-- dump date 20110803_090722 -- class Genbank::CDS -- table cds -- table main -- field 1 id -- field 2 GI -- field 3 GeneID -- field 4 chrom_position -- field 5 chromosome -- field 6 codon_start -- field 7 contig -- field 8 description -- field 9 end_pos -- field 10 gene -- field 11 gene_id -- field 12 name -- field 13 organism -- field 14 product -- field 15 protein_id -- field 16 start_pos -- field 17 strand -- field 18 taxid -- field 19 type -- header -- id GI GeneID chrom_position chromosome codon_start contig description end_pos gene gene_id name organism product protein_id start_pos strand taxid type ScpofMp01 11466038 1669524 join(4886..5289,6500..6844,7926..8790) 1 NC_001326.1 cytochrome c oxidase 1 8790 cox1 1669524 cox1 Schizosaccharomyces pombe cytochrome c oxidase 1 NP_039499.1 4886 D 4896 CDS ScpofMp02 13591825 1669527 5291..6445 1 NC_001326.1 intronic ORF; hypothetical protein 6445 1669527 ScpofMp02 Schizosaccharomyces pombe hypothetical protein NP_112417.1 5291 D 4896 CDS ScpofMp03 11466040 1669528 <6845..7817 2 NC_001326.1 intronic ORF; hypothetical protein 7817 1669528 ScpofMp03 Schizosaccharomyces pombe hypothetical protein NP_039501.1 <6845 D 4896 CDS ScpofMp04 11466041 1669523 join(10173..10856,13383..13862) 1 NC_001326.1 cytochrome b 13862 cob 1669523 cob Schizosaccharomyces pombe cytochrome b NP_039502.1 10173 D 4896 CDS ScpofMp05 11466042 1669529 10857..13280 1 NC_001326.1 intronic ORF; hypothetical protein 13280 1669529 ScpofMp05 Schizosaccharomyces pombe hypothetical protein NP_039503.1 10857 D 4896 CDS ScpofMp06 11466043 1669530 14756..15529 1 NC_001326.1 ATPase6 15529 1669530 ScpofMp06 Schizosaccharomyces pombe ATPase6 NP_039504.1 14756 D 4896 CDS ScpofMp07 11466044 1669526 15954..16637 1 NC_001326.1 urf a; unassigned reading frame a; hypothetical protein 16637 1669526 ScpofMp07 Schizosaccharomyces pombe hypothetical protein NP_039505.1 15954 D 4896 CDS ScpofMp08 11466045 1669531 16914..17060 1 NC_001326.1 ATPase 8 17060 1669531 ScpofMp08 Schizosaccharomyces pombe ATPase 8 NP_039506.1 16914 D 4896 CDS ScpofMp09 11466046 1669532 17806..18030 1 NC_001326.1 ATPase 9 18030 1669532 ScpofMp09 Schizosaccharomyces pombe ATPase 9 NP_039507.1 17806 D 4896 CDS ScpofMp10 11466047 1669525 18561..19307 1 NC_001326.1 cytochrome c oxidase 2 19307 cox2 1669525 cox2 Schizosaccharomyces pombe cytochrome c oxidase 2 NP_039508.1 18561 D 4896 CDS SPCP20C8.01c 19075173 2539593 complement(28680..29423) 1 NC_003421.2 cell surface glycoprotein (predicted), DUF2429 family 29423 2539593 SPCP20C8.01c Schizosaccharomyces pombe 972h- cell surface glycoprotein (predicted), DUF2429 family NP_587673.1 28680 R 284812 CDS SPCP20C8.02c 19075174 2539575 complement(31185..31520) 1 NC_003421.2 possibly not coding, may be a spurious ORF; S. pombe specific UPF0321 family protein 1 31520 2539575 SPCP20C8.02c Schizosaccharomyces pombe 972h- S. pombe specific UPF0321 family protein 1 NP_587674.1 31185 R 284812 CDS SPCC1884.02 63054407 2539250 43854..45071 1 NC_003421.2 NiCoT heavy metal ion transporter Nic1 45071 nic1 2539250 nic1 Schizosaccharomyces pombe 972h- NiCoT heavy metal ion transporter Nic1 NP_587676.2 43854 D 284812 CDS SPCC757.02c 19075177 2539110 complement(45695..46912) 1 NC_003421.2 epimarase (predicted) 46912 2539110 SPCC757.02c Schizosaccharomyces pombe 972h- epimarase (predicted) NP_587677.1 45695 R 284812 CDS SPCC757.03c 19075178 2539466 complement(47741..48475) 1 NC_003421.2 ThiJ domain protein 48475 2539466 SPCC757.03c Schizosaccharomyces pombe 972h- ThiJ domain protein NP_587678.1 47741 R 284812 CDS SPCC757.04 19075179 2539097 join(50358..50552,50678..52537) 1 NC_003421.2 transcription factor (predicted) 52537 2539097 SPCC757.04 Schizosaccharomyces pombe 972h- transcription factor (predicted) NP_587679.1 50358 D 284812 CDS SPCC757.05c 19075180 2539223 complement(52910..54112) 1 NC_003421.2 peptidase family M20 protein 54112 2539223 SPCC757.05c Schizosaccharomyces pombe 972h- peptidase family M20 protein NP_587680.1 52910 R 284812 CDS SPCC757.06 19075181 2538727 join(55579..55608,55666..55779,55823..56029) 1 NC_003421.2 this is unlikely to be protein coding as neither intron is supported by transcriptome data; dubious 56029 2538727 SPCC757.06 Schizosaccharomyces pombe 972h- dubious NP_587681.1 55579 D 284812 CDS SPCC757.07c 19075182 2539418 complement(56927..58465) 1 NC_003421.2 catalase 58465 ctt1 2539418 ctt1 Schizosaccharomyces pombe 972h- catalase NP_587682.1 56927 R 284812 CDS SPCC757.15 295442744 9407154 complement(join(60428..60490,60548..60694)) 1 NC_003421.2 sequence orphan 60694 9407154 SPCC757.15 Schizosaccharomyces pombe 972h- sequence orphan XP_002788946.1 60428 R 284812 CDS SPCC757.08 19075183 2539106 join(62999..63162,63217..63336,63436..64027) 1 NC_003421.2 exosome subunit Rrp45 (predicted) 64027 2539106 SPCC757.08 Schizosaccharomyces pombe 972h- exosome subunit Rrp45 (predicted) NP_587683.1 62999 D 284812 CDS SPCC757.09c 19075184 2539434 complement(65489..66685) 1 NC_003421.2 RNA-binding protein that suppresses calcineurin deletion Rnc1 66685 rnc1 2539434 rnc1 Schizosaccharomyces pombe 972h- RNA-binding protein that suppresses calcineurin deletion Rnc1 NP_587684.1 65489 R 284812 CDS SPCC757.10 19075185 2539291 join(68612..68953,69017..69235) 1 NC_003421.2 endoplasmic reticulum membrane protein involved in assembly of the V-ATPase (predicted) 69235 vph2 2539291 vph2 Schizosaccharomyces pombe 972h- endoplasmic reticulum membrane protein involved in assembly of the V-ATPase (predicted) NP_587685.1 68612 D 284812 CDS SPCC757.11c 19075186 2538803 complement(69641..71056) 1 NC_003421.2 membrane transporter 71056 2538803 SPCC757.11c Schizosaccharomyces pombe 972h- membrane transporter NP_587686.1 69641 R 284812 CDS SPCC757.12 19075187 2538825 73483..75360 1 NC_003421.2 alpha-amylase homolog (predicted) 75360 2538825 SPCC757.12 Schizosaccharomyces pombe 972h- alpha-amylase homolog (predicted) NP_587687.1 73483 D 284812 CDS SPCC757.13 19075188 2539039 78044..79612 1 NC_003421.2 membrane transporter (predicted) 79612 2539039 SPCC757.13 Schizosaccharomyces pombe 972h- membrane transporter (predicted) NP_587688.1 78044 D 284812 CDS SPCC613.01 63054408 2539525 80547..82040 1 NC_003421.2 membrane transporter 82040 2539525 SPCC613.01 Schizosaccharomyces pombe 972h- membrane transporter NP_587689.2 80547 D 284812 CDS SPCC613.02 19075190 2539363 82860..84353 1 NC_003421.2 membrane transporter 84353 2539363 SPCC613.02 Schizosaccharomyces pombe 972h- membrane transporter NP_587690.1 82860 D 284812 CDS SPCC613.03 19075191 2539402 85363..85932 1 NC_003421.2 conserved fungal protein 85932 2539402 SPCC613.03 Schizosaccharomyces pombe 972h- conserved fungal protein NP_587691.1 85363 D 284812 CDS SPCC613.04c 19075192 2539360 complement(86370..88610) 1 NC_003421.2 UCS-domain protein Rng3 88610 rng3 2539360 rng3 Schizosaccharomyces pombe 972h- UCS-domain protein Rng3 NP_587692.1 86370 R 284812 CDS SPCC613.05c 19075193 2539308 complement(join(88905..89136,89421..89557)) 1 NC_003421.2 60S ribosomal protein L35 89557 rpl35 2539308 rpl35 Schizosaccharomyces pombe 972h- 60S ribosomal protein L35 NP_587693.1 88905 R 284812 CDS SPCC613.06 19075194 2539464 89780..90349 1 NC_003421.2 60S ribosomal protein L9 90349 rpl902 2539464 rpl902 Schizosaccharomyces pombe 972h- 60S ribosomal protein L9 NP_587694.1 89780 D 284812 CDS SPCC613.07 19075195 2539305 91686..92723 1 NC_003421.2 snoRNA biogenesis protein 92723 2539305 SPCC613.07 Schizosaccharomyces pombe 972h- snoRNA biogenesis protein NP_587695.1 91686 D 284812 CDS SPCC613.08 19075196 2538703 join(93017..93230,93285..93496,93618..94169) 1 NC_003421.2 CDK regulator, involved in ribosome export (predicted) 94169 2538703 SPCC613.08 Schizosaccharomyces pombe 972h- CDK regulator, involved in ribosome export (predicted) NP_587696.1 93017 D 284812 CDS SPCC613.09 19075197 2538979 join(94731..94831,94909..95046,95116..96031) 1 NC_003421.2 tRNA-splicing endonuclease subunit Sen54 (predicted) 96031 sen54 2538979 sen54 Schizosaccharomyces pombe 972h- tRNA-splicing endonuclease subunit Sen54 (predicted) NP_587697.1 94731 D 284812 CDS SPCC613.10 19075198 2538983 96721..98001 1 NC_003421.2 ubiquinol-cytochrome-c reductase complex core protein Qcr2 98001 qcr2 2538983 qcr2 Schizosaccharomyces pombe 972h- ubiquinol-cytochrome-c reductase complex core protein Qcr2 NP_587698.1 96721 D 284812 CDS SPCC613.11c 19075199 2539349 complement(98721..99485) 1 NC_003421.2 repeat consensus MQGTMNT 3/4 copies; cell surface glycoprotein (predicted), DUF1773 family protein 2 99485 meu23 2539349 meu23 Schizosaccharomyces pombe 972h- cell surface glycoprotein (predicted), DUF1773 family protein 2 NP_587699.1 98721 R 284812 CDS SPCC613.12c 19075200 2538848 complement(100255..102171) 1 NC_003421.2 cullin-associated methyltransferase complex subunit Cmc1; Rik1-associated factor Raf1; delocalization of swi6 Dos1; Rik1-associated factor Raf1 102171 raf1 2538848 raf1 Schizosaccharomyces pombe 972h- Rik1-associated factor Raf1 NP_587700.1 100255 R 284812 CDS SPCC330.01c 19075201 2538860 complement(102685..105576) 1 NC_003421.2 Rad16 homolog Rhp16 105576 rhp16 2538860 rhp16 Schizosaccharomyces pombe 972h- Rad16 homolog Rhp16 NP_587701.1 102685 R 284812 CDS SPCC330.02 19075202 2539094 join(105680..105736,105785..107419) 1 NC_003421.2 Rad7 homolog Rhp7 107419 rhp7 2539094 rhp7 Schizosaccharomyces pombe 972h- Rad7 homolog Rhp7 NP_587702.1 105680 D 284812 CDS SPCC330.19c 162312081 5802701 complement(join(108005..108257,108318..108337)) 1 NC_003421.2 added Sept 4 2002, confirmed by EST, val; sequence orphan 108337 5802701 SPCC330.19c Schizosaccharomyces pombe 972h- sequence orphan XP_001713159.1 108005 R 284812 CDS SPCC330.03c 19075203 2538811 complement(join(109871..109938,109994..110171,110311..110502)) 1 NC_003421.2 NADPH-hemoprotein reductase 110502 2538811 SPCC330.03c Schizosaccharomyces pombe 972h- NADPH-hemoprotein reductase NP_587703.1 109871 R 284812 CDS SPCC330.04c 19075204 2538967 complement(112305..113378) 1 NC_003421.2 biased repeat containing protein - 6 copies of 'WKKAREEDKAE' repeat and 6 copies of a smaller 'WRNSMDE' repeat; cell surface glycoprotein (predicted), DUF1773 family protein 3 113378 mug135 2538967 mug135 Schizosaccharomyces pombe 972h- cell surface glycoprotein (predicted), DUF1773 family protein 3 NP_587704.1 112305 R 284812 CDS SPCC330.05c 19075205 2538768 complement(115781..116575) 1 NC_003421.2 orotidine 5'-phosphate decarboxylase Ura4 116575 ura4 2538768 ura4 Schizosaccharomyces pombe 972h- orotidine 5'-phosphate decarboxylase Ura4 NP_587705.1 115781 R 284812 CDS SPCC330.06c 19075206 2538981 complement(118423..118893) 1 NC_003421.2 thioredoxin peroxidase 118893 2538981 SPCC330.06c Schizosaccharomyces pombe 972h- thioredoxin peroxidase NP_587706.1 118423 R 284812 CDS SPCC330.07c 19075207 2539037 complement(120913..122415) 1 NC_003421.2 membrane transporter 122415 2539037 SPCC330.07c Schizosaccharomyces pombe 972h- membrane transporter NP_587707.1 120913 R 284812 CDS SPCC330.08 19075208 2539054 124563..125978 1 NC_003421.2 alpha-1,2-mannosyltransferase Alg11 125978 alg11 2539054 alg11 Schizosaccharomyces pombe 972h- alpha-1,2-mannosyltransferase Alg11 NP_587708.1 124563 D 284812 CDS SPCC330.09 19075209 2538997 127294..129198 1 NC_003421.2 rRNA processing protein Enp2 (predicted) 129198 2538997 SPCC330.09 Schizosaccharomyces pombe 972h- rRNA processing protein Enp2 (predicted) NP_587709.1 127294 D 284812 CDS SPCC330.10 19075210 2539280 129844..131013 1 NC_003421.2 mRNA capping methyltransferase 131013 pcm1 2539280 pcm1 Schizosaccharomyces pombe 972h- mRNA capping methyltransferase NP_587710.1 129844 D 284812 CDS SPCC330.11 19075211 2538714 131517..135560 1 NC_003421.2 BTB/POZ domain protein Btb1 135560 btb1 2538714 btb1 Schizosaccharomyces pombe 972h- BTB/POZ domain protein Btb1 NP_587711.1 131517 D 284812 CDS SPCC330.12c 19075212 2539100 complement(135957..136499) 1 NC_003421.2 succinate dehydrogenase (ubiquinone) cytochrome b subunit 136499 sdh3 2539100 sdh3 Schizosaccharomyces pombe 972h- succinate dehydrogenase (ubiquinone) cytochrome b subunit NP_587712.1 135957 R 284812 CDS SPCC330.13 19075213 2538885 137021..137749 1 NC_003421.2 DNA-directed RNA polymerase III complex subunit Rpc37 137749 rpc37 2538885 rpc37 Schizosaccharomyces pombe 972h- DNA-directed RNA polymerase III complex subunit Rpc37 NP_587713.1 137021 D 284812 CDS SPCC330.14c 19075214 2538849 complement(138096..138545) 1 NC_003421.2 60S ribosomal protein L24 138545 rpl2402 2538849 rpl2402 Schizosaccharomyces pombe 972h- 60S ribosomal protein L24 NP_587714.1 138096 R 284812 CDS SPCC320.14 19075215 2538738 complement(139222..140193) 1 NC_003421.2 annotations dervived from PMID:12951240, previously annotated as threonine dehydratase; threo-3-hydroxyaspartate ammonia-lyase (predicted) 140193 2538738 SPCC320.14 Schizosaccharomyces pombe 972h- threo-3-hydroxyaspartate ammonia-lyase (predicted) NP_587715.1 139222 R 284812 CDS SPCC320.13c 68013217 3361036 141662..142729 1 NC_003421.2 aurora-B kinase Ark1 142729 ark1 3361036 ark1 Schizosaccharomyces pombe 972h- aurora-B kinase Ark1 NP_001018849.1 141662 D 284812 CDS SPCC320.12 19075217 2538697 complement(join(143220..143227,143294..143843)) 1 NC_003421.2 mitochondrial inner membrane peptidase Atp23 143843 2538697 SPCC320.12 Schizosaccharomyces pombe 972h- mitochondrial inner membrane peptidase Atp23 NP_587717.1 143220 R 284812 CDS SPCC320.11c 19075218 2539255 join(144380..144435,144589..144675,144838..145237) 1 NC_003421.2 RNA-binding protein 145237 2539255 SPCC320.11c Schizosaccharomyces pombe 972h- RNA-binding protein NP_587718.1 144380 D 284812 CDS SPCC320.10 19075219 2538791 complement(join(146210..147251,147298..147617,147669..147731,147868..148128)) 1 NC_003421.2 signal recognition particle subunit Srp72 148128 srp72 2538791 srp72 Schizosaccharomyces pombe 972h- signal recognition particle subunit Srp72 NP_587719.1 146210 R 284812 CDS SPCC320.09 19075220 2539199 complement(join(149153..150163,150279..150323,150374..150472)) 1 NC_003421.2 ferrochelatase 150472 hem15 2539199 hem15 Schizosaccharomyces pombe 972h- ferrochelatase NP_587720.1 149153 R 284812 CDS SPCC320.08 19075221 2539011 complement(151307..152824) 1 NC_003421.2 membrane transporter (predicted) 152824 2539011 SPCC320.08 Schizosaccharomyces pombe 972h- membrane transporter (predicted) NP_587721.1 151307 R 284812 CDS SPCC320.07c 19075222 2538704 155906..158191 1 NC_003421.2 RNA-binding protein Mde7 158191 mde7 2538704 mde7 Schizosaccharomyces pombe 972h- RNA-binding protein Mde7 NP_587722.1 155906 D 284812 CDS SPCC320.06 19075223 2538995 complement(join(158577..159193,159251..159503)) 1 NC_003421.2 conserved fungal protein 159503 2538995 SPCC320.06 Schizosaccharomyces pombe 972h- conserved fungal protein NP_587723.1 158577 R 284812 CDS SPCC320.05 19075224 2538858 complement(159993..161996) 1 NC_003421.2 sulphate transporter (predicted) 161996 2538858 SPCC320.05 Schizosaccharomyces pombe 972h- sulphate transporter (predicted) NP_587724.1 159993 R 284812 CDS SPCC320.04c 19075225 2538910 join(163074..163175,163219..163294,163357..163493,163541..163696,163754..163819,163864..163906,163959..164291,164338..164726,164783..164884,164931..165059,165104..165178,165229..165336,165385..165561) 1 NC_003421.2 GTPase Gem1 165561 2538910 SPCC320.04c Schizosaccharomyces pombe 972h- GTPase Gem1 NP_587725.1 163074 D 284812 CDS SPCC320.03 19075226 2538949 complement(165922..168525) 1 NC_003421.2 transcription factor (predicted) 168525 2538949 SPCC320.03 Schizosaccharomyces pombe 972h- transcription factor (predicted) NP_587726.1 165922 R 284812 CDS SPCC1235.01 19075227 2539159 174183..176159 1 NC_003421.2 ~37 copies of a 7-10 repeat consensus 'PMEEITTMTI' and a S/N rich C terminal region; sequence orphan 176159 2539159 SPCC1235.01 Schizosaccharomyces pombe 972h- sequence orphan NP_587727.1 174183 D 284812 CDS SPCC1235.02 19075228 2538717 176957..178048 1 NC_003421.2 vitamin metabolic process hardwired for analysis, temporary; biotin synthase 178048 bio2 2538717 bio2 Schizosaccharomyces pombe 972h- biotin synthase NP_587728.1 176957 D 284812 CDS SPCC1235.03 19075229 2539296 179387..180586 1 NC_003421.2 SMR domain protein, possibly involved in DNA repair 180586 2539296 SPCC1235.03 Schizosaccharomyces pombe 972h- SMR domain protein, possibly involved in DNA repair NP_587729.1 179387 D 284812 CDS SPCC1235.04c 19075230 2539270 complement(join(181068..181319,181368..181776,181830..181966)) 1 NC_003421.2 FAD synthetase 181966 2539270 SPCC1235.04c Schizosaccharomyces pombe 972h- FAD synthetase NP_587730.1 181068 R 284812 CDS SPCC1235.05c 19075231 2539045 complement(183023..186877) 1 NC_003421.2 fun thirty related protein Fft2 186877 fft2 2539045 fft2 Schizosaccharomyces pombe 972h- fun thirty related protein