-543, 553-575, 596-617, 627-648, 669-691, 696-718, 784-806, 826-848, 879-898 and 908-930 568708006809 Signal peptide predicted for STM_MW42951 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 19 and 20 568708006813 note framshift follwoign codon 1 within a 8xpoly T tract; pfam_scan;Pfam:PF00497; E()=5.6E-72;score=242.1;query 24-244;description=SBP_bac_3 568708006819 Signal peptide predicted for STM_MW43031 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.949 between residues 22 and 23 568708006828 1 probable transmembrane helix predicted for STM_MW43081 by TMHMM2.0 at aa 78-100 568708006830 Signal peptide predicted for STM_MW43091 by SignalP 2.0 HMM (Signal peptide probability 0.723) with cleavage site probability 0.456 between residues 24 and 25 568708006831 1 probable transmembrane helix predicted for STM_MW43091 by TMHMM2.0 at aa 5-23 568708006843 3 probable transmembrane helices predicted for STM_MW43161 by TMHMM2.0 at aa 15-37, 44-66 and 81-100 568708006846 4 probable transmembrane helices predicted for STM_MW43181 by TMHMM2.0 at aa 6-28, 48-70, 75-97 and 109-131 568708006854 1 probable transmembrane helix predicted for STM_MW43231 by TMHMM2.0 at aa 13-32 568708006855 Signal peptide predicted for STM_MW43231 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.602 between residues 30 and 31 568708006859 10 probable transmembrane helices predicted for STM_MW43271 by TMHMM2.0 at aa 22-44, 51-73, 111-133, 154-183, 244-263, 275-297, 317-339, 351-373, 388-410 and 435-457 568708006867 Signal peptide predicted for STM_MW43331 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.720 between residues 20 and 21 568708006870 Ribosomal protein S18; Region: Ribosomal_S18; cl00373 568708006874 10 probable transmembrane helices predicted for STM_MW43391 by TMHMM2.0 at aa 13-34, 54-72, 85-107, 117-134, 141-163, 173-192, 204-226, 231-253, 258-280 and 284-303 568708006880 12 probable transmembrane helices predicted for STM_MW43421 by TMHMM2.0 at aa 27-44, 49-71, 104-126, 136-158, 165-187, 210-232, 252-274, 289-311, 347-369, 374-396, 417-435 and 439-461 568708006885 10 probable transmembrane helices predicted for STM_MW43441 by TMHMM2.0 at aa 5-25, 35-52, 64-86, 91-113, 120-142, 152-174, 195-217, 232-254, 259-281 and 286-308 568708006890 Signal peptide predicted for STM_MW43471 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.996 between residues 19 and 20 568708006893 Signal peptide predicted for STM_MW43491 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.887 between residues 20 and 21 568708006897 4 probable transmembrane helices predicted for STM_MW43511 by TMHMM2.0 at aa 5-27, 58-80, 100-117 and 144-162 568708006899 Signal peptide predicted for STM_MW43511 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.988 between residues 26 and 27 568708006901 Signal peptide predicted for STM_MW43531 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.967 between residues 21 and 22 568708006904 Signal peptide predicted for STM_MW43541 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.711 between residues 25 and 26 568708006905 1 probable transmembrane helix predicted for STM_MW43541 by TMHMM2.0 at aa 7-29 568708006908 12 probable transmembrane helices predicted for STM_MW43561 by TMHMM2.0 at aa 7-26, 41-63, 76-93, 97-116, 137-154, 164-186, 215-237, 252-273, 280-302, 307-329, 342-364 and 374-393 568708006913 Signal peptide predicted for STM_MW43601 by SignalP 2.0 HMM (Signal peptide probability 0.966) with cleavage site probability 0.924 between residues 24 and 25 568708006920 12 probable transmembrane helices predicted for STM_MW43621 by TMHMM2.0 at aa 12-34, 54-73, 85-107, 111-133, 146-165, 175-197, 257-279, 294-316, 323-345, 355-377, 389-408 and 423-445 568708006921 Signal peptide predicted for STM_MW43631 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.955 between residues 31 and 32 568708006922 12 probable transmembrane helices predicted for STM_MW43631 by TMHMM2.0 at aa 12-34, 49-68, 81-100, 105-127, 140-162, 177-196, 260-282, 297-319, 326-345, 355-377, 390-412 and 422-444 568708006933 12 probable transmembrane helices predicted for STM_MW43721 by TMHMM2.0 at aa 12-34, 49-68, 89-111, 116-138, 145-167, 177-199, 212-234, 249-266, 273-295, 299-321, 334-356 and 366-385 568708006942 12 probable transmembrane helices predicted for STM_MW43761 by TMHMM2.0 at aa 20-42, 57-79, 86-105, 110-132, 145-167, 177-196, 231-253, 263-282, 295-317, 322-344, 357-379 and 383-402 568708006948 Signal