Fft2 NP_587731.1 183023 R 284812 CDS SPCC1235.16 295442746 9407312 join(188100..188149,188323..188414,188468..188592) 1 NC_003421.2 vacuolar H+-ATPase assembly protein Vma21 (predicted) 188592 vma21 9407312 vma21 Schizosaccharomyces pombe 972h- vacuolar H+-ATPase assembly protein Vma21 (predicted) XP_002788947.1 188100 D 284812 CDS SPCC1235.06 19075232 2539080 join(189259..189783,189844..190092) 1 NC_003421.2 Sad1 interacting factor 1 190092 sif1 2539080 sif1 Schizosaccharomyces pombe 972h- Sad1 interacting factor 1 NP_587732.1 189259 D 284812 CDS SPCC1235.07 19075233 2539115 join(190730..190845,191023..191179,191238..191402,191526..191822) 1 NC_003421.2 PMID:17035632 is pending curation; Sim4 and Mal2 associated (4 and 2 associated) protein 7 191822 fta7 2539115 fta7 Schizosaccharomyces pombe 972h- Sim4 and Mal2 associated (4 and 2 associated) protein 7 NP_587733.1 190730 D 284812 CDS SPCC1235.08c 19075234 2539043 complement(192446..193126) 1 NC_003421.2 DUF1751 family protein 193126 pdh1 2539043 pdh1 Schizosaccharomyces pombe 972h- DUF1751 family protein NP_587734.1 192446 R 284812 CDS SPCC1235.09 19075235 2538701 join(194552..194603,194694..195460,195499..195918,195971..196426) 1 NC_003421.2 Set3 complex subunit Hif2 196426 hif2 2538701 hif2 Schizosaccharomyces pombe 972h- Set3 complex subunit Hif2 NP_587735.1 194552 D 284812 CDS SPCC1235.10c 19075236 2538952 complement(join(196809..198830,199029..199133,199196..199223,199279..199316)) 1 NC_003421.2 exocyst complex subunit Sec6 199316 sec6 2538952 sec6 Schizosaccharomyces pombe 972h- exocyst complex subunit Sec6 NP_587736.1 196809 R 284812 CDS SPCC1235.11 19075237 2539169 join(200130..200131,200172..200276,200365..200459,200643..200683,200750..200844,200900..200987) 1 NC_003421.2 mitochondrial protein, human BRP44L ortholog 200987 2539169 SPCC1235.11 Schizosaccharomyces pombe 972h- mitochondrial protein, human BRP44L ortholog NP_587737.1 200130 D 284812 CDS SPCC1235.12c 19075238 2539151 complement(201772..202707) 1 NC_003421.2 meiotically upregulated gene Mug46 202707 mug146 2539151 mug146 Schizosaccharomyces pombe 972h- meiotically upregulated gene Mug46 NP_587738.1 201772 R 284812 CDS SPCC1235.13 19075239 2538845 204733..206340 1 NC_003421.2 hexose transporter Ght6 206340 ght6 2538845 ght6 Schizosaccharomyces pombe 972h- hexose transporter Ght6 NP_587739.1 204733 D 284812 CDS SPCC1235.14 19075240 2539240 212313..213953 1 NC_003421.2 hexose transporter Ght5 213953 ght5 2539240 ght5 Schizosaccharomyces pombe 972h- hexose transporter Ght5 NP_587740.1 212313 D 284812 CDS SPCC1235.15 162312083 5802702 join(215424..215600,215850..216078,216187..216498,216591..216910) 1 NC_003421.2 non consensus intron fixed 19. Nov. 2003 pers. comm. Jan Dungan; diacylglycerol O-acyltransferase Dga1 216910 dga1 5802702 dga1 Schizosaccharomyces pombe 972h- diacylglycerol O-acyltransferase Dga1 XP_001713160.1 215424 D 284812 CDS SPCC548.04 295442748 2538765 join(223385..223407,223451..223603,223687..223796,223853..223860) 1 NC_003421.2 ubiquitin family protein Urm1 (predicted) 223860 urm1 2538765 urm1 Schizosaccharomyces pombe 972h- ubiquitin family protein Urm1 (predicted) NP_587744.2 223385 D 284812 CDS SPCC548.05c 19075245 2539314 complement(join(224087..225172,225323..225643)) 1 NC_003421.2 ubiquitin-protein ligase E3 (predicted) 225643 2539314 SPCC548.05c Schizosaccharomyces pombe 972h- ubiquitin-protein ligase E3 (predicted) NP_587745.1 224087 R 284812 CDS SPCC548.06c 19075246 2539300 complement(226757..228400) 1 NC_003421.2 hexose transporter Ght8 (predicted) 228400 ght8 2539300 ght8 Schizosaccharomyces pombe 972h- hexose transporter Ght8 (predicted) NP_587746.1 226757 R 284812 CDS SPCC548.07c 19075247 2538732 complement(232834..234507) 1 NC_003421.2 hexose transporter Ght1 234507 ght1 2538732 ght1 Schizosaccharomyces pombe 972h- hexose transporter Ght1 NP_587747.1 232834 R 284812 CDS SPCC1529.01 295442750 2539221 join(237554..237923,237975..238080,238139..238533,238588..239092,239151..239250) 1 NC_003421.2 coordinates updated 12/Oct?07, pers. comm. Brian Wilhelm; membrane transporter 239250 2539221 SPCC1529.01 Schizosaccharomyces pombe 972h- membrane transporter NP_587748.2 237554 D 284812 CDS SPCC794.01c 19075249 2539576 complement(239781..241208) 1 NC_003421.2 glucose-6-phosphate 1-dehydrogenase (predicted) 241208 2539576 SPCC794.01c Schizosaccharomyces pombe 972h- glucose-6-phosphate 1-dehydrogenase (predicted) NP_587749.1 239781 R 284812 CDS SPCC794.02 19075250 2539070 join(243855..243993,244160..244405,244455..244760,244802..244843,244893..244969) 1 NC_003421.2 wtf element Wtf5 244969 wtf5 2539070 wtf5 Schizosaccharomyces pombe 972h- wtf element Wtf5 NP_587750.1 243855 D 284812 CDS SPCC794.03 19075251 2539472 245964..247628 1 NC_003421.2 amino acid permease, unknown 13 247628 2539472 SPCC794.03 Schizosaccharomyces pombe 972h- amino acid permease, unknown 13 NP_587751.1 245964 D 284812 CDS SPCC794.04c 19075252 2539445 complement(248551..250194) 1 NC_003421.2 membrane transporter 250194 2539445 SPCC794.04c Schizosaccharomyces pombe 972h- membrane transporter NP_587752.1 248551 R 284812 CDS SPCC794.06 19075254 2539435 260437..261732 1 NC_003421.2 TDT malic acid transporter 261732 2539435 SPCC794.06 Schizosaccharomyces pombe 972h- TDT malic acid transporter NP_587754.1 260437 D 284812 CDS SPCC794.07 19075255 2538797 join(262811..262884,262971..263041,263093..264399) 1 NC_003421.2 dihydrolipoamide S-acetyltransferase E2 (predicted) 264399 2538797 SPCC794.07 Schizosaccharomyces pombe 972h- dihydrolipoamide S-acetyltransferase E2 (predicted) NP_587755.1 262811 D 284812 CDS SPCC794.08 19075256 2538740 join(265445..265644,265685..267881) 1 NC_003421.2 HEAT repeat protein, unknown biological role 267881 2538740 SPCC794.08 Schizosaccharomyces pombe 972h- HEAT repeat protein, unknown biological role NP_587756.1 265445 D 284812 CDS SPCC794.09c 19075257 2539035 complement(268097..269479) 1 NC_003421.2 translation elongation factor EF-1 alpha Ef1a-a 269479 ef1a-a 2539035 ef1a-a Schizosaccharomyces pombe 972h- translation elongation factor EF-1 alpha Ef1a-a NP_587757.1 268097 R 284812 CDS SPCC794.10 19075258 2539585 270966..272465 1 NC_003421.2 UTP-glucose-1-phosphate uridylyltransferase (predicted) 272465 2539585 SPCC794.10 Schizosaccharomyces pombe 972h- UTP-glucose-1-phosphate uridylyltransferase (predicted) NP_587758.1 270966 D 284812 CDS SPCC794.11c 19075259 2539421 complement(273167..274597) 1 NC_003421.2 ENTH/VHS domain protein Ent3 274597 2539421 SPCC794.11c Schizosaccharomyces pombe 972h- ENTH/VHS domain protein Ent3 NP_587759.1 273167 R 284812 CDS SPCC794.12c 19075260 2539592 complement(275514..277211) 1 NC_003421.2 malic enzyme, malate dehydrogenase (oxaloacetate decarboxylating), Mae2 277211 mae2 2539592 mae2 Schizosaccharomyces pombe 972h- malic enzyme, malate dehydrogenase (oxaloacetate decarboxylating), Mae2 NP_587760.1 275514 R 284812 CDS SPCC794.15 19075261 2539297 join(278906..278983,279027..279209) 1 NC_003421.2 below 100 amino acid size threshold; sequence orphan 279209 2539297 SPCC794.15 Schizosaccharomyces pombe 972h- sequence orphan NP_587761.1 278906 D 284812 CDS SPCC553.12c 63054411 2539446 279434..280999 1 NC_003421.2 conserved fungal protein 280999 2539446 SPCC553.12c Schizosaccharomyces pombe 972h- conserved fungal protein NP_587762.2 279434 D 284812 CDS SPCC553.11c 19075263 2538859 join(281902..281936,282056..282137,282204..282410) 1 NC_003421.2 transcription factor TFIIA complex small subunit (predicted) 282410 2538859 SPCC553.11c Schizosaccharomyces pombe 972h- transcription factor TFIIA complex small subunit (predicted) NP_587763.1 281902 D 284812 CDS SPCC553.10 19075264 2539384 complement(283422..284471) 1 NC_003421.2 conserved fungal protein 284471 2539384 SPCC553.10 Schizosaccharomyces pombe 972h- conserved fungal protein NP_587764.1 283422 R 284812 CDS SPCC553.09c 19075265 2539135 join(287640..287905,287947..288925,288968..289276,289316..289486) 1 NC_003421.2 PMID:15314153 is pending GO curation; DNA polymerase alpha B-subunit 289486 spb70 2539135 spb70 Schizosaccharomyces pombe 972h- DNA polymerase alpha B-subunit NP_587765.1 287640 D 284812 CDS SPCC553.08c 19075266 2539293 join(289912..290007,290063..292215,292261..293014) 1 NC_003421.2 GTPase Ria1 (predicted) 293014 2539293 SPCC553.08c Schizosaccharomyces pombe 972h- GTPase Ria1 (predicted) NP_587766.1 289912 D 284812 CDS SPCC553.07c 63054412 2539547 join(293444..293936,293976..294415,294462..294974,295021..295218) 1 NC_003421.2 added missed C-terminal exon (pers. comm. Charly Chahwan); GO:0000790 is Rad17-dependent; DinB translesion DNA repair polymerase 295218 mug40 2539547 mug40 Schizosaccharomyces pombe 972h- DinB translesion DNA repair polymerase NP_587767.2 293444 D 284812 CDS SPCC553.06 19075268 2539265 complement(join(295482..295967,296068..296266,296357..296487)) 1 NC_003421.2 oligosaccharyltransferase subunit 296487 2539265 SPCC553.06 Schizosaccharomyces pombe 972h- oligosaccharyltransferase subunit NP_587768.1 295482 R 284812 CDS SPCC553.04 19075269 2539557 complement(join(300340..302102,302158..302227)) 1 NC_003421.2 WD repeat containing cyclophilin family peptidyl-prolyl cis-trans isomerase Cyp9 302227 cyp9 2539557 cyp9 Schizosaccharomyces pombe 972h- WD repeat containing cyclophilin family peptidyl-prolyl cis-trans isomerase Cyp9 NP_587769.1 300340 R 284812 CDS SPCC553.03 19075270 2539405 complement(join(302352..304934,304980..305210)) 1 NC_003421.2 AAA family ATPase Pex1 (predicted) 305210 pex1 2539405 pex1 Schizosaccharomyces pombe 972h- AAA family ATPase Pex1 (predicted) NP_587770.1 302352 R 284812 CDS SPCC553.02 19075271 2539475 complement(join(305988..306194,306247..306574,306624..307035,307082..308091,308292..308408,308453..308481)) 1 NC_003421.2 glutamine-dependent NAD(+) synthetase (predicted) 308481 2539475 SPCC553.02 Schizosaccharomyces pombe 972h- glutamine-dependent NAD(+) synthetase (predicted) NP_587771.1 305988 R 284812 CDS SPCC553.01c 162312086 2538994 310539..312686 1 NC_003421.2 meiotic chromosome segregation protein 312686 2538994 SPCC553.01c Schizosaccharomyces pombe 972h- meiotic chromosome segregation protein NP_587772.3 310539 D 284812 CDS SPCC736.02 19075273 2539443 313183..314043 1 NC_003421.2 sequence orphan 314043 2539443 SPCC736.02 Schizosaccharomyces pombe 972h- sequence orphan NP_587773.1 313183 D 284812 CDS SPCC736.03c 19075274 2538914 complement(314364..315653) 1 NC_003421.2 mitochondrial phenylalanyl-tRNA synthetase 315653 2538914 SPCC736.03c Schizosaccharomyces pombe 972h- mitochondrial phenylalanyl-tRNA synthetase NP_587774.1 314364 R 284812 CDS SPCC736.04c 19075275 2539101 complement(316725..317852) 1 NC_003421.2 alpha-1,2-galactosyltransferase Gma12 317852 gma12 2539101 gma12 Schizosaccharomyces pombe 972h- alpha-1,2-galactosyltransferase Gma12 NP_587775.1 316725 R 284812 CDS SPCC736.05 295442752 2539521 join(320617..320755,320964..321335,321387..321523) 1 NC_003421.2 wtf element Wtf7 321523 wtf7 2539521 wtf7 Schizosaccharomyces pombe 972h- wtf element Wtf7 NP_587776.2 320617 D 284812 CDS SPCC736.06 19075277 2538918 323032..324867 1 NC_003421.2 mitochondrial aspartate-tRNA ligase 324867 2538918 SPCC736.06 Schizosaccharomyces pombe 972h- mitochondrial aspartate-tRNA ligase NP_587777.1 323032 D 284812 CDS SPCC736.07c 19075278 2538840 complement(join(324921..326872,326947..327094)) 1 NC_003421.2 conserved fungal protein 327094 2538840 SPCC736.07c Schizosaccharomyces pombe 972h- conserved fungal protein NP_587778.1 324921 R 284812 CDS SPCC736.08 19075279 2539560 join(327542..327623,327702..329461) 1 NC_003421.2 CBF1/Su(H)/LAG-1 family transcription factor Cbf11 329461 cbf11 2539560 cbf11 Schizosaccharomyces pombe 972h- CBF1/Su(H)/LAG-1 family transcription factor Cbf11 NP_587779.1 327542 D 284812 CDS SPCC736.09c 19075280 2539455 complement(329749..330444) 1 NC_003421.2 TRAX 330444 2539455 SPCC736.09c Schizosaccharomyces pombe 972h- TRAX NP_587780.1 329749 R 284812 CDS SPCC736.10c 19075281 2539594 complement(332025..332483) 1 NC_003421.2 mitochondrial ribosomal protein subunit S8 332483 mrps8 2539594 mrps8 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit S8 NP_587781.1 332025 R 284812 CDS SPCC736.11 19075282 2539403 join(334137..334265,334637..337012) 1 NC_003421.2 argonaute 337012 ago1 2539403 ago1 Schizosaccharomyces pombe 972h- argonaute NP_587782.1 334137 D 284812 CDS SPCC736.12c 295442754 2539540 complement(join(337829..337985,338030..338178,338232..338347,338395..339354,339483..339567)) 1 NC_003421.2 targets include meu26, crs1, mug9, meu1, rec8, bqt1, mug1, ssm4, spo5, rec25 PMID:16823445; YTH family protein Mmi1 339567 mmi1 2539540 mmi1 Schizosaccharomyces pombe 972h- YTH family protein Mmi1 NP_587783.2 337829 R 284812 CDS SPCC736.13 19075284 2539566 complement(340769..341788) 1 NC_003421.2 short chain dehydrogenase (predicted) 341788 2539566 SPCC736.13 Schizosaccharomyces pombe 972h- short chain dehydrogenase (predicted) NP_587784.1 340769 R 284812 CDS SPCC736.14 19075285 2539505 join(343034..343084,343352..345949) 1 NC_003421.2 microtubule-associated protein Dis1 345949 dis1 2539505 dis1 Schizosaccharomyces pombe 972h- microtubule-associated protein Dis1 NP_587785.1 343034 D 284812 CDS SPCC736.15 19075286 2539093 349172..350227 1 NC_003421.2 protein kinase inhibitor (predicted) 350227 2539093 SPCC736.15 Schizosaccharomyces pombe 972h- protein kinase inhibitor (predicted) NP_587786.1 349172 D 284812 CDS SPCC594.01 63054414 2538708 join(354456..354756,354856..354946,355269..357252) 1 NC_003421.2 DUF1769 family protein 357252 2538708 SPCC594.01 Schizosaccharomyces pombe 972h- DUF1769 family protein NP_587787.2 354456 D 284812 CDS SPCC594.02c 19075288 2538998 complement(358264..359733) 1 NC_003421.2 conserved fungal protein 359733 2538998 SPCC594.02c Schizosaccharomyces pombe 972h- conserved fungal protein NP_587788.1 358264 R 284812 CDS SPCC594.03 19075289 2538819 361356..361682 1 NC_003421.2 dubious 361682 2538819 SPCC594.03 Schizosaccharomyces pombe 972h- dubious NP_587789.1 361356 D 284812 CDS SPCC594.04c 19075290 2539484 complement(362699..363715) 1 NC_003421.2 steroid oxidoreductase superfamily protein 363715 2539484 SPCC594.04c Schizosaccharomyces pombe 972h- steroid oxidoreductase superfamily protein NP_587790.1 362699 R 284812 CDS SPCC594.05c 19075291 2539023 complement(364204..365478) 1 NC_003421.2 spp1 is already used by SPAC6B12.10c; Set1C PHD Finger protein Spf1 365478 spf1 2539023 spf1 Schizosaccharomyces pombe 972h- Set1C PHD Finger protein Spf1 NP_587791.1 364204 R 284812 CDS SPCC594.06c 19075292 2538847 complement(join(365928..366917,366954..366989)) 1 NC_003421.2 vacuolar SNARE Vam7 (predicted) 366989 2538847 SPCC594.06c Schizosaccharomyces pombe 972h- vacuolar SNARE Vam7 (predicted) NP_587792.1 365928 R 284812 CDS SPCC594.07c 19075293 2539582 complement(join(368179..368790,368840..368995)) 1 NC_003421.2 sequence orphan 368995 2539582 SPCC594.07c Schizosaccharomyces pombe 972h- sequence orphan NP_587793.1 368179 R 284812 CDS SPCC1682.01 162312088 2539153 join(371230..371286,371353..371438,371498..371546,371612..371677) 1 NC_003421.2 ubiquinol-cytochrome-c reductase complex subunit 9 371677 qcr9 2539153 qcr9 Schizosaccharomyces pombe 972h- ubiquinol-cytochrome-c reductase complex subunit 9 NP_587794.3 371230 D 284812 CDS SPCC1682.02c 19075295 2538838 complement(372447..375086) 1 NC_003421.2 MCM complex subunit Mcm3 375086 mcm3 2538838 mcm3 Schizosaccharomyces pombe 972h- MCM complex subunit Mcm3 NP_587795.1 372447 R 284812 CDS SPCC1682.03c 19075296 2538863 complement(join(375965..376590,376628..377882)) 1 NC_003421.2 meiotically upregulated gene Mug174 377882 mug174 2538863 mug174 Schizosaccharomyces pombe 972h- meiotically upregulated gene Mug174 NP_587796.1 375965 R 284812 CDS SPCC1682.04 19075297 2539261 join(378229..378523,378690..378925) 1 NC_003421.2 centrin 378925 cdc31 2539261 cdc31 Schizosaccharomyces pombe 972h- centrin NP_587797.1 378229 D 284812 CDS SPCC1682.05c 19075298 2539391 complement(join(379065..379652,379728..380604,380660..380922,380969..381034)) 1 NC_003421.2 signal recognition particle subunit (predicted) 381034 srp68 2539391 srp68 Schizosaccharomyces pombe 972h- signal recognition particle subunit (predicted) NP_587798.1 379065 R 284812 CDS SPCC1682.06 19075299 2539128 join(382377..382767,382813..383138) 1 NC_003421.2 sequence orphan 383138 2539128 SPCC1682.06 Schizosaccharomyces pombe 972h- sequence orphan NP_587799.1 382377 D 284812 CDS SPCC1682.07 19075300 2539194 join(384473..384690,384821..385868) 1 NC_003421.2 transcription factor TFIIH complex subunit Ssl1 385868 ssl1 2539194 ssl1 Schizosaccharomyces pombe 972h- transcription factor TFIIH complex subunit Ssl1 NP_587800.1 384473 D 284812 CDS SPCC1682.08c 19075301 2539137 complement(386124..388235) 1 NC_003421.2 RNA-binding protein Mcp2 388235 2539137 SPCC1682.08c Schizosaccharomyces pombe 972h- RNA-binding protein Mcp2 NP_587801.1 386124 R 284812 CDS SPCC1682.09c 19075302 2538713 complement(join(388702..389218,389318..389412,389534..389824)) 1 NC_003421.2 mitochondrial guanine nucleotide transporter 389824 2538713 SPCC1682.09c Schizosaccharomyces pombe 972h- mitochondrial guanine nucleotide transporter NP_587802.1 388702 R 284812 CDS SPCC1682.10 19075303 2538912 join(390747..390797,390842..391765) 1 NC_003421.2 19S proteasome regulatory subunit Rpn8 (predicted) 391765 rpn8 2538912 rpn8 Schizosaccharomyces pombe 972h- 19S proteasome regulatory subunit Rpn8 (predicted) NP_587803.1 390747 D 284812 CDS SPCC1682.11c 19075304 2538935 complement(join(392323..392434,392486..393025,393075..394134,394172..394184)) 1 NC_003421.2 DUF580 family protein 394184 2538935 SPCC1682.11c Schizosaccharomyces pombe 972h- DUF580 family protein NP_587804.1 392323 R 284812 CDS SPCC1682.12c 19075305 2538947 complement(394883..396256) 1 NC_003421.2 ubiquitin C-terminal hydrolase Ubp16 396256 ubp16 2538947 ubp16 Schizosaccharomyces pombe 972h- ubiquitin C-terminal hydrolase Ubp16 NP_587805.1 394883 R 284812 CDS SPCC1682.13 19075306 2538956 399080..399898 1 NC_003421.2 Clr6 associated factor 2, Laf2 399898 laf2 2538956 laf2 Schizosaccharomyces pombe 972h- Clr6 associated factor 2, Laf2 NP_587806.1 399080 D 284812 CDS SPCC1682.14 19075307 2539178 400767..401348 1 NC_003421.2 60S ribosomal protein L19 401348 rpl1902 2539178 rpl1902 Schizosaccharomyces pombe 972h- 60S ribosomal protein L19 NP_587807.1 400767 D 284812 CDS SPCC1682.15 19075308 2539235 402249..404498 1 NC_003421.2 PX/PXA domain protein 404498 mug122 2539235 mug122 Schizosaccharomyces pombe 972h- PX/PXA domain protein NP_587808.1 402249 D 284812 CDS SPCC1682.16 63054416 2539189 join(405612..405829,406303..407251) 1 NC_003421.2 19S proteasome regulatory subunit Rpt4 (predicted) 407251 rpt4 2539189 rpt4 Schizosaccharomyces pombe 972h- 19S proteasome regulatory subunit Rpt4 (predicted) NP_587809.2 405612 D 284812 CDS SPCC306.02c 19075310 2539170 complement(join(408244..408693,408758..408823)) 1 NC_003421.2 Rab GTPase binding (predicted) 408823 2539170 SPCC306.02c Schizosaccharomyces pombe 972h- Rab GTPase binding (predicted) NP_587810.1 408244 R 284812 CDS SPCC306.03c 19075311 2538744 complement(409839..412067) 1 NC_003421.2 condensin, non-SMC subunit Cnd2 412067 cnd2 2538744 cnd2 Schizosaccharomyces pombe 972h- condensin, non-SMC subunit Cnd2 NP_587811.1 409839 R 284812 CDS SPCC306.04c 19075312 2538762 complement(412765..415527) 1 NC_003421.2 histone lysine methyltransferase Set1 415527 set1 2538762 set1 Schizosaccharomyces pombe 972h- histone lysine methyltransferase Set1 NP_587812.1 412765 R 284812 CDS SPCC306.05c 19075313 2539373 complement(join(416424..416532,416616..416779,417005..417577)) 1 NC_003421.2 INSIG domain protein 417577 ins1 2539373 ins1 Schizosaccharomyces pombe 972h- INSIG domain protein NP_587813.1 416424 R 284812 CDS SPCC306.06c 19075314 2539326 complement(join(418476..419319,419382..419473)) 1 NC_003421.2 ER membrane protein, BIG1 family (predicted) 419473 2539326 SPCC306.06c Schizosaccharomyces pombe 972h- ER membrane protein, BIG1 family (predicted) NP_587814.1 418476 R 284812 CDS SPCC306.07c 19075315 2538926 complement(join(420000..420657,420879..421012,421073..421135)) 1 NC_003421.2 U3 snoRNP-associated protein Cic1/Utp30 family 421135 2538926 SPCC306.07c Schizosaccharomyces pombe 972h- U3 snoRNP-associated protein Cic1/Utp30 family NP_587815.1 420000 R 284812 CDS SPCC306.08c 19075316 2538766 complement(421703..422728) 1 NC_003421.2 malate dehydrogenase 422728 2538766 SPCC306.08c Schizosaccharomyces pombe 972h- malate dehydrogenase NP_587816.1 421703 R 284812 CDS SPCC306.09c 19075317 2538829 complement(join(424547..426143,426218..426276)) 1 NC_003421.2 adenylyl cyclase-associated protein Cap1 426276 cap1 2538829 cap1 Schizosaccharomyces pombe 972h- adenylyl cyclase-associated protein Cap1 NP_587817.1 424547 R 284812 CDS SPCC306.11 19075318 2538873 430788..431639 1 NC_003421.2 sequence orphan 431639 2538873 SPCC306.11 Schizosaccharomyces pombe 972h- sequence orphan NP_587818.1 430788 D 284812 CDS SPCC4G3.19 19075319 2539309 complement(432395..434674) 1 NC_003421.2 gamma tubulin complex subunit Alp16 434674 alp16 2539309 alp16 Schizosaccharomyces pombe 972h- gamma tubulin complex subunit Alp16 NP_587819.1 432395 R 284812 CDS SPCC4G3.18 19075320 2539542 complement(435937..438423) 1 NC_003421.2 ribosome biogenesis protein Rix1 (predicted) 438423 2539542 SPCC4G3.18 Schizosaccharomyces pombe 972h- ribosome biogenesis protein Rix1 (predicted) NP_587820.1 435937 R 284812 CDS SPCC4G3.17 19075321 2539410 complement(439064..439660) 1 NC_003421.2 metal dependent phosphohydrolase (predicted) 439660 2539410 SPCC4G3.17 Schizosaccharomyces pombe 972h- metal dependent phosphohydrolase (predicted) NP_587821.1 439064 R 284812 CDS SPCC4G3.16 19075322 2539515 complement(440054..441271) 1 NC_003421.2 CMP/dCMP deaminase family 441271 2539515 SPCC4G3.16 Schizosaccharomyces pombe 972h- CMP/dCMP deaminase family NP_587822.1 440054 R 284812 CDS SPCC4G3.15c 19075323 2538778 join(442039..442145,442214..442432,442492..442696) 1 NC_003421.2 CCR4-Not complex subunit Not2 (predicted) 442696 not2 2538778 not2 Schizosaccharomyces pombe 972h- CCR4-Not complex subunit Not2 (predicted) NP_587823.1 442039 D 284812 CDS SPCC4G3.14 19075324 2539501 complement(443170..444756) 1 NC_003421.2 DNAJ domain protein Mdj1 (predicted) 444756 mdj1 2539501 mdj1 Schizosaccharomyces pombe 972h- DNAJ domain protein Mdj1 (predicted) NP_587824.1 443170 R 284812 CDS SPCC4G3.13c 19075325 2539541 445404..446051 1 NC_003421.2 putative signal sequence at aa 1-20; CUE domain protein Cue1/4 family 446051 2539541 SPCC4G3.13c Schizosaccharomyces pombe 972h- CUE domain protein Cue1/4 family NP_587825.1 445404 D 284812 CDS SPCC4G3.12c 19075326 2539364 447264..449729 1 NC_003421.2 ubiquitin-protein ligase E3 (predicted) 449729 2539364 SPCC4G3.12c Schizosaccharomyces pombe 972h- ubiquitin-protein ligase E3 (predicted) NP_587826.1 447264 D 284812 CDS SPCC4G3.11 19075327 2539375 complement(450465..451415) 1 NC_003421.2 conserved fungal protein 451415 mug154 2539375 mug154 Schizosaccharomyces pombe 972h- conserved fungal protein NP_587827.1 450465 R 284812 CDS SPCC4G3.10c 19075328 2539465 452369..454429 1 NC_003421.2 DNA repair protein Rhp42 454429 rhp42 2539465 rhp42 Schizosaccharomyces pombe 972h- DNA repair protein Rhp42 NP_587828.1 452369 D 284812 CDS SPCC4G3.09c 19075329 2539298 455303..457210 1 NC_003421.2 GTPase activating protein Gyp3 457210 gyp3 2539298 gyp3 Schizosaccharomyces pombe 972h- GTPase activating protein Gyp3 NP_587829.1 455303 D 284812 CDS SPCC4G3.08 19075330 2539494 complement(458100..459410) 1 NC_003421.2 serine/threonine protein kinase Psk1 459410 psk1 2539494 psk1 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Psk1 NP_587830.1 458100 R 284812 CDS SPCC4G3.07c 19075331 2539406 460117..461502 1 NC_003421.2 PHD finger containing protein Phf1 461502 phf1 2539406 phf1 Schizosaccharomyces pombe 972h- PHD finger containing protein Phf1 NP_587831.1 460117 D 284812 CDS SPCC4G3.06c 19075332 2539502 461951..462385 1 NC_003421.2 mitochondrial ribosomal protein subunit L4 462385 mrpl4 2539502 mrpl4 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit L4 NP_587832.1 461951 D 284812 CDS SPCC4G3.05c 162312090 2539004 join(462720..462815,462984..464714) 1 NC_003421.2 Holliday junction resolvase subunit Mus81 464714 mus81 2539004 mus81 Schizosaccharomyces pombe 972h- Holliday junction resolvase subunit Mus81 XP_001713161.1 462720 D 284812 CDS SPCC4G3.04c 19075334 2539510 join(464937..465129,465259..465983) 1 NC_003421.2 C-methytransferase (predicted) 465983 coq5 2539510 coq5 Schizosaccharomyces pombe 972h- C-methytransferase (predicted) NP_587834.1 464937 D 284812 CDS SPCC4G3.03 19075335 2539458 complement(466796..467839) 1 NC_003421.2 WD40/YVTN repeat-like protein 467839 2539458 SPCC4G3.03 Schizosaccharomyces pombe 972h- WD40/YVTN repeat-like protein NP_587835.1 466796 R 284812 CDS SPCC4G3.02 19075336 2539292 complement(join(468839..469135,469245..469331,469396..469497,469626..469688)) 1 NC_003421.2 bis(5'-nucleosidyl)-tetraphosphatase 469688 aph1 2539292 aph1 Schizosaccharomyces pombe 972h- bis(5'-nucleosidyl)-tetraphosphatase NP_587836.1 468839 R 284812 CDS SPCC364.07 19075337 2539490 complement(470668..472068) 1 NC_003421.2 D-3 phosphoglycerate dehydrogenase (predicted) 472068 2539490 SPCC364.07 Schizosaccharomyces pombe 972h- D-3 phosphoglycerate dehydrogenase (predicted) NP_587837.1 470668 R 284812 CDS SPCC364.06 19075338 2539538 complement(474390..475571) 1 NC_003421.2 nucleosome assembly protein Nap1 475571 nap1 2539538 nap1 Schizosaccharomyces pombe 972h- nucleosome assembly protein Nap1 NP_587838.1 474390 R 284812 CDS SPCC364.05 19075339 2539519 complement(join(476046..478343,478400..478587,478640..478745,478800..478864,478913..478988)) 1 NC_003421.2 GTPase regulator Vps3 (predicted) 478988 vps3 2539519 vps3 Schizosaccharomyces pombe 972h- GTPase regulator Vps3 (predicted) NP_587839.1 476046 R 284812 CDS SPCC364.04c 19075340 2539476 join(479727..479778,479836..479946,480013..481751) 1 NC_003421.2 CASP family protein 481751 2539476 SPCC364.04c Schizosaccharomyces pombe 972h- CASP family protein NP_587840.1 479727 D 284812 CDS SPCC364.03 19075341 2539013 complement(482235..482798) 1 NC_003421.2 60S ribosomal protein L17 482798 rpl1702 2539013 rpl1702 Schizosaccharomyces pombe 972h- 60S ribosomal protein L17 NP_587841.1 482235 R 284812 CDS SPCC364.02c 19075342 2538787 483585..484739 1 NC_003421.2 stress response protein Bis1 484739 bis1 2538787 bis1 Schizosaccharomyces pombe 972h- stress response protein Bis1 NP_587842.1 483585 D 284812 CDS SPCC364.01 19075343 2539535 complement(join(484965..485924,485977..485979)) 1 NC_003421.2 splicing possibly incorrect, non-consensus branch, may use internal Met at position 1166; calnexin independence factor Cif1 485979 cif1 2539535 cif1 Schizosaccharomyces pombe 972h- calnexin independence factor Cif1 NP_587843.1 484965 R 284812 CDS SPCC970.11c 19075344 2539347 join(487167..487305,487473..487718,487768..488046,488092..488283,488324..488386,488437..488519) 1 NC_003421.2 wtf element Wtf9 488519 wtf9 2539347 wtf9 Schizosaccharomyces pombe 972h- wtf element Wtf9 NP_587844.1 487167 D 284812 CDS SPCC970.10c 19075345 2539307 join(490068..490157,490222..492174) 1 NC_003421.2 ubiquitin-protein ligase E3 Brl2 492174 brl2 2539307 brl2 Schizosaccharomyces pombe 972h- ubiquitin-protein ligase E3 Brl2 NP_587845.1 490068 D 284812 CDS SPCC970.09 19075346 2539407 complement(join(492370..492784,492832..493549,493600..493738,493780..493954,494003..495612,495673..495722,495767..495926)) 1 NC_003421.2 exocyst complex subunit Sec8 495926 sec8 2539407 sec8 Schizosaccharomyces pombe 972h- exocyst complex subunit Sec8 NP_587846.1 492370 R 284812 CDS SPCC970.08 19075347 2538905 complement(496863..499766) 1 NC_003421.2 inositol polyphosphate kinase (predicted) 499766 2538905 SPCC970.08 Schizosaccharomyces pombe 972h- inositol polyphosphate kinase (predicted) NP_587847.1 496863 R 284812 CDS SPCC970.07c 19075348 2539420 500859..502769 1 NC_003421.2 cullin-associated methyltransferase complex subunit Cmc2; Rik1-associated factor Raf2; delocalization of swi6 Dos2; Rik1-associated factor Raf2 502769 raf2 2539420 raf2 Schizosaccharomyces pombe 972h- Rik1-associated factor Raf2 NP_587848.1 500859 D 284812 CDS SPCC970.06 19075349 2539516 complement(503617..504525) 1 NC_003421.2 cargo receptor for soluble proteins (predicted) 504525 2539516 SPCC970.06 Schizosaccharomyces pombe 972h- cargo receptor for soluble proteins (predicted) NP_587849.1 503617 R 284812 CDS SPCC970.05 19075350 2538883 complement(join(506415..506492,506654..506875)) 1 NC_003421.2 60S ribosomal protein L36 506875 rpl3601 2538883 rpl3601 Schizosaccharomyces pombe 972h- 60S ribosomal protein L36 NP_587850.1 506415 R 284812 CDS SPCC970.04c 19075351 2539016 join(508053..508320,508777..508870,508936..509308) 1 NC_003421.2 protein kinase activator Mob2 509308 mob2 2539016 mob2 Schizosaccharomyces pombe 972h- protein kinase activator Mob2 NP_587851.1 508053 D 284812 CDS SPCC970.03 19075352 2539526 complement(510435..511340) 1 NC_003421.2 cytochrome b5 reductase (predicted) 511340 2539526 SPCC970.03 Schizosaccharomyces pombe 972h- cytochrome b5 reductase (predicted) NP_587852.1 510435 R 284812 CDS SPCC970.02 19075353 2538908 complement(join(512043..512275,512326..512635,512709..513281,513328..513540)) 1 NC_003421.2 mannan endo-1,6-alpha-mannosidase (predicted) 513540 2538908 SPCC970.02 Schizosaccharomyces pombe 972h- mannan endo-1,6-alpha-mannosidase (predicted) NP_587853.1 512043 R 284812 CDS SPCC970.12 19075354 2538763 complement(join(514122..514251,514293..514328,514377..514463,514511..514571,514617..514770)) 1 NC_003421.2 kinetochore protein Mis18 514770 mis18 2538763 mis18 Schizosaccharomyces pombe 972h- kinetochore protein Mis18 NP_587854.1 514122 R 284812 CDS SPCC970.01 19075355 2538760 complement(join(514906..515322,515363..515794,515837..516164,516204..516552,516602..516885,516936..517412,517459..517581,517635..517903)) 1 NC_003421.2 DNA repair endonuclease XPF 517903 rad16 2538760 rad16 Schizosaccharomyces pombe 972h- DNA repair endonuclease XPF NP_587855.1 514906 R 284812 CDS SPCC10H11.01 19075356 2538936 519540..522584 1 NC_003421.2 ATP-dependent RNA helicase Prp11 522584 prp11 2538936 prp11 Schizosaccharomyces pombe 972h- ATP-dependent RNA helicase Prp11 NP_587856.1 519540 D 284812 CDS SPCC10H11.02 63054417 2539268 524132..525001 1 NC_003421.2 DNAJ domain protein Cwf23 525001 cwf23 2539268 cwf23 Schizosaccharomyces pombe 972h- DNAJ domain protein Cwf23 NP_587857.2 524132 D 284812 CDS SPCP31B10.02 19075358 2539599 525361..525792 1 NC_003421.2 conserved VP.KP.EP.NCC.SGC..CVW.Y..DL; conserved eukaryotic protein 525792 2539599 SPCP31B10.02 Schizosaccharomyces pombe 972h- conserved eukaryotic protein NP_587858.1 525361 D 284812 CDS SPCP31B10.03c 19075359 2539504 complement(526271..526690) 1 NC_003421.2 mediator complex subunit Med31 526690 med31 2539504 med31 Schizosaccharomyces pombe 972h- mediator complex subunit Med31 NP_587859.1 526271 R 284812 CDS SPCP31B10.04 19075360 2539450 join(527602..527665,527751..528092,528190..528647) 1 NC_003421.2 homology to YKL077W is low but has conserved residues by multiple alignment, conserved N-terminal signal peptide and C-terminal transmenbrane helix; confirmed intron; conserved fungal protein 528647 2539450 SPCP31B10.04 Schizosaccharomyces pombe 972h- conserved fungal protein NP_587860.1 527602 D 284812 CDS SPCP31B10.05 19075361 2539579 529173..530783 1 NC_003421.2 tyrosyl-DNA phosphodiesterase Tdp1 530783 tdp1 2539579 tdp1 Schizosaccharomyces pombe 972h- tyrosyl-DNA phosphodiesterase Tdp1 NP_587861.1 529173 D 284812 CDS SPCP31B10.06 19075362 2539477 533322..536888 1 NC_003421.2 C2 domain protein 536888 mug190 2539477 mug190 Schizosaccharomyces pombe 972h- C2 domain protein NP_587862.1 533322 D 284812 CDS SPCP31B10.07 19075363 2539544 537326..539854 1 NC_003421.2 translation elongation factor 2 (EF-2) Eft2,B 539854 eft202 2539544 eft202 Schizosaccharomyces pombe 972h- translation elongation factor 2 (EF-2) Eft2,B NP_587863.1 537326 D 284812 CDS SPCP31B10.08c 19075364 2539518 complement(join(540259..540376,540567..540775)) 1 NC_003421.2 60S ribosomal protein L35a 540775 rpl35a 2539518 rpl35a Schizosaccharomyces pombe 972h- 60S ribosomal protein L35a NP_587864.1 540259 R 284812 CDS SPCC962.01 19075365 2539288 join(541275..541388,541569..545744) 1 NC_003421.2 C2 domain protein 545744 2539288 SPCC962.01 Schizosaccharomyces pombe 972h- C2 domain protein NP_587865.1 541275 D 284812 CDS SPCC962.02c 162312092 2538875 complement(join(546108..548972,549020..549148)) 1 NC_003421.2 survivin, Bir1 549148 bir1 2538875 bir1 Schizosaccharomyces pombe 972h- survivin, Bir1 NP_587866.3 546108 R 284812 CDS SPCC962.03c 19075368 2539426 complement(550473..552101) 1 NC_003421.2 karyopherin Cut15 552101 cut15 2539426 cut15 Schizosaccharomyces pombe 972h- karyopherin Cut15 NP_587868.1 550473 R 284812 CDS SPCC962.04 19075369 2539588 join(553185..553565,553648..553704) 1 NC_003421.2 40S ribosomal protein S12 553704 rps1201 2539588 rps1201 Schizosaccharomyces pombe 972h- 40S ribosomal protein S12 NP_587869.1 553185 D 284812 CDS SPCC962.05 295442756 2539485 join(554521..554744,554865..556200) 1 NC_003421.2 asteroid homolog, XP-G family protein 556200 ast1 2539485 ast1 Schizosaccharomyces pombe 972h- asteroid homolog, XP-G family protein NP_587870.2 554521 D 284812 CDS SPCC962.06c 19075371 2538832 complement(join(556396..558128,558175..558205)) 1 NC_003421.2 zinc finger