peptide predicted for STM_MW43811 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 22 and 23 568708006949 1 probable transmembrane helix predicted for STM_MW43811 by TMHMM2.0 at aa 5-23 568708006951 match to SC4294 1..39 blast score 73.2 percent identity 82 SC4294 hypothetical protein 4598157:4598312 forward MW:5627; match to SC4294 38..51 blast score 31.2 percent identity 100 SC4294 hypothetical protein 4598157:4598312 forward MW:5627; tmhmm; query 1-47 568708006953 Signal peptide predicted for STM_MW43861 by SignalP 2.0 HMM (Signal peptide probability 0.850) with cleavage site probability 0.565 between residues 24 and 25 568708006954 6 probable transmembrane helices predicted for STM_MW43861 by TMHMM2.0 at aa 2-24, 55-77, 111-133, 143-165, 177-199 and 214-232 568708006955 6 probable transmembrane helices predicted for STM_MW43871 by TMHMM2.0 at aa 15-37, 57-74, 84-106, 111-133, 165-187 and 194-213 568708006968 pfam_scan;Pfam:PF00367; E()=5.9E-11;score=41.1;query11-41;description=PTS_EIIB; pfam_scan;Pfam:PF02378; E()=2.4E-34;score=118.5;query 112-404;description=PTS_EIIC; tmhmm; query 1-473 568708006974 8 probable transmembrane helices predicted for STM_MW44011 by TMHMM2.0 at aa 122-141, 295-314, 324-346, 714-736, 773-795, 808-827, 842-864 and 869-891 568708006979 2 probable transmembrane helices predicted for STM_MW44021 by TMHMM2.0 at aa 59-78 and 82-101 568708006988 11 probable transmembrane helices predicted for STM_MW44091 by TMHMM2.0 at aa 7-29, 76-98, 121-140, 162-184, 205-222, 263-285, 290-307, 322-339, 371-393, 413-435 and 442-464 568708006990 Signal peptide predicted for STM_MW44091 by SignalP 2.0 HMM (Signal peptide probability 0.708) with cleavage site probability 0.265 between residues 24 and 25 568708007000 Signal peptide predicted for STM_MW44181 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.993 between residues 22 and 23 568708007003 8 probable transmembrane helices predicted for STM_MW44201 by TMHMM2.0 at aa 24-46, 67-89, 99-121, 142-164, 169-191, 229-251, 281-303 and 324-346 568708007011 6 probable transmembrane helices predicted for STM_MW44251 by TMHMM2.0 at aa 17-39, 54-76, 97-119, 267-289, 296-313 and 328-348 568708007013 6 probable transmembrane helices predicted for STM_MW44261 by TMHMM2.0 at aa 10-32, 64-83, 103-125, 279-301, 305-322 and 329-351 568708007017 11 probable transmembrane helices predicted for STM_MW44281 by TMHMM2.0 at aa 20-42, 66-88, 92-114, 138-160, 186-208, 221-243, 258-279, 291-313, 317-339, 346-368 and 383-405 568708007038 Signal peptide predicted for STM_MW44511 by SignalP 2.0 HMM (Signal peptide probability 0.999) with cleavage site probability 0.978 between residues 24 and 25 568708007045 Signal peptide predicted for STM_MW44561 by SignalP 2.0 HMM (Signal peptide probability 0.753) with cleavage site probability 0.564 between residues 17 and 18 568708007050 3 probable transmembrane helices predicted for STM_MW44591 by TMHMM2.0 at aa 20-42, 68-90 and 130-152 568708007052 5 probable transmembrane helices predicted for STM_MW44601 by TMHMM2.0 at aa 37-59, 92-114, 146-165, 180-202 and 246-268 568708007054 tmhmm; query 1-125 568708007055 12 probable transmembrane helices predicted for STM_MW44621 by TMHMM2.0 at aa 13-35, 55-77, 84-103, 108-130, 137-159, 169-191, 212-234, 244-266, 271-293, 298-320, 333-355 and 360-382 568708007057 3 probable transmembrane helices predicted for STM_MW44631 by TMHMM2.0 at aa 13-32, 42-62 and 398-420 568708007059 Signal peptide predicted for STM_MW44631 by SignalP 2.0 HMM (Signal peptide probability 0.997) with cleavage site probability 0.294 between residues 42 and 43 568708007060 12 probable transmembrane helices predicted for STM_MW44641 by TMHMM2.0 at aa 13-35, 50-72, 84-103, 107-129, 141-163, 167-189, 219-241, 256-278, 290-312, 316-338, 350-372 and 376-398 568708007064 5 probable transmembrane helices predicted for STM_MW44681 by TMHMM2.0 at aa 17-39, 54-76, 103-125, 140-162 and 169-191 568708007076 16 probable transmembrane helices predicted for STM_MW44781 by TMHMM2.0 at aa 12-29, 34-56, 89-111, 121-140, 161-183, 193-215, 220-242, 257-279, 286-305, 325-347, 364-386, 486-505, 532-551, 566-588, 595-617 and 662-684 568708007078 Signal peptide predicted for STM_MW44781 by SignalP 2.0 HMM (Signal peptide probability 0.638) with cleavage site probability 0.612 between residues 27 and 28 568708007079 Signal peptide predicted for STM_MW44791 by SignalP 2.0 HMM (Signal peptide probability 0.995) with cleavage site probability 