protein Bpb1 558205 bpb1 2538832 bpb1 Schizosaccharomyces pombe 972h- zinc finger protein Bpb1 NP_587871.1 556396 R 284812 CDS SPCC1672.01 162312094 2538785 join(560067..560098,560215..560341,560516..561277) 1 NC_003421.2 histidinol-phosphatase (predicted) 561277 2538785 SPCC1672.01 Schizosaccharomyces pombe 972h- histidinol-phosphatase (predicted) NP_587872.3 560067 D 284812 CDS SPCC1672.02c 19075373 2539285 complement(562353..563117) 1 NC_003421.2 switch-activating protein Sap1 563117 sap1 2539285 sap1 Schizosaccharomyces pombe 972h- switch-activating protein Sap1 NP_587873.1 562353 R 284812 CDS SPCC1672.03c 19075374 2539231 complement(565891..567474) 1 NC_003421.2 guanine deaminase (predicted) 567474 2539231 SPCC1672.03c Schizosaccharomyces pombe 972h- guanine deaminase (predicted) NP_587874.1 565891 R 284812 CDS SPCC1672.04c 19075375 2538939 complement(join(568700..568953,569021..569072)) 1 NC_003421.2 mitochondrial copper chaperone (predicted) 569072 2538939 SPCC1672.04c Schizosaccharomyces pombe 972h- mitochondrial copper chaperone (predicted) NP_587875.1 568700 R 284812 CDS SPCC1672.05c 19075376 2539269 complement(570243..571448) 1 NC_003421.2 cytoplasmic tyrosine-tRNA ligase Yrs1 (predicted) 571448 yrs1 2539269 yrs1 Schizosaccharomyces pombe 972h- cytoplasmic tyrosine-tRNA ligase Yrs1 (predicted) NP_587876.1 570243 R 284812 CDS SPCC1672.06c 19075377 2539244 complement(571710..574472) 1 NC_003421.2 inositol hexakisphosphate kinase/inositol pyrophosphate synthase (predicted) 574472 asp1 2539244 asp1 Schizosaccharomyces pombe 972h- inositol hexakisphosphate kinase/inositol pyrophosphate synthase (predicted) NP_587877.1 571710 R 284812 CDS SPCC1672.07 19075378 2539299 join(575537..575612,575672..578304) 1 NC_003421.2 U3 snoRNP-associated protein Utp21 (predicted) 578304 2539299 SPCC1672.07 Schizosaccharomyces pombe 972h- U3 snoRNP-associated protein Utp21 (predicted) NP_587878.1 575537 D 284812 CDS SPCC1672.08c 19075379 2539236 complement(579456..580313) 1 NC_003421.2 transcription factor TFIIE beta subunit Tfa2 580313 tfa2 2539236 tfa2 Schizosaccharomyces pombe 972h- transcription factor TFIIE beta subunit Tfa2 NP_587879.1 579456 R 284812 CDS SPCC1672.09 19075380 2539344 join(580593..580627,580666..581122,581239..581626,581672..582195) 1 NC_003421.2 triglyceride lipase-cholesterol esterase (predicted) 582195 2539344 SPCC1672.09 Schizosaccharomyces pombe 972h- triglyceride lipase-cholesterol esterase (predicted) NP_587880.1 580593 D 284812 CDS SPCC1672.10 19075381 2539214 join(584135..584219,584292..584397,584486..585587) 1 NC_003421.2 kinetochore protein Mis16 585587 mis16 2539214 mis16 Schizosaccharomyces pombe 972h- kinetochore protein Mis16 NP_587881.1 584135 D 284812 CDS SPCC1672.11c 19075382 2538749 complement(585906..589853) 1 NC_003421.2 P-type ATPase (predicted) 589853 2538749 SPCC1672.11c Schizosaccharomyces pombe 972h- P-type ATPase (predicted) NP_587882.1 585906 R 284812 CDS SPCC1672.12c 19075383 2538767 complement(join(590326..590457,590566..590951,590997..591067,591183..591258,591322..591482,591522..591575,591623..591654)) 1 NC_003421.2 DUF410 family protein 591654 2538767 SPCC1672.12c Schizosaccharomyces pombe 972h- DUF410 family protein NP_587883.1 590326 R 284812 CDS SPCC1183.01 19075384 2538937 join(591852..591884,591925..592086,592134..592253,592353..592791,592832..594435) 1 NC_003421.2 exocyst complex subunit Sec15 (predicted) 594435 sec15 2538937 sec15 Schizosaccharomyces pombe 972h- exocyst complex subunit Sec15 (predicted) NP_587884.1 591852 D 284812 CDS SPCC1183.02 19075385 2539015 join(595060..595212,595493..596002) 1 NC_003421.2 glutathione S-transferase (predicted) 596002 2539015 SPCC1183.02 Schizosaccharomyces pombe 972h- glutathione S-transferase (predicted) NP_587885.1 595060 D 284812 CDS SPCC1183.03c 19075386 2539143 complement(join(596368..596512,596667..596761,596842..597078)) 1 NC_003421.2 frataxin homolog 597078 2539143 SPCC1183.03c Schizosaccharomyces pombe 972h- frataxin homolog NP_587886.1 596368 R 284812 CDS SPCC1183.04c 19075387 2539021 complement(join(597614..599046,599096..599237)) 1 NC_003421.2 mitochondrial RNA metabolism pathway protein Pet127 599237 pet127 2539021 pet127 Schizosaccharomyces pombe 972h- mitochondrial RNA metabolism pathway protein Pet127 NP_587887.1 597614 R 284812 CDS SPCC1183.05c 19075388 2539042 complement(join(599310..599379,599654..600061,600101..600209,600247..600378,600416..600679,600728..601885,601940..602161,602227..602326,602367..602429,602558..602803)) 1 NC_003421.2 DNA ligase Lig4 602803 lig4 2539042 lig4 Schizosaccharomyces pombe 972h- DNA ligase Lig4 NP_587888.1 599310 R 284812 CDS SPCC1183.06 19075389 2538855 join(603037..603263,603321..603653,603721..604129) 1 NC_003421.2 uracil DNA N-glycosylase Ung1 604129 ung1 2538855 ung1 Schizosaccharomyces pombe 972h- uracil DNA N-glycosylase Ung1 NP_587889.1 603037 D 284812 CDS SPCC1183.12 295442758 9407039 complement(join(604405..604805,604857..604872)) 1 NC_003421.2 synonym SPNGAF60 is from Solexa transcript data; sporulation specific protein Spo13 604872 spo13 9407039 spo13 Schizosaccharomyces pombe 972h- sporulation specific protein Spo13 XP_002788948.1 604405 R 284812 CDS SPCC1183.07 19075390 2538897 606337..611409 1 NC_003421.2 U3 snoRNP-associated protein Rrp5 611409 2538897 SPCC1183.07 Schizosaccharomyces pombe 972h- U3 snoRNP-associated protein Rrp5 NP_587890.1 606337 D 284812 CDS SPCC1183.08c 19075391 2539222 complement(611900..612550) 1 NC_003421.2 60S ribosomal protein L10a 612550 rpl101 2539222 rpl101 Schizosaccharomyces pombe 972h- 60S ribosomal protein L10a NP_587891.1 611900 R 284812 CDS SPCC1183.09c 19075392 2538844 complement(join(613345..613564,613628..613725)) 1 NC_003421.2 NAS (nontraceable author statement) inferred from other family members; plasma membrane proteolipid Pmp31 613725 pmp31 2538844 pmp31 Schizosaccharomyces pombe 972h- plasma membrane proteolipid Pmp31 NP_587892.1 613345 R 284812 CDS SPCC1183.10 19075393 2539065 join(615605..615743,615913..616158,616208..616480,616522..616563,616613..616689) 1 NC_003421.2 wtf element Wtf10 616689 wtf10 2539065 wtf10 Schizosaccharomyces pombe 972h- wtf element Wtf10 NP_587893.1 615605 D 284812 CDS SPCC1183.11 19075394 2539051 620024..623059 1 NC_003421.2 MS ion channel protein 1 623059 2539051 SPCC1183.11 Schizosaccharomyces pombe 972h- MS ion channel protein 1 NP_587894.1 620024 D 284812 CDS SPCC31H12.02c 19075395 2538730 complement(623607..624527) 1 NC_003421.2 no evidence for chaperone activity of YCR021C; membrane transporter (predicted) 624527 mug73 2538730 mug73 Schizosaccharomyces pombe 972h- membrane transporter (predicted) NP_587895.1 623607 R 284812 CDS SPCC31H12.03c 19075396 2538932 complement(625488..626225) 1 NC_003421.2 RNA binding protein (predicted) 626225 2538932 SPCC31H12.03c Schizosaccharomyces pombe 972h- RNA binding protein (predicted) NP_587896.1 625488 R 284812 CDS SPCC31H12.04c 19075397 2539010 complement(join(627212..627697,627793..627804)) 1 NC_003421.2 60S ribosomal protein L12.1/L12A 627804 rpl1202 2539010 rpl1202 Schizosaccharomyces pombe 972h- 60S ribosomal protein L12.1/L12A NP_587897.1 627212 R 284812 CDS SPCC31H12.05c 19075398 2539179 complement(join(628996..629094,629146..629847,630218..630342,630401..630443)) 1 NC_003421.2 serine/threonine protein phosphatase Sds21 630443 sds21 2539179 sds21 Schizosaccharomyces pombe 972h- serine/threonine protein phosphatase Sds21 NP_587898.1 628996 R 284812 CDS SPCC31H12.06 19075399 2538723 632248..633654 1 NC_003421.2 sequence orphan 633654 mug111 2538723 mug111 Schizosaccharomyces pombe 972h- sequence orphan NP_587899.1 632248 D 284812 CDS SPCC31H12.07 19075400 2538699 join(634309..634339,634389..634560,634620..634651,634717..636761) 1 NC_003421.2 GTPase activating protein Sec23a 636761 sec231 2538699 sec231 Schizosaccharomyces pombe 972h- GTPase activating protein Sec23a NP_587900.1 634309 D 284812 CDS SPCC31H12.08c 19075401 2538913 complement(637461..639533) 1 NC_003421.2 CCR4-Not complex subunit Ccr4 (predicted) 639533 ccr4 2538913 ccr4 Schizosaccharomyces pombe 972h- CCR4-Not complex subunit Ccr4 (predicted) NP_587901.1 637461 R 284812 CDS SPCC5E4.03c 19075402 2539353 complement(join(640145..640241,640292..640556,640606..640774,640831..641924,642138..642444)) 1 NC_003421.2 SAGA complex subunit/TATA-binding protein associated factor/transcription factor TFIID complex subunit Taf5 642444 taf5 2539353 taf5 Schizosaccharomyces pombe 972h- SAGA complex subunit/TATA-binding protein associated factor/transcription factor TFIID complex subunit Taf5 NP_587902.1 640145 R 284812 CDS SPCC5E4.04 19075403 2539442 join(643812..645901,645941..646242,646284..646578,646617..649416) 1 NC_003421.2 separase 649416 cut1 2539442 cut1 Schizosaccharomyces pombe 972h- separase NP_587903.1 643812 D 284812 CDS SPCC5E4.05c 19075404 2538799 complement(649656..650792) 1 NC_003421.2 mitochondrial serine hydrolase (predicted) 650792 2538799 SPCC5E4.05c Schizosaccharomyces pombe 972h- mitochondrial serine hydrolase (predicted) NP_587904.1 649656 R 284812 CDS SPCC5E4.10c 19075405 2539376 complement(join(651622..651905,651973..651994)) 1 NC_003421.2 sequence orphan 651994 2539376 SPCC5E4.10c Schizosaccharomyces pombe 972h- sequence orphan NP_587905.1 651622 R 284812 CDS SPCC5E4.06 19075406 2539020 join(652783..652893,653000..656311) 1 NC_003421.2 Smc5-6 complex SMC subunit Smc6 656311 smc6 2539020 smc6 Schizosaccharomyces pombe 972h- Smc5-6 complex SMC subunit Smc6 NP_587906.1 652783 D 284812 CDS SPCC5E4.07 19075407 2539548 656625..657071 1 NC_003421.2 60S ribosomal protein L27/L28 657071 rpl2802 2539548 rpl2802 Schizosaccharomyces pombe 972h- 60S ribosomal protein L27/L28 NP_587907.1 656625 D 284812 CDS SPCC16C4.19 162312096 2539536 657704..658258 1 NC_003421.2 RNase MRP 658258 2539536 SPCC16C4.19 Schizosaccharomyces pombe 972h- RNase MRP XP_001713162.1 657704 D 284812 CDS SPCC16C4.01 295442760 2539175 join(658832..659139,659223..659488,659567..659628,659709..660197,660298..660321) 1 NC_003421.2 GO:0005515 and GO:0005816 pers. comm. Osami Niwa; NAS from=GO:0005816|GO:0016021; Sad1 interacting factor 2 660321 sif2 2539175 sif2 Schizosaccharomyces pombe 972h- Sad1 interacting factor 2 NP_587910.3 658832 D 284812 CDS SPCC16C4.20c 19075411 2539226 complement(join(660851..661044,661097..661124,661170..661181)) 1 NC_003421.2 sequence orphan 661181 2539226 SPCC16C4.20c Schizosaccharomyces pombe 972h- sequence orphan NP_587911.1 660851 R 284812 CDS SPCC16C4.02c 19075412 2538903 complement(662342..663988) 1 NC_003421.2 DUF1941 family protein 663988 2538903 SPCC16C4.02c Schizosaccharomyces pombe 972h- DUF1941 family protein NP_587912.1 662342 R 284812 CDS SPCC16C4.03 19075413 2539218 join(664668..665068,665214..665340) 1 NC_003421.2 peptidyl-prolyl cis-trans isomerase Pin1 665340 pin1 2539218 pin1 Schizosaccharomyces pombe 972h- peptidyl-prolyl cis-trans isomerase Pin1 NP_587913.1 664668 D 284812 CDS SPCC16C4.04 19075414 2538989 join(667171..667433,667479..667683,667737..668069) 1 NC_003421.2 sequence orphan 668069 2538989 SPCC16C4.04 Schizosaccharomyces pombe 972h- sequence orphan NP_587914.1 667171 D 284812 CDS SPCC16C4.05 19075415 2538975 join(668586..668656,668718..669063,669118..669306) 1 NC_003421.2 RNase P and RNase MRP subunit (predicted) 669306 2538975 SPCC16C4.05 Schizosaccharomyces pombe 972h- RNase P and RNase MRP subunit (predicted) NP_587915.1 668586 D 284812 CDS SPCC16C4.06c 19075416 2539359 complement(join(669467..669584,669637..670760)) 1 NC_003421.2 tRNA pseudouridine synthase (predicted) 670760 2539359 SPCC16C4.06c Schizosaccharomyces pombe 972h- tRNA pseudouridine synthase (predicted) NP_587916.1 669467 R 284812 CDS SPCC16C4.21 162312098 5802705 671310..671555 1 NC_003421.2 previously predicted protein TR:Q09185, on the 54/1 promoter fragment, but this is 5' of the promoter there is no evidence that it is coding, as it has short length, very low coding potential and no homology; dubious 671555 5802705 SPCC16C4.21 Schizosaccharomyces pombe 972h- dubious XP_001713163.1 671310 D 284812 CDS SPCC16C4.07 19075417 2539358 673476..675161 1 NC_003421.2 RNA-binding protein Scw1 675161 scw1 2539358 scw1 Schizosaccharomyces pombe 972h- RNA-binding protein Scw1 NP_587917.1 673476 D 284812 CDS SPCC16C4.08c 19075418 2538757 complement(join(675765..676068,676133..676290,676360..676750,676854..677026)) 1 NC_003421.2 Shk1 kinase binding protein 15 677026 skb15 2538757 skb15 Schizosaccharomyces pombe 972h- Shk1 kinase binding protein 15 NP_587918.1 675765 R 284812 CDS SPCC16C4.09 19075419 2539180 680362..683562 1 NC_003421.2 RNB-like protein 683562 sts5 2539180 sts5 Schizosaccharomyces pombe 972h- RNB-like protein NP_587919.1 680362 D 284812 CDS SPCC16C4.22 295442762 9406966 join(684828..684947,685049..685192) 1 NC_003421.2 histone-like transcription factor family (CBF/NF-Y) 685192 9406966 SPCC16C4.22 Schizosaccharomyces pombe 972h- histone-like transcription factor family (CBF/NF-Y) XP_002788949.1 684828 D 284812 CDS SPCC16C4.10 19075420 2538922 join(685901..686085,686204..686792) 1 NC_003421.2 Pentose phosphate shunt enzymes are cytoplasmic (Bohringer metabolic pathways); 6-phosphogluconolactonase (predicted) 686792 2538922 SPCC16C4.10 Schizosaccharomyces pombe 972h- 6-phosphogluconolactonase (predicted) NP_587920.1 685901 D 284812 CDS SPCC16C4.11 19075421 2539366 join(687754..687781,687833..688671) 1 NC_003421.2 Pho85/PhoA-like cyclin-dependent kinase Pef1 688671 pef1 2539366 pef1 Schizosaccharomyces pombe 972h- Pho85/PhoA-like cyclin-dependent kinase Pef1 NP_587921.1 687754 D 284812 CDS SPCC16C4.12 19075422 2539279 join(689568..689645,689703..690167) 1 NC_003421.2 NatB N-acetyltransferase complex catalytic subunit Nat3 (predicted) 690167 2539279 SPCC16C4.12 Schizosaccharomyces pombe 972h- NatB N-acetyltransferase complex catalytic subunit Nat3 (predicted) NP_587922.1 689568 D 284812 CDS SPCC16C4.13c 19075423 2539186 complement(691135..691632) 1 NC_003421.2 60S ribosomal protein L12.1/L12A 691632 rpl1201 2539186 rpl1201 Schizosaccharomyces pombe 972h- 60S ribosomal protein L12.1/L12A NP_587923.1 691135 R 284812 CDS SPCC16C4.14c 19075424 2539187 complement(691825..694845) 1 NC_003421.2 transcription factor TFIIIC complex subunit Sfc4 694845 sfc4 2539187 sfc4 Schizosaccharomyces pombe 972h- transcription factor TFIIIC complex subunit Sfc4 NP_587924.1 691825 R 284812 CDS SPCC16C4.15 19075425 2539321 join(696054..696083,696157..697083) 1 NC_003421.2 mitochondrial ribosomal protein subunit L2 697083 rml2 2539321 rml2 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit L2 NP_587925.1 696054 D 284812 CDS SPCC16C4.16c 295442764 2539386 complement(join(697605..697752,697875..698127,698180..698399)) 1 NC_003421.2 conserved fungal protein 698399 2539386 SPCC16C4.16c Schizosaccharomyces pombe 972h- conserved fungal protein NP_587926.2 697605 R 284812 CDS SPCC16C4.17 19075427 2538916 699038..699745 1 NC_003421.2 meiotically upregulated gene Mug123 699745 mug123 2538916 mug123 Schizosaccharomyces pombe 972h- meiotically upregulated gene Mug123 NP_587927.1 699038 D 284812 CDS SPCC16C4.18c 19075428 2539133 complement(join(700165..701391,701550..701681)) 1 NC_003421.2 histone H4-like TAF Taf6, SAGA complex subunit 701681 taf6 2539133 taf6 Schizosaccharomyces pombe 972h- histone H4-like TAF Taf6, SAGA complex subunit NP_587928.1 700165 R 284812 CDS SPCPJ732.01 19075429 2539552 702607..704337 1 NC_003421.2 retromer complex subunit Vps5 704337 vps5 2539552 vps5 Schizosaccharomyces pombe 972h- retromer complex subunit Vps5 NP_587929.1 702607 D 284812 CDS SPCPJ732.02c 19075430 2539441 complement(join(704973..705176,705228..705722,705808..706776)) 1 NC_003421.2 xylulose kinase (predicted) 706776 2539441 SPCPJ732.02c Schizosaccharomyces pombe 972h- xylulose kinase (predicted) NP_587930.1 704973 R 284812 CDS SPCPJ732.03 68017562 2538782 join(708340..708616,708675..708728,708769..708890) 1 NC_003421.2 sequence orphan 708890 meu15 2538782 meu15 Schizosaccharomyces pombe 972h- sequence orphan NP_001018850.1 708340 D 284812 CDS SPCC18B5.01c 162312100 2539195 complement(709415..714007) 1 NC_003421.2 brefeldin A efflux transporter Bfr1 714007 bfr1 2539195 bfr1 Schizosaccharomyces pombe 972h- brefeldin A efflux transporter Bfr1 NP_587932.3 709415 R 284812 CDS SPCC18B5.03 19075433 2539123 722234..724867 1 NC_003421.2 dual specificity protein kinase Wee1 724867 wee1 2539123 wee1 Schizosaccharomyces pombe 972h- dual specificity protein kinase Wee1 NP_587933.1 722234 D 284812 CDS SPCC18B5.04 19075434 2538921 726010..726510 1 NC_003421.2 mitochondrial ribosomal protein subunit S18 726510 rsm18 2538921 rsm18 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit S18 NP_587934.1 726010 D 284812 CDS SPCC18B5.05c 19075435 2539014 complement(727030..728013) 1 NC_003421.2 Other S. pombe and S. cerevisiae phosphomethylpyrimidine kinases have additional TENA/THI domain; phosphomethylpyrimidine kinase (predicted) 728013 2539014 SPCC18B5.05c Schizosaccharomyces pombe 972h- phosphomethylpyrimidine kinase (predicted) NP_587935.1 727030 R 284812 CDS SPCC18B5.06 19075436 2539371 join(729133..729212,729266..729319,729380..729678,729735..729841,729890..730522) 1 NC_003421.2 translation release factor eRF1 family protein 730522 2539371 SPCC18B5.06 Schizosaccharomyces pombe 972h- translation release factor eRF1 family protein NP_587936.1 729133 D 284812 CDS SPCC18B5.07c 19075437 2539348 complement(join(731472..733050,733103..733221)) 1 NC_003421.2 nucleoporin Nup61 733221 nup61 2539348 nup61 Schizosaccharomyces pombe 972h- nucleoporin Nup61 NP_587937.1 731472 R 284812 CDS SPCC18B5.08c 19075438 2539323 complement(733421..736342) 1 NC_003421.2 mitochondrial isoleucine-tRNA ligase (predicted) 736342 2539323 SPCC18B5.08c Schizosaccharomyces pombe 972h- mitochondrial isoleucine-tRNA ligase (predicted) NP_587938.1 733421 R 284812 CDS SPCC18B5.09c 19075439 2539177 complement(737520..737870) 1 NC_003421.2 was previously annotated as dubious; sequence orphan 737870 2539177 SPCC18B5.09c Schizosaccharomyces pombe 972h- sequence orphan NP_587939.1 737520 R 284812 CDS SPCC18B5.10c 19075440 2539362 complement(join(738016..738159,738226..738304,738350..738594,738637..738705,738758..738849,738893..739166,739229..739255)) 1 NC_003421.2 TREX complex subunit Tex1 (predicted) 739255 2539362 SPCC18B5.10c Schizosaccharomyces pombe 972h- TREX complex subunit Tex1 (predicted) NP_587940.1 738016 R 284812 CDS SPCC18B5.11c 19075441 2538959 complement(join(739402..739681,739754..739962,740001..740210,740276..740535,740604..740688,740734..740765,740833..740881,740973..741230)) 1 NC_003421.2 replication checkpoint kinase Cds1 741230 cds1 2538959 cds1 Schizosaccharomyces pombe 972h- replication checkpoint kinase Cds1 NP_587941.1 739402 R 284812 CDS SPCC14G10.01 19075442 2538759 join(741745..741781,741830..742503) 1 NC_003421.2 SPBC18B5.12 was a typo; dephospho-CoA kinase (predicted) 742503 2538759 SPCC14G10.01 Schizosaccharomyces pombe 972h- dephospho-CoA kinase (predicted) NP_587942.1 741745 D 284812 CDS SPCC14G10.02 63054423 2539162 join(743004..743034,743077..747752) 1 NC_003421.2 ribosome biogenesis protein Urb1 747752 2539162 SPCC14G10.02 Schizosaccharomyces pombe 972h- ribosome biogenesis protein Urb1 NP_587943.2 743004 D 284812 CDS SPCC14G10.03c 19075444 2539122 complement(join(748037..748192,748297..748530)) 1 NC_003421.2 proteasome maturation factor Ump1 (predicted) 748530 ump1 2539122 ump1 Schizosaccharomyces pombe 972h- proteasome maturation factor Ump1 (predicted) NP_587944.1 748037 R 284812 CDS SPCC14G10.04 19075445 2539216 join(748812..748906,748990..749049,749160..749212,749479..750764) 1 NC_003421.2 sequence orphan 750764 2539216 SPCC14G10.04 Schizosaccharomyces pombe 972h- sequence orphan NP_587945.1 748812 D 284812 CDS SPCC1020.13c 19075446 2539084 join(752474..752680,752725..753289,753353..754093,754135..754631) 1 NC_003421.2 phospholipase (predicted) 754631 2539084 SPCC1020.13c Schizosaccharomyces pombe 972h- phospholipase (predicted) NP_587946.1 752474 D 284812 CDS SPCC1020.12c 63054424 2538710 join(755257..755405,755469..756186) 1 NC_003421.2 xap-5-like protein 756186 2538710 SPCC1020.12c Schizosaccharomyces pombe 972h- xap-5-like protein NP_587947.2 755257 D 284812 CDS SPCC1020.11c 295442766 2538978 join(757365..757424,757506..757761,757851..757861) 1 NC_003421.2 DUF786 family protein 757861 2538978 SPCC1020.11c Schizosaccharomyces pombe 972h- DUF786 family protein NP_587948.2 757365 D 284812 CDS SPCC1020.10 19075449 2539239 complement(758901..760853) 1 NC_003421.2 serine/threonine protein kinase Oca2 (predicted) 760853 oca2 2539239 oca2 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Oca2 (predicted) NP_587949.1 758901 R 284812 CDS SPCC1020.09 19075450 2539303 complement(766170..767369) 1 NC_003421.2 heterotrimeric G protein beta subunit Gnr1 767369 gnr1 2539303 gnr1 Schizosaccharomyces pombe 972h- heterotrimeric G protein beta subunit Gnr1 NP_587950.1 766170 R 284812 CDS SPCC1020.08 19075451 2539172 complement(767986..770052) 1 NC_003421.2 wybutosine biosynthesis protein Tyw1 770052 2539172 SPCC1020.08 Schizosaccharomyces pombe 972h- wybutosine biosynthesis protein Tyw1 NP_587951.1 767986 R 284812 CDS SPCC1020.07 19075452 2538948 complement(join(770722..771293,771351..771413,771479..771521,771693..771725)) 1 NC_003421.2 haloacid dehalogenase-like hydrolase 771725 2538948 SPCC1020.07 Schizosaccharomyces pombe 972h- haloacid dehalogenase-like hydrolase NP_587952.1 770722 R 284812 CDS SPCC1020.06c 19075453 2538977 773498..774466 1 NC_003421.2 transaldolase (predicted) 774466 tal1 2538977 tal1 Schizosaccharomyces pombe 972h- transaldolase (predicted) NP_587953.1 773498 D 284812 CDS SPCC1020.05 19075454 2538828 complement(775041..776570) 1 NC_003421.2 phosphoprotein phosphatase (predicted) 776570 2538828 SPCC1020.05 Schizosaccharomyces pombe 972h- phosphoprotein phosphatase (predicted) NP_587954.1 775041 R 284812 CDS SPCC1020.14 19075455 2538755 complement(778133..782134) 1 NC_003421.2 retrotransposable element 782134 Tf2-12 2538755 Tf2-12 Schizosaccharomyces pombe 972h- retrotransposable element NP_587955.1 778133 R 284812 CDS SPCC1020.04c 19075456 2539083 join(783101..783375,783594..783747) 1 NC_003421.2 DNA-directed RNA polymerase I, II and III subunit Rpb6 783747 rpb6 2539083 rpb6 Schizosaccharomyces pombe 972h- DNA-directed RNA polymerase I, II and III subunit Rpb6 NP_587956.1 783101 D 284812 CDS SPCC1020.03 19075457 2539150 complement(join(784250..784788,784832..785244,785464..785705)) 1 NC_003421.2 mitochondrial iron ion transporter 785705 2539150 SPCC1020.03 Schizosaccharomyces pombe 972h- mitochondrial iron ion transporter NP_587957.1 784250 R 284812 CDS SPCC1020.02 19075458 2539155 complement(786520..790614) 1 NC_003421.2 S. cerevisiae SPC105 can rescue S. pombe mal3 mutant strains (PMID:15371542); S. Pombe Centromere; kinetochore protein Spc7 790614 spc7 2539155 spc7 Schizosaccharomyces pombe 972h- kinetochore protein Spc7 NP_587958.1 786520 R 284812 CDS SPCC1020.01c 63054425 2539012 793179..796211 1 NC_003421.2 P-type proton ATPase Pma2 796211 pma2 2539012 pma2 Schizosaccharomyces pombe 972h- P-type proton ATPase Pma2 NP_587959.2 793179 D 284812 CDS SPCC1393.02c 19075460 2538890 complement(796749..797969) 1 NC_003421.2 non-specific DNA binding protein Spt2 (predicted) 797969 2538890 SPCC1393.02c Schizosaccharomyces pombe 972h- non-specific DNA binding protein Spt2 (predicted) NP_587960.1 796749 R 284812 CDS SPCC1393.03 19075461 2538892 798282..798743 1 NC_003421.2 40S ribosomal protein S15 (predicted) 798743 rps1501 2538892 rps1501 Schizosaccharomyces pombe 972h- 40S ribosomal protein S15 (predicted) NP_587961.1 798282 D 284812 CDS SPCC1393.04 19075462 2538719 join(799843..799984,800059..800618) 1 NC_003421.2 Sim4 and Mal2 associated (4 and 2 associated) protein 4 800618 fta4 2538719 fta4 Schizosaccharomyces pombe 972h- Sim4 and Mal2 associated (4 and 2 associated) protein 4 NP_587962.1 799843 D 284812 CDS SPCC1393.05 19075463 2538690 join(801197..801227,801264..801339,801379..801427,801467..801516,801572..801986,802032..803311,803362..803409,803447..803557,803600..803881,803932..804018,804060..804501) 1 NC_003421.2 RNA-silencing factor Ers1 804501 ers1 2538690 ers1 Schizosaccharomyces pombe 972h- RNA-silencing factor Ers1 NP_587963.1 801197 D 284812 CDS SPCC1393.06c 295442768 2539247 complement(join(804627..805627,805678..805800,805849..805921,805965..806009)) 1 NC_003421.2 rRNA processing protein Ipi1 806009 2539247 SPCC1393.06c Schizosaccharomyces pombe 972h- rRNA processing protein Ipi1 NP_587964.2 804627 R 284812 CDS SPCC1393.07c 19075465 2538889 complement(join(806262..807577,807634..808855)) 1 NC_003421.2 possibly a glycoprotein; sequence orphan 808855 mug4 2538889 mug4 Schizosaccharomyces pombe 972h- sequence orphan NP_587965.1 806262 R 284812 CDS SPCC1393.08 19075466 2538884 812655..814328 1 NC_003421.2 transcription factor, zf-GATA type (predicted) 814328 2538884 SPCC1393.08 Schizosaccharomyces pombe 972h- transcription factor, zf-GATA type (predicted) NP_587966.1 812655 D 284812 CDS SPCC1393.09c 19075467 2538880 complement(join(815442..815819,815970..816106,816179..816247,816394..816457)) 1 NC_003421.2 RWD domain 816457 2538880 SPCC1393.09c Schizosaccharomyces pombe 972h- RWD domain NP_587967.1 815442 R 284812 CDS SPCC1393.10 19075468 2538731 818459..819328 1 NC_003421.2 copper transporter complex subunit Ctr4 819328 ctr4 2538731 ctr4 Schizosaccharomyces pombe 972h- copper transporter complex subunit Ctr4 NP_587968.1 818459 D 284812 CDS SPCC1393.14 295442770 9406926 complement(819849..820157) 1 NC_003421.2 nuclear telomere cap complex subunit Ten1 820157 ten1 9406926 ten1 Schizosaccharomyces pombe 972h- nuclear telomere cap complex subunit Ten1 XP_002788950.1 819849 R 284812 CDS SPCC1393.11 19075469 2538991 821644..822237 1 NC_003421.2 mitochondrial ribosomal protein subunit L20 822237 2538991 SPCC1393.11 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit L20 NP_587969.1 821644 D 284812 CDS SPCC1393.12 19075470 2538891 823679..824005 1 NC_003421.2 sequence orphan 824005 2538891 SPCC1393.12 Schizosaccharomyces pombe 972h- sequence orphan NP_587970.1 823679 D 284812 CDS SPCC1393.13 19075471 2538830 join(825105..825135,825243..826540) 1 NC_003421.2 DUF89 family protein 826540 2538830 SPCC1393.13 Schizosaccharomyces pombe 972h- DUF89 family protein NP_587971.1 825105 D 284812 CDS SPCC2H8.02 19075472 2538980 828546..830297 1 NC_003421.2 inorganic phosphate transporter (predicted) 830297 2538980 SPCC2H8.02 Schizosaccharomyces pombe 972h- inorganic phosphate transporter (predicted) NP_587972.1 828546 D 284812 CDS SPCC2H8.04 19075474 2539320 join(831178..831384,831449..832042) 1 NC_003421.2 sequence orphan 832042 2539320 SPCC2H8.04 Schizosaccharomyces pombe 972h- sequence orphan NP_587974.1 831178 D 284812 CDS SPCC2H8.05c 63054426 2539210 complement(832347..833000) 1 NC_003421.2 sequence orphan 833000 2539210 SPCC2H8.05c Schizosaccharomyces pombe 972h- sequence orphan NP_587975.2 832347 R 284812 CDS SPCC63.02c 19075476 2539415 complement(833966..835660) 1 NC_003421.2 alpha-amylase homolog Aah3 835660 aah3 2539415 aah3 Schizosaccharomyces pombe 972h- alpha-amylase homolog Aah3 NP_587976.1 833966 R 284812 CDS SPCC63.03 19075477 2539584 join(837605..837658,837720..838933,838984..839404,839462..839701) 1 NC_003421.2 DNAJ domain protein, DNAJC11 family 839701 2539584 SPCC63.03 Schizosaccharomyces pombe 972h- DNAJ domain protein, DNAJC11 family NP_587977.1 837605 D 284812 CDS SPCC63.04 19075478 2539506 839962..844071 1 NC_003421.2 alpha-1,4-glucan synthase Mok14 844071 mok14 2539506 mok14 Schizosaccharomyces pombe 972h- alpha-1,4-glucan synthase Mok14 NP_587978.1 839962 D 284812 CDS SPCC63.05 19075479 2539161 844446..845417 1 NC_003421.2 TAP42 family protein (predicted) 845417 2539161 SPCC63.05 Schizosaccharomyces pombe 972h- TAP42 family protein (predicted) NP_587979.1 844446 D 284812 CDS SPCC63.06 19075480 2538796 845924..846919 1 NC_003421.2 human WDR89 family WD repeat protein 846919 2538796 SPCC63.06 Schizosaccharomyces pombe 972h- human WDR89 family WD repeat protein NP_587980.1 845924 D 284812 CDS SPCC63.07 19075481 2539571 join(848634..848869,848931..849231,849328..849432,849486..849629) 1 NC_003421.2 tRNA guanylyltransferase (predicted) 849629 2539571 SPCC63.07 Schizosaccharomyces pombe 972h- tRNA guanylyltransferase (predicted) NP_587981.1 848634 D 284812 CDS SPCC63.08c 19075482 2539461 complement(join(850050..852440,852503..852604)) 1 NC_003421.2 serine/threonine protein kinase Ppk36 852604 ppk36 2539461 ppk36 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Ppk36 NP_587982.1 850050 R 284812 CDS SPCC63.10c 295442772 2538793 complement(join(854651..855926,855984..856213)) 1 NC_003421.2 dolichol kinase (predicted) 856213 2538793 SPCC63.10c Schizosaccharomyces pombe 972h- dolichol kinase (predicted) NP_587983.2 854651 R 284812 CDS SPCC63.11 19075484 2538728 857153..859141 1 NC_003421.2 U5 snRNP-associated protein Prp28 (predicted) 859141 prp28 2538728 prp28 Schizosaccharomyces pombe 972h- U5 snRNP-associated protein Prp28 (predicted) NP_587984.1 857153 D 284812 CDS SPCC63.12c 19075485 2539401 complement(859779..860393) 1 NC_003421.2 20S proteasome component beta 3, Pup3 (predicted) 860393 pup3 2539401 pup3 Schizosaccharomyces pombe 972h- 20S proteasome component beta 3, Pup3 (predicted) NP_587985.1 859779 R 284812 CDS SPCC63.13 19075486 2539451 861566..862192 1 NC_003421.2 YMR161W same domain organization and single predicted tmm helix; DNAJ domain protein 862192 2539451 SPCC63.13 Schizosaccharomyces pombe 972h- DNAJ domain protein NP_587986.1 861566 D 284812 CDS SPCC63.14 19075487 2538827 862712..866266 1 NC_003421.2 conserved fungal protein 866266 2538827 SPCC63.14 Schizosaccharomyces pombe 972h- conserved fungal protein NP_587987.1 862712 D 284812 CDS SPCC16A11.01 19075488 2539224 867996..868982 1 NC_003421.2 plasma membrane protein involved in inositol lipid-mediated signaling 868982 2539224 SPCC16A11.01 Schizosaccharomyces pombe 972h- plasma membrane protein involved in inositol lipid-mediated signaling NP_587988.1 867996 D 284812 CDS SPCC16A11.02 63054427 2539337 join(869701..869726,869764..872071) 1 NC_003421.2 U3 snoRNP-associated protein Utp13 (predicted) 872071 utp13 2539337 utp13 Schizosaccharomyces pombe 972h- U3 snoRNP-associated protein Utp13 (predicted) NP_587989.2 869701 D 284812 CDS SPCC16A11.03c 19075490 2539233 complement(join(872348..873641,873950..874056)) 1 NC_003421.2 DUF2009 protein 874056 2539233 SPCC16A11.03c Schizosaccharomyces pombe 972h- DUF2009 protein NP_587990.1 872348 R 284812 CDS SPCC16A11.04 19075491 2538748 874608..877640 1 NC_003421.2 sorting nexin Snx12 (predicted) 877640 snx12 2538748 snx12 Schizosaccharomyces pombe 972h- sorting nexin Snx12 (predicted) NP_587991.1 874608 D 284812 CDS SPCC16A11.05c 19075492 2539369 complement(join(877939..878154,878208..878318,878402..878442,878524..878549,878600..878634)) 1 NC_003421.2 CARE ambiguous gene name; U4/U6 x U5 tri-snRNP complex subunit Dim1 878634 dim1 2539369 dim1 Schizosaccharomyces pombe 972h- U4/U6 x U5 tri-snRNP complex subunit Dim1 NP_587992.1 877939 R 284812 CDS SPCC16A11.06c 19075493 2539152 complement(879647..881167) 1 NC_003421.2 pig-B 881167 gpi10 2539152 gpi10 Schizosaccharomyces pombe 972h- pig-B NP_587993.1 879647 R 284812 CDS SPCC16A11.07 19075494 2539368 881166..881660 1 NC_003421.2 May use alternative initiation Met at codon 19; ubiquinone binding protein Coq10 881660 coq10 2539368 coq10 Schizosaccharomyces pombe 972h- ubiquinone binding protein Coq10 NP_587994.1 881166 D 284812 CDS SPCC16A11.08 19075495 2539317 join(883392..883535,883594..883702,883822..885173) 1 NC_003421.2 sorting nexin Atg20 885173 atg20 2539317 atg20 Schizosaccharomyces pombe 972h- sorting nexin Atg20 NP_587995.1 883392 D 284812 CDS SPCC16A11.09c 19075496 2538784 complement(886101..886733) 1 NC_003421.2 TIM23 translocase complex subunit Tim23 886733 tim23 2538784 tim23 Schizosaccharomyces pombe 972h- TIM23 translocase complex subunit Tim23 NP_587996.1 886101 R 284812 CDS SPCC16A11.10c 19075497 2538772 complement(join(887406..887555,887642..887733,888240..888387)) 1 NC_003421.2 cytochrome b5 (predicted) 888387 oca8 2538772 oca8 Schizosaccharomyces pombe 972h- cytochrome b5 (predicted) NP_587997.1 887406 R 284812 CDS SPCC16A11.11 19075498 2538813 888858..889205 1 NC_003421.2 mitochondrial ribosomal protein subunit L31 889205 mrpl31 2538813 mrpl31 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit L31 NP_587998.1 888858 D 284812 CDS SPCC16A11.12c 19075499 2539228 complement(join(889437..891666,891892..892211)) 1 NC_003421.2 ubiquitin C-terminal hydrolase Ubp1 892211 ubp1 2539228 ubp1 Schizosaccharomyces pombe 972h- ubiquitin C-terminal hydrolase Ubp1 NP_587999.1 889437 R 284812 CDS SPCC16A11.13 19075500 2539055 892720..893514 1 NC_003421.2 U1 snRNP-associated protein Usp106 893514 usp106 2539055 usp106 Schizosaccharomyces pombe 972h- U1 snRNP-associated protein Usp106 NP_588000.1 892720 D 284812 CDS SPCC16A11.14 19075501 2539144 894171..895427 1 NC_003421.2 RSC complex subunit Sfh1 895427 sfh1 2539144 sfh1 Schizosaccharomyces pombe 972h- RSC complex subunit Sfh1 NP_588001.1 894171 D 284812 CDS SPCC16A11.15c 19075502 2538968 complement(896182..896535) 1 NC_003421.2 sequence orphan 896535 2538968 SPCC16A11.15c Schizosaccharomyces pombe 972h- sequence orphan NP_588002.1 896182 R 284812 CDS SPCC16A11.16c 19075503 2539182 complement(join(897682..898632,898743..898827,899025..899155)) 1 NC_003421.2 adhesion regulating molecule protein homolog 899155 2539182 