0.327 between residues 25 and 26 568708007080 2 probable transmembrane helices predicted for STM_MW44791 by TMHMM2.0 at aa 7-29 and 192-214 568708007089 Signal peptide predicted for STM_MW44831 by SignalP 2.0 HMM (Signal peptide probability 0.641) with cleavage site probability 0.472 between residues 19 and 20 568708007091 7 probable transmembrane helices predicted for STM_MW44831 by TMHMM2.0 at aa 7-29, 44-63, 70-92, 96-118, 138-160, 180-199 and 206-235 568708007093 6 probable transmembrane helices predicted for STM_MW44841 by TMHMM2.0 at aa 69-91, 111-133, 146-168, 197-219, 231-253 and 258-277 568708007097 2 probable transmembrane helices predicted for STM_MW44871 by TMHMM2.0 at aa 43-65 and 77-99 568708007099 1 probable transmembrane helix predicted for STM_MW44881 by TMHMM2.0 at aa 7-29 568708007100 Signal peptide predicted for STM_MW44881 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.427 between residues 24 and 25 568708007102 4 probable transmembrane helices predicted for STM_MW44911 by TMHMM2.0 at aa 7-29, 53-75, 87-109 and 129-151 568708007104 4 probable transmembrane helices predicted for STM_MW44921 by TMHMM2.0 at aa 184-201, 214-236, 241-263 and 276-298 568708007112 5 probable transmembrane helices predicted for STM_MW44971 by TMHMM2.0 at aa 21-40, 45-62, 69-86, 101-123 and 144-163 568708007113 Signal peptide predicted for STM_MW44971 by SignalP 2.0 HMM (Signal peptide probability 0.713) with cleavage site probability 0.283 between residues 34 and 35 568708007115 3 probable transmembrane helices predicted for STM_MW44981 by TMHMM2.0 at aa 5-27, 31-48 and 55-72 568708007123 Signal peptide predicted for STM_MW45041 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 28 and 29 568708007126 pfam_scan;Pfam:PF01026; E()=4.9E-75;score=251.6;query 6-255;description=TatD_DNase 568708007138 Signal peptide predicted for STM_MW45131 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 26 and 27 568708007140 Signal peptide predicted for STM_MW45141 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 27 and 28 568708007143 Signal peptide predicted for STM_MW45161 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.820 between residues 27 and 28 568708007145 Signal peptide predicted for STM_MW45171 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.969 between residues 21 and 22 568708007147 Signal peptide predicted for STM_MW45181 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 20 and 21 568708007151 2 probable transmembrane helices predicted for STM_MW45201 by TMHMM2.0 at aa 13-32 and 162-184 568708007152 Signal peptide predicted for STM_MW45201 by SignalP 2.0 HMM (Signal peptide probability 0.996) with cleavage site probability 0.852 between residues 30 and 31 568708007158 Signal peptide predicted for STM_MW45251 by SignalP 2.0 HMM (Signal peptide probability 0.726) with cleavage site probability 0.725 between residues 39 and 40 568708007163 1 probable transmembrane helix predicted for STM_MW45281 by TMHMM2.0 at aa 146-168 568708007166 Signal peptide predicted for STM_MW45301 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.999 between residues 21 and 22 568708007170 Signal peptide predicted for STM_MW45321 by SignalP 2.0 HMM (Signal peptide probability 0.859) with cleavage site probability 0.597 between residues 27 and 28 568708007171 2 probable transmembrane helices predicted for STM_MW45321 by TMHMM2.0 at aa 5-27 and 184-206 568708007175 6 probable transmembrane helices predicted for STM_MW45331 by TMHMM2.0 at aa 10-32, 298-317, 321-343, 350-372, 377-396 and 403-420 568708007177 Signal peptide predicted for STM_MW45341 by SignalP 2.0 HMM (Signal peptide probability 0.952) with cleavage site probability 0.902 between residues 20 and 21 568708007179 1 probable transmembrane helix predicted for STM_MW45351 by TMHMM2.0 at aa 7-29 568708007180 Signal peptide predicted for STM_MW45351 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.614 between residues 27 and 28 568708007182 Signal peptide predicted for STM_MW45361 by SignalP 2.0 HMM (Signal peptide probability 0.848) with cleavage site probability 0.847 between residues 28 and 29 568708007185 Signal peptide predicted for STM_MW45371 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 0.998 between residues 20 and 21 568708007187 Signal peptide predicted for STM_MW45381 by SignalP 2.0 HMM (Signal peptide probability 1.000) with cleavage site probability 1.000 between residues 22 and 23 568708007188 tmhmm; query 1-166