SPCC16A11.16c Schizosaccharomyces pombe 972h- adhesion regulating molecule protein homolog NP_588003.1 897682 R 284812 CDS SPCC16A11.17 63054428 2539164 900402..903137 1 NC_003421.2 possibly spliced at C-term; MCM complex subunit Cdc21 903137 cdc21 2539164 cdc21 Schizosaccharomyces pombe 972h- MCM complex subunit Cdc21 NP_588004.2 900402 D 284812 CDS SPCC24B10.02c 19075505 2539251 complement(903550..904899) 1 NC_003421.2 NAD/NADH kinase (predicted) 904899 2539251 SPCC24B10.02c Schizosaccharomyces pombe 972h- NAD/NADH kinase (predicted) NP_588005.1 903550 R 284812 CDS SPCC24B10.03 19075506 2538934 join(906321..906464,906652..906894) 1 NC_003421.2 sequence orphan 906894 2538934 SPCC24B10.03 Schizosaccharomyces pombe 972h- sequence orphan NP_588006.1 906321 D 284812 CDS SPCC24B10.04 19075507 2539356 907686..908285 1 NC_003421.2 sequence orphan 908285 2539356 SPCC24B10.04 Schizosaccharomyces pombe 972h- sequence orphan NP_588007.1 907686 D 284812 CDS SPCC24B10.05 19075508 2539125 join(908977..909054,909289..909465) 1 NC_003421.2 may be additional small exon; Tim9-Tim10 complex subunit Tim9 909465 tim9 2539125 tim9 Schizosaccharomyces pombe 972h- Tim9-Tim10 complex subunit Tim9 NP_588008.1 908977 D 284812 CDS SPCC24B10.06 19075509 2539230 join(910510..910633,910848..910998,911064..911259) 1 NC_003421.2 sequence orphan 911259 2539230 SPCC24B10.06 Schizosaccharomyces pombe 972h- sequence orphan NP_588009.1 910510 D 284812 CDS SPCC24B10.07 19075510 2539206 join(913117..913138,913210..914897) 1 NC_003421.2 S6 kinase family protein kinase Gad8 914897 gad8 2539206 gad8 Schizosaccharomyces pombe 972h- S6 kinase family protein kinase Gad8 NP_588010.1 913117 D 284812 CDS SPCC24B10.08c 19075511 2539174 complement(915382..916695) 1 NC_003421.2 SAGA complex subunit Ada2 916695 ada2 2539174 ada2 Schizosaccharomyces pombe 972h- SAGA complex subunit Ada2 NP_588011.1 915382 R 284812 CDS SPCC24B10.09 19075512 2539331 join(917864..917866,917931..918326) 1 NC_003421.2 40S ribosomal protein S17 918326 rps1702 2539331 rps1702 Schizosaccharomyces pombe 972h- 40S ribosomal protein S17 NP_588012.1 917864 D 284812 CDS SPCC24B10.10c 19075513 2539116 complement(918772..919839) 1 NC_003421.2 mitochondrial outer membrane ATPase Msp1 (predicted) 919839 2539116 SPCC24B10.10c Schizosaccharomyces pombe 972h- mitochondrial outer membrane ATPase Msp1 (predicted) NP_588013.1 918772 R 284812 CDS SPCC24B10.11c 19075514 2539006 complement(join(920455..920686,920736..920886,920943..921161,921215..921221)) 1 NC_003421.2 THO complex subunit 7 (predicted) 921221 2539006 SPCC24B10.11c Schizosaccharomyces pombe 972h- THO complex subunit 7 (predicted) NP_588014.1 920455 R 284812 CDS SPCC24B10.12 19075515 2539388 921422..921946 1 NC_003421.2 GO component terms are inferres from TAS in Q8IWR7_HUMAN; CGI121 family protein 921946 2539388 SPCC24B10.12 Schizosaccharomyces pombe 972h- CGI121 family protein NP_588015.1 921422 D 284812 CDS SPCC24B10.13 19075516 2539237 923069..923491 1 NC_003421.2 Shk1 kinase binding protein 5 923491 skb5 2539237 skb5 Schizosaccharomyces pombe 972h- Shk1 kinase binding protein 5 NP_588016.1 923069 D 284812 CDS SPCC24B10.14c 19075517 2539197 complement(join(924212..924667,924781..924936)) 1 NC_003421.2 xrcc4 like factor, cernunnon 924936 xlf1 2539197 xlf1 Schizosaccharomyces pombe 972h- xrcc4 like factor, cernunnon NP_588017.1 924212 R 284812 CDS SPCC24B10.15 19075518 2538887 927999..929387 1 NC_003421.2 PINc domain 929387 2538887 SPCC24B10.15 Schizosaccharomyces pombe 972h- PINc domain NP_588018.1 927999 D 284812 CDS SPCC24B10.16c 19075519 2539365 complement(929755..930087) 1 NC_003421.2 sequence orphan 930087 2539365 SPCC24B10.16c Schizosaccharomyces pombe 972h- sequence orphan NP_588019.1 929755 R 284812 CDS SPCC24B10.17 19075520 2539350 join(930591..930684,930751..930947,931078..931386) 1 NC_003421.2 COPII-coated vesicle component Emp24 (predicted) 931386 emp24 2539350 emp24 Schizosaccharomyces pombe 972h- COPII-coated vesicle component Emp24 (predicted) NP_588020.1 930591 D 284812 CDS SPCC24B10.18 19075521 2539098 join(932022..932112,932395..932450,932504..932638) 1 NC_003421.2 human Leydig cell tumor 10 kDa protein homolog 932638 2539098 SPCC24B10.18 Schizosaccharomyces pombe 972h- human Leydig cell tumor 10 kDa protein homolog NP_588021.1 932022 D 284812 CDS SPCC24B10.19c 19075522 2538907 complement(join(932963..934284,934401..934446)) 1 NC_003421.2 sequence orphan 934446 2538907 SPCC24B10.19c Schizosaccharomyces pombe 972h- sequence orphan NP_588022.1 932963 R 284812 CDS SPCC24B10.20 19075523 2538958 937803..938567 1 NC_003421.2 short chain dehydrogenase (predicted) 938567 2538958 SPCC24B10.20 Schizosaccharomyces pombe 972h- short chain dehydrogenase (predicted) NP_588023.1 937803 D 284812 CDS SPCC24B10.21 19075524 2538729 939945..940694 1 NC_003421.2 triosephosphate isomerase 940694 tpi1 2538729 tpi1 Schizosaccharomyces pombe 972h- triosephosphate isomerase NP_588024.1 939945 D 284812 CDS SPCC24B10.22 63054429 2539099 941416..944472 1 NC_003421.2 mip1 is primary name for SPAC57A7.11; mitochondrial DNA polymerase 944472 pog1 2539099 pog1 Schizosaccharomyces pombe 972h- mitochondrial DNA polymerase NP_588025.2 941416 D 284812 CDS SPCPB16A4.02c 19075526 2538973 complement(join(944872..945632,945671..945713,945797..945859,946141..946260)) 1 NC_003421.2 conserved fungal protein 946260 2538973 SPCPB16A4.02c Schizosaccharomyces pombe 972h- conserved fungal protein NP_588026.1 944872 R 284812 CDS SPCPB16A4.03c 19075527 2539569 complement(947832..949589) 1 NC_003421.2 IMP cyclohydrolase/phosphoribosylaminoimidazolecarboxamideform y ltransferase 949589 ade10 2539569 ade10 Schizosaccharomyces pombe 972h- IMP cyclohydrolase/phosphoribosylaminoimidazolecarboxamideform y ltransferase NP_588027.1 947832 R 284812 CDS SPCPB16A4.04c 19075528 2539574 complement(join(951193..951841,951975..952033,952091..952204)) 1 NC_003421.2 tRNA (guanine-N7-)-methyltransferase catalytic subunit Trm8 (predicted) 952204 trm8 2539574 trm8 Schizosaccharomyces pombe 972h- tRNA (guanine-N7-)-methyltransferase catalytic subunit Trm8 (predicted) NP_588028.1 951193 R 284812 CDS SPCPB16A4.05c 19075529 2538808 complement(952676..953536) 1 NC_003421.2 urease accessory protein UREG (predicted) 953536 2538808 SPCPB16A4.05c Schizosaccharomyces pombe 972h- urease accessory protein UREG (predicted) NP_588029.1 952676 R 284812 CDS SPCPB16A4.06c 19075530 2539492 complement(956424..956804) 1 NC_003421.2 compositionally biased region; previously annotated as dubious, but has localization signal; sequence orphan 956804 2539492 SPCPB16A4.06c Schizosaccharomyces pombe 972h- sequence orphan NP_588030.1 956424 R 284812 CDS SPCC1742.01 162312102 2539287 complement(959281..963972) 1 NC_003421.2 large repeated threonine-rich region; sequence orphan 963972 2539287 SPCC1742.01 Schizosaccharomyces pombe 972h- sequence orphan NP_588031.3 959281 R 284812 CDS SPCC1795.12c 19075532 2539124 972824..973162 1 NC_003421.2 previously annotated as dubious, but has localization signal; sequence orphan 973162 2539124 SPCC1795.12c Schizosaccharomyces pombe 972h- sequence orphan NP_588032.1 972824 D 284812 CDS SPCC1795.11 19075533 2538689 complement(974761..976671) 1 NC_003421.2 suppressor of uncontrolled mitosis; Multicopy suppressor of Overexpressed Cyr1; ATP-dependent RNA helicase Sum3 976671 sum3 2538689 sum3 Schizosaccharomyces pombe 972h- ATP-dependent RNA helicase Sum3 NP_588033.1 974761 R 284812 CDS SPCC1795.10c 19075534 2538756 977441..978124 1 NC_003421.2 Sed5 Vesicle Protein Svp26 (predicted) 978124 2538756 SPCC1795.10c Schizosaccharomyces pombe 972h- Sed5 Vesicle Protein Svp26 (predicted) NP_588034.1 977441 D 284812 CDS SPCC1795.09 19075535 2538927 complement(978613..980178) 1 NC_003421.2 aspartic protease Yps1 980178 yps1 2538927 yps1 Schizosaccharomyces pombe 972h- aspartic protease Yps1 NP_588035.1 978613 R 284812 CDS SPCC1795.08c 19075536 2539114 join(981120..981128,981211..981491,981576..984243) 1 NC_003421.2 NuA4 histone acetyltransferase complex subunit Vid21 984243 vid21 2539114 vid21 Schizosaccharomyces pombe 972h- NuA4 histone acetyltransferase complex subunit Vid21 NP_588036.1 981120 D 284812 CDS SPCC1795.07 19075537 2538943 complement(join(984466..984640,984711..984991)) 1 NC_003421.2 mitochondrial ribosomal protein subunit S37 (predicted) 984991 2538943 SPCC1795.07 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit S37 (predicted) NP_588037.1 984466 R 284812 CDS SPCC1795.06 19075538 2539392 complement(986079..986684) 1 NC_003421.2 P-factor pheromone Map2 986684 map2 2539392 map2 Schizosaccharomyces pombe 972h- P-factor pheromone Map2 NP_588038.1 986079 R 284812 CDS SPCC1795.05c 19075539 2538942 988847..989422 1 NC_003421.2 uridylate kinase 989422 2538942 SPCC1795.05c Schizosaccharomyces pombe 972h- uridylate kinase NP_588039.1 988847 D 284812 CDS SPCC1795.04c 19075540 2539378 join(990713..990715,990755..990852,990902..991384,991451..991628) 1 NC_003421.2 20S proteasome component alpha 7, Pre10 (predicted) 991628 pre10 2539378 pre10 Schizosaccharomyces pombe 972h- 20S proteasome component alpha 7, Pre10 (predicted) NP_588040.1 990713 D 284812 CDS SPCC1795.03 19075541 2539196 complement(join(993568..994533,994709..994804)) 1 NC_003421.2 UDP-galactose transporter Gms1 994804 gms1 2539196 gms1 Schizosaccharomyces pombe 972h- UDP-galactose transporter Gms1 NP_588041.1 993568 R 284812 CDS SPCC1795.02c 19075542 2539393 join(995522..995886,995943..996816) 1 NC_003421.2 CaCA proton/calcium exchanger 996816 vcx1 2539393 vcx1 Schizosaccharomyces pombe 972h- CaCA proton/calcium exchanger NP_588042.1 995522 D 284812 CDS SPCC1795.01c 63054432 2539219 997688..998620 1 NC_003421.2 mitotic spindle checkpoint protein Mad3 998620 mad3 2539219 mad3 Schizosaccharomyces pombe 972h- mitotic spindle checkpoint protein Mad3 NP_588043.2 997688 D 284812 CDS SPCC895.03c 19075544 2539596 complement(998942..1000168) 1 NC_003421.2 SUA5/yciO/yrdC family protein Sua5 (predicted) 1000168 2539596 SPCC895.03c Schizosaccharomyces pombe 972h- SUA5/yciO/yrdC family protein Sua5 (predicted) NP_588044.1 998942 R 284812 CDS SPCC895.04c 19075545 2538886 complement(join(1001020..1001624,1001713..1001947,1002145..1002264)) 1 NC_003421.2 SNARE Ufe1 1002264 ufe1 2538886 ufe1 Schizosaccharomyces pombe 972h- SNARE Ufe1 NP_588045.1 1001020 R 284812 CDS SPCC895.05 19075546 2539487 1003130..1007515 1 NC_003421.2 formin For3 1007515 for3 2539487 for3 Schizosaccharomyces pombe 972h- formin For3 NP_588046.1 1003130 D 284812 CDS SPCC895.06 19075547 2538986 join(1008473..1008589,1008669..1010498,1010541..1010876) 1 NC_003421.2 elongator complex subunit Elp2 (predicted) 1010876 2538986 SPCC895.06 Schizosaccharomyces pombe 972h- elongator complex subunit Elp2 (predicted) NP_588047.1 1008473 D 284812 CDS SPCC895.07 19075548 2539497 1011762..1014191 1 NC_003421.2 Mad2-dependent spindle checkpoint component Alp14 1014191 alp14 2539497 alp14 Schizosaccharomyces pombe 972h- Mad2-dependent spindle checkpoint component Alp14 NP_588048.1 1011762 D 284812 CDS SPCC895.08c 19075549 2539597 complement(1014648..1016120) 1 NC_003421.2 conserved fungal protein 1016120 2539597 SPCC895.08c Schizosaccharomyces pombe 972h- conserved fungal protein NP_588049.1 1014648 R 284812 CDS SPCC895.09c 19075550 2539263 complement(join(1017094..1018002,1018046..1020066,1020108..1020708,1020768..1020956,1021028..1021291)) 1 NC_003421.2 ATP-dependent RNA helicase Ucp1 (predicted) 1021291 ucp12 2539263 ucp12 Schizosaccharomyces pombe 972h- ATP-dependent RNA helicase Ucp1 (predicted) NP_588050.1 1017094 R 284812 CDS SPCC825.01 19075551 2539509 1022681..1025149 1 NC_003421.2 ribosome biogenesis ATPase, Arb family ABCF1-like (predicted) 1025149 2539509 SPCC825.01 Schizosaccharomyces pombe 972h- ribosome biogenesis ATPase, Arb family ABCF1-like (predicted) NP_588051.1 1022681 D 284812 CDS SPCC825.02 19075552 2538725 join(1025552..1025651,1025701..1025784,1025841..1025879,1025918..1026574,1026702..1026839,1026892..1027111,1027156..1027438) 1 NC_003421.2 glucosidase II Gtb1 (predicted) 1027438 2538725 SPCC825.02 Schizosaccharomyces pombe 972h- glucosidase II Gtb1 (predicted) NP_588052.1 1025552 D 284812 CDS SPCC825.03c 19075553 2539377 complement(1028292..1029146) 1 NC_003421.2 SNARE Psy1 1029146 psy1 2539377 psy1 Schizosaccharomyces pombe 972h- SNARE Psy1 NP_588053.1 1028292 R 284812 CDS SPCC825.04c 19075554 2539448 complement(1030256..1030870) 1 NC_003421.2 histone N-acetyltransferase (predicted) 1030870 2539448 SPCC825.04c Schizosaccharomyces pombe 972h- histone N-acetyltransferase (predicted) NP_588054.1 1030256 R 284812 CDS SPCC825.05c 19075555 2539459 complement(join(1031434..1031901,1031940..1032269,1032329..1032418,1032472..1032489)) 1 NC_003421.2 splicing coactivator SRRM1 (predicted) 1032489 2539459 SPCC825.05c Schizosaccharomyces pombe 972h- splicing coactivator SRRM1 (predicted) NP_588055.1 1031434 R 284812 CDS SPCC1259.01c 162312104 3361064 complement(join(1032939..1033373,1033433..1033456)) 1 NC_003421.2 40S ribosomal protein S18 (predicted) 1033456 rps1802 3361064 rps1802 Schizosaccharomyces pombe 972h- 40S ribosomal protein S18 (predicted) NP_588057.2 1032939 R 284812 CDS SPCC1259.02c 19075558 2539040 complement(1034412..1036880) 1 NC_003421.2 peptidase (predicted) 1036880 2539040 SPCC1259.02c Schizosaccharomyces pombe 972h- peptidase (predicted) NP_588058.1 1034412 R 284812 CDS SPCC1259.03 19075559 2538906 join(1040133..1040357,1040603..1040737) 1 NC_003421.2 DNA-directed RNA polymerase complex I subunit Rpa12 1040737 rpa12 2538906 rpa12 Schizosaccharomyces pombe 972h- DNA-directed RNA polymerase complex I subunit Rpa12 NP_588059.1 1040133 D 284812 CDS SPCC1259.04 19075560 2539078 join(1041374..1041513,1041568..1041934) 1 NC_003421.2 Ino80 complex subunit Iec3 1041934 iec3 2539078 iec3 Schizosaccharomyces pombe 972h- Ino80 complex subunit Iec3 NP_588060.1 1041374 D 284812 CDS SPCC1259.05c 19075561 2539086 complement(join(1042639..1042780,1042843..1042877)) 1 NC_003421.2 cytochrome c oxidase subunit VIIa 1042877 cox9 2539086 cox9 Schizosaccharomyces pombe 972h- cytochrome c oxidase subunit VIIa NP_588061.1 1042639 R 284812 CDS SPCC1259.06 19075562 2539131 join(1043831..1043924,1043981..1044555) 1 NC_003421.2 transcription factor TFIID complex subunit 8 (predicted) 1044555 2539131 SPCC1259.06 Schizosaccharomyces pombe 972h- transcription factor TFIID complex subunit 8 (predicted) NP_588062.1 1043831 D 284812 CDS SPCC1259.07 19075563 2539374 join(1045467..1045498,1045545..1046568) 1 NC_003421.2 transcriptional regulatory protein Rxt3 1046568 rxt3 2539374 rxt3 Schizosaccharomyces pombe 972h- transcriptional regulatory protein Rxt3 NP_588063.1 1045467 D 284812 CDS SPCC1259.08 19075564 2539092 1048603..1049787 1 NC_003421.2 N-terminal may need truncating; conserved fungal protein 1049787 2539092 SPCC1259.08 Schizosaccharomyces pombe 972h- conserved fungal protein NP_588064.1 1048603 D 284812 CDS SPCC1259.09c 19075565 2539081 complement(join(1050087..1050372,1050415..1050646,1050695..1051324,1051391..1051435,1051477..1051581,1051641..1051713)) 1 NC_003421.2 pyruvate dehydrogenase protein x component 1051713 2539081 SPCC1259.09c Schizosaccharomyces pombe 972h- pyruvate dehydrogenase protein x component NP_588065.1 1050087 R 284812 CDS SPCC1259.10 19075566 2539074 join(1052318..1052481,1052520..1052829,1052885..1053649) 1 NC_003421.2 mitochondrial metallopeptidase involved in genome maintenance Pgp1 1053649 pgp1 2539074 pgp1 Schizosaccharomyces pombe 972h- mitochondrial metallopeptidase involved in genome maintenance Pgp1 NP_588066.1 1052318 D 284812 CDS SPCC1259.11c 19075567 2539140 complement(1053866..1056028) 1 NC_003421.2 GTPase activating protein Gyp2 (predicted) 1056028 gyp2 2539140 gyp2 Schizosaccharomyces pombe 972h- GTPase activating protein Gyp2 (predicted) NP_588067.1 1053866 R 284812 CDS SPCC1259.12c 19075568 2538867 complement(join(1056495..1056590,1056685..1056737,1056787..1057191,1057239..1057880,1057925..1058189)) 1 NC_003421.2 Ran GTPase binding protein (predicted) 1058189 2538867 SPCC1259.12c Schizosaccharomyces pombe 972h- Ran GTPase binding protein (predicted) NP_588068.1 1056495 R 284812 CDS SPCC1259.15c 19075569 2539190 complement(join(1058890..1058971,1059022..1059257,1059427..1059516,1059567..1059594,1059643..1059737)) 1 NC_003421.2 S. cerevisiae E2-C, is not a functional homolog of this E2 because it is not required for the degradation of mitotic cyclin; ubiquitin conjugating enzyme E2-C, Ubc11 1059737 ubc11 2539190 ubc11 Schizosaccharomyces pombe 972h- ubiquitin conjugating enzyme E2-C, Ubc11 NP_588069.1 1058890 R 284812 CDS SPCC1259.13 19075570 2539087 join(1060020..1060087,1060133..1060374,1060421..1060849,1060888..1061095,1061142..1061331,1061377..1061673,1061719..1061775) 1 NC_003421.2 Chk1 protein kinase 1061775 chk1 2539087 chk1 Schizosaccharomyces pombe 972h- Chk1 protein kinase NP_588070.1 1060020 D 284812 CDS SPCC1259.14c 19075571 2538871 complement(1061985..1064195) 1 NC_003421.2 S. pombe specific UPF0300 family protein 5 1064195 meu27 2538871 meu27 Schizosaccharomyces pombe 972h- S. pombe specific UPF0300 family protein 5 NP_588071.1 1061985 R 284812 CDS SPCC4B3.18 19075572 2539367 complement(1143091..1144041) 1 NC_003421.2 phosphopantothenate-cysteine ligase 1144041 2539367 SPCC4B3.18 Schizosaccharomyces pombe 972h- phosphopantothenate-cysteine ligase NP_588072.1 1143091 R 284812 CDS SPCC4B3.17 19075573 2539468 complement(1145056..1145907) 1 NC_003421.2 ubiquinol cytochrome-c reductase assembly protein Cbp3 1145907 cbp3 2539468 cbp3 Schizosaccharomyces pombe 972h- ubiquinol cytochrome-c reductase assembly protein Cbp3 NP_588073.1 1145056 R 284812 CDS SPCC4B3.16 19075574 2538898 complement(1146383..1147141) 1 NC_003421.2 TIP41-like type 2a phosphatase regulator Tip41 1147141 tip41 2538898 tip41 Schizosaccharomyces pombe 972h- TIP41-like type 2a phosphatase regulator Tip41 NP_588074.1 1146383 R 284812 CDS SPCC4B3.15 19075575 2539205 complement(1147453..1150215) 1 NC_003421.2 medial ring protein Mid1 1150215 mid1 2539205 mid1 Schizosaccharomyces pombe 972h- medial ring protein Mid1 NP_588075.1 1147453 R 284812 CDS SPCC4B3.14 19075576 2539503 complement(1150842..1151714) 1 NC_003421.2 complexed with Cdc5 protein Cwf20 1151714 cwf20 2539503 cwf20 Schizosaccharomyces pombe 972h- complexed with Cdc5 protein Cwf20 NP_588076.1 1150842 R 284812 CDS SPCC4B3.13 19075577 2539460 complement(1152243..1153862) 1 NC_003421.2 MatE family transporter 1153862 2539460 SPCC4B3.13 Schizosaccharomyces pombe 972h- MatE family transporter NP_588077.1 1152243 R 284812 CDS SPCC4B3.12 19075578 2539545 complement(1154281..1155606) 1 NC_003421.2 histone lysine methyltransferase Set9 1155606 set9 2539545 set9 Schizosaccharomyces pombe 972h- histone lysine methyltransferase Set9 NP_588078.1 1154281 R 284812 CDS SPCC4B3.11c 19075579 2539553 1156206..1156556 1 NC_003421.2 conserved eukaryotic protein 1156556 2539553 SPCC4B3.11c Schizosaccharomyces pombe 972h- conserved eukaryotic protein NP_588079.1 1156206 D 284812 CDS SPCC4B3.10c 19075580 2538790 join(1158148..1158160,1158217..1160126) 1 NC_003421.2 inositol 1,3,4,5,6-pentakisphosphate (IP5) kinase 1160126 ipk1 2538790 ipk1 Schizosaccharomyces pombe 972h- inositol 1,3,4,5,6-pentakisphosphate (IP5) kinase NP_588080.1 1158148 D 284812 CDS SPCC4B3.09c 19075581 2539530 join(1160411..1160544,1160594..1161080) 1 NC_003421.2 mitochondrial ribosomal protein subunit L12 1161080 2539530 SPCC4B3.09c Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit L12 NP_588081.1 1160411 D 284812 CDS SPCC4B3.08 19075582 2539555 complement(1161336..1161992) 1 NC_003421.2 C-terminal domain kinase I (CTDK-I) gamma subunit (predicted) 1161992 2539555 SPCC4B3.08 Schizosaccharomyces pombe 972h- C-terminal domain kinase I (CTDK-I) gamma subunit (predicted) NP_588082.1 1161336 R 284812 CDS SPCC4B3.07 19075583 2539438 complement(1162869..1164050) 1 NC_003421.2 nuclear pore associated protein 1164050 nro1 2539438 nro1 Schizosaccharomyces pombe 972h- nuclear pore associated protein NP_588083.1 1162869 R 284812 CDS SPCC4B3.06c 19075584 2538718 1165188..1165790 1 NC_003421.2 NADPH-dependent FMN reductase (predicted) 1165790 2538718 SPCC4B3.06c Schizosaccharomyces pombe 972h- NADPH-dependent FMN reductase (predicted) NP_588084.1 1165188 D 284812 CDS SPCC4B3.05c 162312106 2539032 join(1166571..1166604,1166662..1166696,1166743..1166767,1166815..1167323,1167373..1167837) 1 NC_003421.2 uroporphyrinogen decarboxylase Hem12 (predicted) 1167837 hem12 2539032 hem12 Schizosaccharomyces pombe 972h- uroporphyrinogen decarboxylase Hem12 (predicted) NP_588085.2 1166571 D 284812 CDS SPCC4B3.04c 19075586 2539411 join(1168730..1168929,1168979..1169153,1169211..1172786) 1 NC_003421.2 lysophospholipase 1172786 nte1 2539411 nte1 Schizosaccharomyces pombe 972h- lysophospholipase NP_588086.1 1168730 D 284812 CDS SPCC4B3.03c 19075587 2538837 1173490..1175529 1 NC_003421.2 DUF21 domain protein 1175529 2538837 SPCC4B3.03c Schizosaccharomyces pombe 972h- DUF21 domain protein NP_588087.1 1173490 D 284812 CDS SPCC4B3.02c 19075588 2538876 join(1176759..1176780,1176826..1176872,1176953..1176997,1177129..1177404) 1 NC_003421.2 Golgi transport protein Got1 (predicted) 1177404 2538876 SPCC4B3.02c Schizosaccharomyces pombe 972h- Golgi transport protein Got1 (predicted) NP_588088.1 1176759 D 284812 CDS SPCC4B3.01 162312108 5802714 complement(join(1177872..1178489,1178547..1178825)) 1 NC_003421.2 thiosulfate sulfurtransferase (predicted) 1178825 5802714 SPCC4B3.01 Schizosaccharomyces pombe 972h- thiosulfate sulfurtransferase (predicted) XP_001713164.1 1177872 R 284812 CDS SPCP25A2.02c 19075591 2539473 complement(1179636..1182557) 1 NC_003421.2 SNF2 family helicase Rhp26 1182557 rhp26 2539473 rhp26 Schizosaccharomyces pombe 972h- SNF2 family helicase Rhp26 NP_588091.1 1179636 R 284812 CDS SPCP25A2.03 19075592 2539396 join(1182796..1182990,1183050..1183940,1183996..1185168) 1 NC_003421.2 THO complex subunit (predicted) 1185168 2539396 SPCP25A2.03 Schizosaccharomyces pombe 972h- THO complex subunit (predicted) NP_588092.1 1182796 D 284812 CDS SPCC550.01c 19075593 2538864 complement(join(1185888..1185971,1186018..1186167)) 1 NC_003421.2 CHCH domain protein (predicted) 1186167 2538864 SPCC550.01c Schizosaccharomyces pombe 972h- CHCH domain protein (predicted) NP_588093.1 1185888 R 284812 CDS SPCC550.02c 19075594 2538974 complement(join(1186393..1186824,1186885..1187241,1187293..1187568)) 1 NC_003421.2 RNA-binding protein Cwf5 1187568 cwf5 2538974 cwf5 Schizosaccharomyces pombe 972h- RNA-binding protein Cwf5 NP_588094.1 1186393 R 284812 CDS SPCC550.03c 19075595 2538841 complement(1187735..1191376) 1 NC_003421.2 Ski complex RNA helicase Ski2 (predicted) 1191376 2538841 SPCC550.03c Schizosaccharomyces pombe 972h- Ski complex RNA helicase Ski2 (predicted) NP_588095.1 1187735 R 284812 CDS SPCC550.04c 19075596 2539262 complement(join(1191937..1191994,1192051..1192220,1192267..1192414,1192473..1193071)) 1 NC_003421.2 pig-C 1193071 gpi2 2539262 gpi2 Schizosaccharomyces pombe 972h- pig-C NP_588096.1 1191937 R 284812 CDS SPCC550.05 162312110 2539550 join(1194197..1194775,1194824..1194943) 1 NC_003421.2 Smc5-6 complex non-SMC subunit 1 1194943 nse1 2539550 nse1 Schizosaccharomyces pombe 972h- Smc5-6 complex non-SMC subunit 1 XP_001713165.1 1194197 D 284812 CDS SPCC550.06c 19075598 2539489 complement(1195418..1195732) 1 NC_003421.2 mitochondrial heat shock protein Hsp10 1195732 hsp10 2539489 hsp10 Schizosaccharomyces pombe 972h- mitochondrial heat shock protein Hsp10 NP_588098.1 1195418 R 284812 CDS SPCC550.07 19075599 2539478 1198190..1199791 1 NC_003421.2 acetamidase (predicted) 1199791 2539478 SPCC550.07 Schizosaccharomyces pombe 972h- acetamidase (predicted) NP_588099.1 1198190 D 284812 CDS SPCC550.08 19075600 2539440 1200989..1201732 1 NC_003421.2 N-acetyltransferase (predicted) 1201732 2539440 SPCC550.08 Schizosaccharomyces pombe 972h- N-acetyltransferase (predicted) NP_588100.1 1200989 D 284812 CDS SPCC550.09 19075601 2539457 1202535..1204142 1 NC_003421.2 peroxin Pex32 (predicted) 1204142 2539457 SPCC550.09 Schizosaccharomyces pombe 972h- peroxin Pex32 (predicted) NP_588101.1 1202535 D 284812 CDS SPCC550.10 19075602 2539264 1205004..1206506 1 NC_003421.2 aldehyde dehydrogenase Meu8 (predicted) 1206506 meu8 2539264 meu8 Schizosaccharomyces pombe 972h- aldehyde dehydrogenase Meu8 (predicted) NP_588102.1 1205004 D 284812 CDS SPCC550.11 19075603 2539463 join(1207663..1207825,1208163..1211089) 1 NC_003421.2 karyopherin 1211089 2539463 SPCC550.11 Schizosaccharomyces pombe 972h- karyopherin NP_588103.1 1207663 D 284812 CDS SPCC550.12 19075604 2539564 join(1212008..1212087,1212159..1212273,1212346..1213356) 1 NC_003421.2 actin-like protein Arp6 1213356 arp6 2539564 arp6 Schizosaccharomyces pombe 972h- actin-like protein Arp6 NP_588104.1 1212008 D 284812 CDS SPCC550.13 19075605 2539399 1214446..1216083 1 NC_003421.2 Hsk1-Dfp1 kinase complex regulatory subunit Dfp1 1216083 dfp1 2539399 dfp1 Schizosaccharomyces pombe 972h- Hsk1-Dfp1 kinase complex regulatory subunit Dfp1 NP_588105.1 1214446 D 284812 CDS SPCC550.14 19075606 2539425 1217178..1221017 1 NC_003421.2 vigilin (predicted) 1221017 vgl1 2539425 vgl1 Schizosaccharomyces pombe 972h- vigilin (predicted) NP_588106.1 1217178 D 284812 CDS SPCC550.15c 19075607 2539563 complement(1221616..1223007) 1 NC_003421.2 ribosome biogenesis protein (predicted) 1223007 2539563 SPCC550.15c Schizosaccharomyces pombe 972h- ribosome biogenesis protein (predicted) NP_588107.1 1221616 R 284812 CDS SPCC4E9.01c 162312112 2538852 complement(join(1223686..1224000,1224088..1224373,1224417..1224832,1224870..1225652,1225710..1225854,1225899..1226248,1226298..1226396,1226482..1226594,1226661..1226925)) 1 NC_003421.2 meiotic cohesin complex subunit Rec11 1226925 rec11 2538852 rec11 Schizosaccharomyces pombe 972h- meiotic cohesin complex subunit Rec11 NP_588108.3 1223686 R 284812 CDS SPCC4E9.02 63054436 2539433 1227545..1228792 1 NC_003421.2 cyclin Cig1 1228792 cig1 2539433 cig1 Schizosaccharomyces pombe 972h- cyclin Cig1 NP_588110.2 1227545 D 284812 CDS SPCC645.02 19075611 2539038 1229724..1230290 1 NC_003421.2 conserved protein (fungal and plant) 1230290 2539038 SPCC645.02 Schizosaccharomyces pombe 972h- conserved protein (fungal and plant) NP_588111.1 1229724 D 284812 CDS SPCC645.03c 19075612 2539409 complement(join(1231042..1231359,1231448..1231702)) 1 NC_003421.2 iron-sulfur protein Isa1 1231702 isa1 2539409 isa1 Schizosaccharomyces pombe 972h- iron-sulfur protein Isa1 NP_588112.1 1231042 R 284812 CDS SPCC645.04 19075613 2539436 1232185..1233171 1 NC_003421.2 Smc5-6 complex non-SMC subunit Nse3 1233171 nse3 2539436 nse3 Schizosaccharomyces pombe 972h- Smc5-6 complex non-SMC subunit Nse3 NP_588113.1 1232185 D 284812 CDS SPCC645.05c 19075614 2539513 complement(1233450..1238030) 1 NC_003421.2 myosin II heavy chain 1238030 myo2 2539513 myo2 Schizosaccharomyces pombe 972h- myosin II heavy chain NP_588114.1 1233450 R 284812 CDS SPCC645.06c 19075615 2539437 complement(1239385..1243212) 1 NC_003421.2 divergently orientated to rgf1; RhoGEF Rgf3 1243212 rgf3 2539437 rgf3 Schizosaccharomyces pombe 972h- RhoGEF Rgf3 NP_588115.1 1239385 R 284812 CDS SPCC645.07 19075616 2539580 join(1245263..1247944,1247991..1249313) 1 NC_003421.2 divergently orientated to rgf3; RhoGEF for Rho1, Rgf1 1249313 rgf1 2539580 rgf1 Schizosaccharomyces pombe 972h- RhoGEF for Rho1, Rgf1 NP_588116.1 1245263 D 284812 CDS SPCC645.08c 19075617 2539488 complement(1249557..1252193) 1 NC_003421.2 RNA-binding protein Snd1 1252193 snd1 2539488 snd1 Schizosaccharomyces pombe 972h- RNA-binding protein Snd1 NP_588117.1 1249557 R 284812 CDS SPCC645.09 19075618 2539589 1254545..1254964 1 NC_003421.2 mitochondrial ribosomal protein subunit L37 1254964 mrpl37 2539589 mrpl37 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit L37 NP_588118.1 1254545 D 284812 CDS SPCC645.10 19075619 2539578 join(1255280..1256590,1256650..1256793) 1 NC_003421.2 ATP(CTP) tRNA nucleotidyltransferase (predicted) 1256793 2539578 SPCC645.10 Schizosaccharomyces pombe 972h- ATP(CTP) tRNA nucleotidyltransferase (predicted) NP_588119.1 1255280 D 284812 CDS SPCC645.11c 19075620 2539498 complement(1256933..1257493) 1 NC_003421.2 possibly spliced to SPCC645.12c; meiotically upregulated gene Mug117 1257493 mug117 2539498 mug117 Schizosaccharomyces pombe 972h- meiotically upregulated gene Mug117 NP_588120.1 1256933 R 284812 CDS SPCC645.12c 19075621 2538818 complement(1257676..1258272) 1 NC_003421.2 sequence orphan 1258272 2538818 SPCC645.12c Schizosaccharomyces pombe 972h- sequence orphan NP_588121.1 1257676 R 284812 CDS SPCC645.13 19075622 2538700 1258634..1260799 1 NC_003421.2 transcription elongation regulator 1260799 2538700 SPCC645.13 Schizosaccharomyces pombe 972h- transcription elongation regulator NP_588122.1 1258634 D 284812 CDS SPCC645.14c 19075623 2539474 complement(1261606..1263381) 1 NC_003421.2 chaperone activator Sti1 (predicted) 1263381 sti1 2539474 sti1 Schizosaccharomyces pombe 972h- chaperone activator Sti1 (predicted) NP_588123.1 1261606 R 284812 CDS SPCC23B6.01c 19075624 2539266 complement(join(1264730..1266005,1266340..1266417,1266512..1266543,1266671..1266754)) 1 NC_003421.2 oxysterol binding protein (predicted) 1266754 2539266 SPCC23B6.01c Schizosaccharomyces pombe 972h- oxysterol binding protein (predicted) NP_588124.1 1264730 R 284812 CDS SPCC23B6.02c 19075625 2538915 complement(join(1268069..1268172,1268249..1268564)) 1 NC_003421.2 sequence orphan 1268564 2538915 SPCC23B6.02c Schizosaccharomyces pombe 972h- sequence orphan NP_588125.1 1268069 R 284812 CDS SPCC23B6.03c 19075626 2539209 complement(1268997..1277435) 1 NC_003421.2 ATM checkpoint kinase 1277435 tel1 2539209 tel1 Schizosaccharomyces pombe 972h- ATM checkpoint kinase NP_588126.1 1268997 R 284812 CDS SPCC23B6.04c 19075627 2539120 complement(1277873..1280899) 1 NC_003421.2 longer than orthologs, possibly a gene fusion; sec14 cytosolic factor family 1280899 2539120 SPCC23B6.04c Schizosaccharomyces pombe 972h- sec14 cytosolic factor family NP_588127.1 1277873 R 284812 CDS SPCC23B6.05c 19075628 2538775 complement(join(1281886..1281950,1282052..1282154,1282218..1282364)) 1 NC_003421.2 DNA replication factor A subunit Ssb3 1282364 ssb3 2538775 ssb3 Schizosaccharomyces pombe 972h- DNA replication factor A subunit Ssb3 NP_588128.1 1281886 R 284812 CDS SPCC1322.01 63054437 2538798 1283162..1286035 1 NC_003421.2 RNA processosome mitochondrial, name derivation; 3'-5' exonuclease for RNA 3' ss-tail 1286035 rpm1 2538798 rpm1 Schizosaccharomyces pombe 972h- 3'-5' exonuclease for RNA 3' ss-tail NP_588129.2 1283162 D 284812 CDS SPCC1322.02 19075630 2539073 1286350..1287405 1 NC_003421.2 sequence orphan 1287405 2539073 SPCC1322.02 Schizosaccharomyces pombe 972h- sequence orphan NP_588130.1 1286350 D 284812 CDS SPCC1322.03 19075631 2539071 1288137..1290725 1 NC_003421.2 TRP-like ion channel 1290725 2539071 SPCC1322.03 Schizosaccharomyces pombe 972h- TRP-like ion channel NP_588131.1 1288137 D 284812 CDS SPCC1322.04 19075632 2538877 1292178..1293698 1 NC_003421.2 UTP-glucose-1-phosphate uridylyltransferase (predicted) 1293698 2538877 SPCC1322.04 Schizosaccharomyces pombe 972h- UTP-glucose-1-phosphate uridylyltransferase (predicted) NP_588132.1 1292178 D 284812 CDS SPCC1322.05c 19075633 2538917 complement(1294076..1295914) 1 NC_003421.2 leukotriene A-4 hydrolase (predicted) 1295914 2538917 SPCC1322.05c Schizosaccharomyces pombe 972h- leukotriene A-4 hydrolase (predicted) NP_588133.1 1294076 R 284812 CDS SPCC1322.06 19075634 2538800 join(1296958..1297184,1297262..1298294,1298351..1299040,1299091..1299930,1300025..1300186) 1 NC_003421.2 karyopherin Kap113 1300186 kap113 2538800 kap113 Schizosaccharomyces pombe 972h- karyopherin Kap113 NP_588134.1 1296958 D 284812 CDS SPCC1322.07c 19075635 2539245 complement(1300640..1300954) 1 NC_003421.2 has transcript profile on microarray; sequence orphan 1300954 mug150 2539245 mug150 Schizosaccharomyces pombe 972h- sequence orphan NP_588135.1 1300640 R 284812 CDS SPCC1322.08 19075636 2539027 join(1302900..1302911,1303135..1304865) 1 NC_003421.2 sty1 regulated kinase 1 (PMID 12080074); MAPK-activated protein kinase Srk1 1304865 srk1 2539027 srk1 Schizosaccharomyces pombe 972h- MAPK-activated protein kinase Srk1 NP_588136.1 1302900 D 284812 CDS SPCC1322.09 19075637 2538894 join(1306194..1306737,1306796..1306974,1307129..1307773) 1 NC_003421.2 conserved fungal protein 1307773 2538894 SPCC1322.09 Schizosaccharomyces pombe 972h- conserved fungal protein NP_588137.1 1306194 D 284812 CDS SPCC1322.10 19075638 2538971 1309780..1310568 1 NC_003421.2 cell wall protein Pwp1 1310568 2538971 SPCC1322.10 Schizosaccharomyces pombe 972h- cell wall protein Pwp1 NP_588138.1 1309780 D 284812 CDS SPCC1322.11 19075639 2539286 join(1311652..1311823,1312089..1312336) 1 NC_003421.2 60S ribosomal protein L23 1312336 rpl2302 2539286 rpl2302 Schizosaccharomyces pombe 972h- 60S ribosomal protein L23 NP_588139.1 1311652 D 284812 CDS SPCC1322.12c 19075640 2538736 complement(1312798..1315932) 1 NC_003421.2 serine/threonine protein kinase Bub1 1315932 bub1 2538736 bub1 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Bub1 NP_588140.1 1312798 R 284812 CDS SPCC1322.13 19075641 2538734 1316337..1317995 1 NC_003421.2 phosphoribosylaminoimidazole carboxylase Ade6 1317995 ade6 2538734 ade6 Schizosaccharomyces pombe 972h- phosphoribosylaminoimidazole carboxylase Ade6 NP_588141.1 1316337 D 284812 CDS SPCC1322.14c 19075642 2538788 complement(1318425..1320590) 1 NC_003421.2 vacuolar transporter chaperone (VTC) complex subunit (predicted) 1320590 vtc4 2538788 vtc4 Schizosaccharomyces pombe 972h- vacuolar transporter chaperone (VTC) complex subunit (predicted) NP_588142.1 1318425 R 284812 CDS SPCC1322.15 19075643 2538815 1321587..1321922 1 NC_003421.2 60S ribosomal protein L34 1321922 rpl3402 2538815 rpl3402 Schizosaccharomyces pombe 972h- 60S ribosomal protein L34 NP_588143.1 1321587 D 284812 CDS SPCC1322.16 19075644 2538888 join(1323871..1324147,1324355..1324621,1324678..1324746,1324796..1325022) 1 NC_003421.2 may use Met at upstream MNRQ; prohibitin Phb2 1325022 phb2 2538888 phb2 Schizosaccharomyces pombe 972h- prohibitin Phb2 NP_588144.1 1323871 D 284812 CDS SPCC132.01c 63054438 2538747 complement(join(1325197..1328130,1328176..1328307)) 1 NC_003421.2 DUF814 family protein 1328307 2538747 SPCC132.01c Schizosaccharomyces pombe 972h- DUF814 family protein NP_588145.2 1325197 R 284812 CDS SPCC132.02 19075647 2538868 join(1329098..1329176,1329234..1329610,1329678..1330220) 1 NC_003421.2 Sir2 family histone deacetylase Hst2 1330220 hst2 2538868 hst2 Schizosaccharomyces pombe 972h- Sir2 family histone deacetylase Hst2 NP_588147.1 1329098 D 284812 CDS SPCC132.03 19075648 2539281 join(1331555..1331791,1331986..1332209,1332276..1332345) 1 NC_003421.2 sequence orphan 1332345 2539281 SPCC132.03 Schizosaccharomyces pombe 972h- sequence orphan NP_588148.1 1331555 D 284812 CDS SPCC132.04c 19075649 2539148 complement(1332764..1336084) 1 NC_003421.2 S. cerevisiae ortholog YDL215C is not normally involved in glutamate biosynthesis (PMID:1975578) i.e reactiondirection is toward 2-oxoglutarate in vitro; NAD-dependent glutamate dehydrogenase (predicted) 1336084 2539148 SPCC132.04c Schizosaccharomyces pombe 972h- NAD-dependent glutamate dehydrogenase (predicted) NP_588149.1 1332764 R 284812 CDS SPCC338.18 19075650 2538839 complement(1341269..1341622) 1 NC_003421.2 sequence orphan 1341622 2538839 SPCC338.18 Schizosaccharomyces pombe 972h- sequence orphan NP_588150.1 1341269 R 284812 CDS SPCC338.17c 19075651 2539447 join(1343092..1343124,1343205..1345058) 1 NC_003421.2 mitotic cohesin complex, non-SMC subunit Rad21 (kleisin) 1345058 rad21 2539447 rad21 Schizosaccharomyces pombe 972h- mitotic cohesin complex, non-SMC subunit Rad21 (kleisin) NP_588151.1 1343092 D 284812 CDS SPCC338.16 19075652 2539527 complement(1345394..1347127) 1 NC_003421.2 F-box protein Pof3 1347127 pof3 2539527 pof3 Schizosaccharomyces pombe 972h- F-box protein Pof3 NP_588152.1 1345394 R 284812 CDS SPCC338.15 19075653 2539520 complement(join(1347822..1348238,1348369..1349024,1349112..1349222,1349269..1349398)) 1 NC_003421.2 dolichyl-di-phosphooligosaccharide-protein glycotransferase subunit (predicted) 1349398 2539520 SPCC338.15 Schizosaccharomyces pombe 972h- dolichyl-di-phosphooligosaccharide-protein glycotransferase subunit (predicted) NP_588153.1 1347822 R 284812 CDS SPCC338.14 19075654 2539129 complement(1350062..1351084) 1 NC_003421.2 adenosine kinase (predicted) 1351084 2539129 SPCC338.14 Schizosaccharomyces pombe 972h- adenosine kinase (predicted) NP_588154.1 1350062 R 284812 CDS SPCC338.13 19075655 2539017 complement(1351993..1354209) 1 NC_003421.2 Golgi transport complex subunit Cog4 (predicted) 1354209 cog4 2539017 cog4 Schizosaccharomyces pombe 972h- Golgi transport complex subunit Cog4 (predicted) NP_588155.1 1351993 R 284812 CDS SPCC338.12 19075656 2539018 complement(1355276..1355509) 1 NC_003421.2 subtilisin cleaved region related protein (predicted) 1355509 2539018 SPCC338.12 Schizosaccharomyces pombe 972h- subtilisin cleaved region related protein (predicted) NP_588156.1 1355276 R 284812 CDS SPCC338.11c 19075657 2539044 1356326..1357237 1 NC_003421.2 methyltransferase Rrg1 (predicted) 1357237 rrg1 2539044 rrg1 Schizosaccharomyces pombe 972h- methyltransferase Rrg1 (predicted) NP_588157.1 1356326 D 284812 CDS SPCC338.10c 19075658 2538862 1357902..1358426 1 NC_003421.2 cytochrome c oxidase subunit V 1358426 cox5 2538862 cox5 Schizosaccharomyces pombe 972h- cytochrome c oxidase subunit V NP_588158.1 1357902 D 284812 CDS SPCC338.08 295442775 2538706 complement(join(1358891..1359082,1359127..1359819)) 1 NC_003421.2 CtIP-related endonuclease 1359819 ctp1 2538706 ctp1 Schizosaccharomyces pombe 972h- CtIP-related endonuclease NP_588159.2 1358891 R 284812 CDS SPCC338.07c 19075660 2539338 join(1362628..1362681,1362733..1364868) 1 NC_003421.2 NatA N-acetyltransferase complex subunit (predicted) 1364868 2539338 SPCC338.07c Schizosaccharomyces pombe 972h- NatA N-acetyltransferase complex subunit (predicted) NP_588160.1 1362628 D 284812 CDS SPCC338.06c 19075661 2538739 1365222..1365641 1 NC_003421.2 heat shock protein Hsp20 family 1365641 2538739 SPCC338.06c Schizosaccharomyces pombe 972h- heat shock protein Hsp20 family NP_588161.1 1365222 D 284812 CDS SPCC338.05c 19075662 2538720 join(1366621..1366631,1366679..1366817,1366981..1367106,1367285..1367364,1367414..1367477) 1 NC_003421.2 ubiquitin conjugating enzyme Mms2 1367477 mms2 2538720 mms2 Schizosaccharomyces pombe 972h- ubiquitin conjugating enzyme Mms2 NP_588162.1 1366621 D 284812 CDS SPCC338.04 19075663 2538789 complement(join(1367793..1368247,1368307..1368355)) 1 NC_003421.2 caffeine induced death protein Cid2 1368355 cid2 2538789 cid2 Schizosaccharomyces pombe 972h- caffeine induced death protein Cid2 NP_588163.1 1367793 R 284812 CDS SPCC338.02 19075664 2538810 complement(1368882..1369259) 1 NC_003421.2 sequence orphan 1369259 mug112 2538810 mug112 Schizosaccharomyces pombe 972h- sequence orphan NP_588164.1 1368882 R 284812 CDS SPCC338.03c 162312114 5802715 1368919..1369344 1 NC_003421.2 dubious 1369344 5802715 SPCC338.03c Schizosaccharomyces pombe 972h- dubious XP_001713166.1 1368919 D 284812 CDS SPCC1281.01 162312116 2539007 1374172..1381404 1 NC_003421.2 alpha-1,4-glucan synthase Ags1 1381404 ags1 2539007 ags1 Schizosaccharomyces pombe 972h- alpha-1,4-glucan synthase Ags1 NP_588165.3 1374172 D 284812 CDS SPCC1281.02c 19075666 2538711 complement(1382490..1383425) 1 NC_003421.2 splicing factor Spf30 (predicted) 1383425 spf30 2538711 spf30 Schizosaccharomyces pombe 972h- splicing factor Spf30 (predicted) NP_588166.1 1382490 R 284812 CDS SPCC1281.03c 19075667 2539075 complement(1384032..1384613) 1 NC_003421.2 DUF1077 family protein 1384613 2539075 SPCC1281.03c Schizosaccharomyces pombe 972h- DUF1077 family protein NP_588167.1 1384032 R 284812 CDS SPCC1281.04 19075668 2539165 1386802..1387803 1 NC_003421.2 pyridoxal reductase (predicted) 1387803 2539165 SPCC1281.04 Schizosaccharomyces pombe 972h- pyridoxal reductase (predicted) NP_588168.1 1386802 D 284812 CDS SPCC1281.05 19075669 2538836 1388798..1389970 1 NC_003421.2 RSC complex subunit Rsc7 1389970 rsc7 2538836 rsc7 Schizosaccharomyces pombe 972h- RSC complex subunit Rsc7 NP_588169.1 1388798 D 284812 CDS SPCC1281.06c 19075670 2538753 complement(1392690..1394129) 1 NC_003421.2 acyl-coA desaturase (predicted) 1394129 2538753 SPCC1281.06c Schizosaccharomyces pombe 972h- acyl-coA desaturase (predicted) NP_588170.1 1392690 R 284812 CDS SPCC1281.07c 19075671 2539028 complement(1397625..1398566) 1 NC_003421.2 glutathione S-transferase Gst3 1398566 2539028 SPCC1281.07c Schizosaccharomyces pombe 972h- glutathione S-transferase Gst3 NP_588171.1 1397625 R 284812 CDS SPCC1281.08 19075672 2539167 join(1399379..1399535,1399698..1400018,1400066..1400296,1400335..1400387,1400444..1400476) 1 NC_003421.2 wtf element Wtf11 1400476 wtf11 2539167 wtf11 Schizosaccharomyces pombe 972h- wtf element Wtf11 NP_588172.1 1399379 D 284812 CDS SPCC622.21 68025734 3361101 join(1401530..1401668,1401900..1402172,1402490..1402551,1402553..1402672) 1 NC_003421.2 was originally annotated as pseudo as original prediction had frameshift and stop codon; wtf element Wtf12 1402672 wtf12 3361101 wtf12 Schizosaccharomyces pombe 972h- wtf element Wtf12 NP_001018852.1 1401530 D 284812 CDS SPCC622.01c 19075673 2539533 complement(1404306..1404755) 1 NC_003421.2 has transcript CRUK 1227/094591; dubious 1404755 2539533 SPCC622.01c Schizosaccharomyces pombe 972h- dubious NP_588173.1 1404306 R 284812 CDS SPCC622.02 19075674 2538761 1405076..1405459 1 NC_003421.2 dubious 1405459 2538761 SPCC622.02 Schizosaccharomyces pombe 972h- dubious NP_588174.1 1405076 D 284812 CDS SPCC622.03c 19075675 2539301 complement(1405969..1406367) 1 NC_003421.2 low complexity gene free region; dubious 1406367 2539301 SPCC622.03c Schizosaccharomyces pombe 972h- dubious NP_588175.1 1405969 R 284812 CDS SPCC622.04 19075676 2538750 1406677..1407099 1 NC_003421.2 dubious 1407099 2538750 SPCC622.04 Schizosaccharomyces pombe 972h- dubious NP_588176.1 1406677 D 284812 CDS SPCC622.05 19075677 2539528 1408164..1408511 1 NC_003421.2 dubious 1408511 2539528 SPCC622.05 Schizosaccharomyces pombe 972h- dubious NP_588177.1 1408164 D 284812 CDS SPCC622.06c 19075678 2539282 complement(1408816..1409184) 1 NC_003421.2 low complexity gene free region; dubious 1409184 2539282 SPCC622.06c Schizosaccharomyces pombe 972h- dubious NP_588178.1 1408816 R 284812 CDS SPCC622.07 19075679 2539276 1409497..1409883 1 NC_003421.2 dubious 1409883 2539276 SPCC622.07 Schizosaccharomyces pombe 972h- dubious NP_588179.1 1409497 D 284812 CDS SPCC622.08c 19075680 2539499 complement(1411524..1411922) 1 NC_003421.2 histone H2A alpha 1411922 hta1 2539499 hta1 Schizosaccharomyces pombe 972h- histone H2A alpha NP_588180.1 1411524 R 284812 CDS SPCC622.09 19075681 2539523 1412484..1412864 1 NC_003421.2 histone H2B alpha Htb1 1412864 htb1 2539523 htb1 Schizosaccharomyces pombe 972h- histone H2B alpha Htb1 NP_588181.1 1412484 D 284812 CDS SPCC622.10c 19075682 2539341 complement(join(1413637..1415911,1415978..1416150)) 1 NC_003421.2 similar to A. gossypii AGL158C (fasta), A. gossypii AGL158C is syntentic ortholog of S. cerevisiae YDR166C, similarity also from PSI Blast with S. cerevisiae YDR166, but not detectable via Blast or Fasta; exocyst complex subunit Sec5 (predicted) 1416150 2539341 SPCC622.10c Schizosaccharomyces pombe 972h- exocyst complex subunit Sec5 (predicted) NP_588182.1 1413637 R 284812 CDS SPCC622.11 19075683 2538812 join(1417100..1417438,1417634..1418983) 1 NC_003421.2 LMBR1-like membrane protein 1418983 2538812 SPCC622.11 Schizosaccharomyces pombe 972h- LMBR1-like membrane protein NP_588183.1 1417100 D 284812 CDS SPCC622.12c 19075684 2539147 complement(1419457..1420812) 1 NC_003421.2 NADP-specific glutamate dehydrogenase (predicted) 1420812 2539147 SPCC622.12c Schizosaccharomyces pombe 972h- NADP-specific glutamate dehydrogenase (predicted) NP_588184.1 1419457 R 284812 CDS SPCC622.13c 19075685 2539480 complement(1422550..1425846) 1 NC_003421.2 Tel Two Interacting protein 1 1425846 tti1 2539480 tti1 Schizosaccharomyces pombe 972h- Tel Two Interacting protein 1 NP_588185.1 1422550 R 284812 CDS SPCC622.14 295442777 2539181 join(1427098..1427310,1427632..1427709,1427788..1428216,1428277..1428522) 1 NC_003421.2 GTPase activating protein (predicted) 1428522 2539181 SPCC622.14 Schizosaccharomyces pombe 972h- GTPase activating protein (predicted) NP_588186.2 1427098 D 284812 CDS SPCC622.15c 19075687 2539454 complement(1429106..1430779) 1 NC_003421.2 this was previously annotated as the ortholog Sae2p but was incorrect prediction; sequence orphan 1430779 2539454 SPCC622.15c Schizosaccharomyces pombe 972h- sequence orphan NP_588187.1 1429106 R 284812 CDS SPCC622.16c 19075688 2539481 complement(1431699..1434545) 1 NC_003421.2 Jmjc domain chromatin associated protein Epe1 1434545 epe1 2539481 epe1 Schizosaccharomyces pombe 972h- Jmjc domain chromatin associated protein Epe1 NP_588188.1 1431699 R 284812 CDS SPCC622.17 63054441 2538794 join(1435549..1435850,1435923..1436649) 1 NC_003421.2 added back in frame splice confirmed by (PMID 14704348) was in original prediction, but removed because it disagreed with mRNA; 13-04-2004 Added back 2 N-terminal exons removed because they didn't agree with SP33625; since confirmed by PMID: 14704348; AP endonuclease Apn1 1436649 apn1 2538794 apn1 Schizosaccharomyces pombe 972h- AP endonuclease Apn1 NP_588189.2 1435549 D 284812 CDS SPCC622.18 19075690 2539372 1437153..1437740 1 NC_003421.2 60S ribosomal protein L6 1437740 rpl6 2539372 rpl6 Schizosaccharomyces pombe 972h- 60S ribosomal protein L6 NP_588190.1 1437153 D 284812 CDS SPCC622.19 19075691 2539424 join(1438375..1438399,1438443..1439839) 1 NC_003421.2 Jmj4 protein 1439839 jmj4 2539424 jmj4 Schizosaccharomyces pombe 972h- Jmj4 protein NP_588191.1 1438375 D 284812 CDS SPCC61.01c 19075692 2539559 complement(join(1440089..1441670,1441783..1441994)) 1 NC_003421.2 siderophore-iron transporter Str2 1441994 str2 2539559 str2 Schizosaccharomyces pombe 972h- siderophore-iron transporter Str2 NP_588192.1 1440089 R 284812 CDS SPCC61.02 19075693 2539570 1443002..1443925 1 NC_003421.2 SAGA complex subunit Spt3 1443925 spt3 2539570 spt3 Schizosaccharomyces pombe 972h- SAGA complex subunit Spt3 NP_588193.1 1443002 D 284812 CDS SPCC61.03 19075694 2539500 1444653..1445636 1 NC_003421.2 UPF0031 family protein 1445636 2539500 SPCC61.03 Schizosaccharomyces pombe 972h- UPF0031 family protein NP_588194.1 1444653 D 284812 CDS SPCC61.04c 19075695 2539076 complement(join(1446343..1446511,1446615..1446907,1447156..1447377)) 1 NC_003421.2 Rab GTPase binding (predicted) 1447377 2539076 SPCC61.04c Schizosaccharomyces pombe 972h- Rab GTPase binding (predicted) NP_588195.1 1446343 R 284812 CDS SPCC61.05 19075696 2539029 1449606..1451015 1 NC_003421.2 S. pombe specific multicopy membrane protein family 1 1451015 2539029 SPCC61.05 Schizosaccharomyces pombe 972h- S. pombe specific multicopy membrane protein family 1 NP_588196.1 1449606 D 284812 CDS SPCC11E10.01 63054442 2539019 1453242..1454414 1 NC_003421.2 cystathionine beta-lyase (predicted) 1454414 2539019 SPCC11E10.01 Schizosaccharomyces pombe 972h- cystathionine beta-lyase (predicted) NP_588197.2 1453242 D 284812 CDS SPCC11E10.02c 19075698 2539272 complement(1454816..1455958) 1 NC_003421.2 pig-K 1455958 gpi8 2539272 gpi8 Schizosaccharomyces pombe 972h- pig-K NP_588198.1 1454816 R 284812 CDS SPCC11E10.03 19075699 2538878 1456436..1457491 1 NC_003421.2 dynactin complex subunit (predicted) 1457491 mug1 2538878 mug1 Schizosaccharomyces pombe 972h- dynactin complex subunit (predicted) NP_588199.1 1456436 D 284812 CDS SPCC11E10.04 19075700 2539022 1457861..1459192 1 NC_003421.2 mitochondrial ATPase expression protein homolog 1459192 2539022 SPCC11E10.04 Schizosaccharomyces pombe 972h- mitochondrial ATPase expression protein homolog NP_588200.1 1457861 D 284812 CDS SPCC11E10.05c 19075701 2538741 complement(1460509..1462227) 1 NC_003421.2 nucleoside diphosphatase Ynd1 1462227 ynd1 2538741 ynd1 Schizosaccharomyces pombe 972h- nucleoside diphosphatase Ynd1 NP_588201.1 1460509 R 284812 CDS SPCC11E10.06c 19075702 2538987 complement(1463253..1464338) 1 NC_003421.2 elongator complex subunit Elp4 (predicted) 1464338 2538987 SPCC11E10.06c Schizosaccharomyces pombe 972h- elongator complex subunit Elp4 (predicted) NP_588202.1 1463253 R 284812 CDS SPCC11E10.07c 19075703 2539154 complement(join(1464773..1465061,1465158..1465600,1465656..1465795,1465853..1466006)) 1 NC_003421.2 translation initiation factor eIF2B alpha subunit 1466006 2539154 SPCC11E10.07c Schizosaccharomyces pombe 972h- translation initiation factor eIF2B alpha subunit NP_588203.1 1464773 R 284812 CDS SPCC11E10.08 19075704 2539050 1468174..1471296 1 NC_003421.2 silencing protein Rik1 1471296 rik1 2539050 rik1 Schizosaccharomyces pombe 972h- silencing protein Rik1 NP_588204.1 1468174 D 284812 CDS SPCC11E10.09c 19075705 2539049 complement(join(1471781..1471813,1471857..1472300,1472367..1473326)) 1 NC_003421.2 alpha-amylase homolog (predicted) 1473326 2539049 SPCC11E10.09c Schizosaccharomyces pombe 972h- alpha-amylase homolog (predicted) NP_588205.1 1471781 R 284812 CDS SPCC188.02 19075706 2539379 join(1475777..1475800,1475844..1475939,1475980..1476193,1476525..1477279,1477332..1477630,1477720..1477978) 1 NC_003421.2 protein phosphatase regulatory subunit Par1 1477978 par1 2539379 par1 Schizosaccharomyces pombe 972h- protein phosphatase regulatory subunit Par1 NP_588206.1 1475777 D 284812 CDS SPCC188.03 19075707 2539121 join(1478304..1480217,1480258..1480389,1480450..1480678,1480727..1480836,1480899..1481141) 1 NC_003421.2 condensin, non-SMCsubunit Cnd3 1481141 cnd3 2539121 cnd3 Schizosaccharomyces pombe 972h- condensin, non-SMCsubunit Cnd3 NP_588207.1 1478304 D 284812 CDS SPCC188.04c 19075708 2539200 complement(join(1481138..1481280,1481345..1481758,1481807..1481966)) 1 NC_003421.2 kinetochore protein Spc25 1481966 spc25 2539200 spc25 Schizosaccharomyces pombe 972h- kinetochore protein Spc25 NP_588208.1 1481138 R 284812 CDS SPCC188.05 162312118 5802716 1482007..1482273 1 NC_003421.2 dubious 1482273 5802716 SPCC188.05 Schizosaccharomyces pombe 972h- dubious XP_001713167.1 1482007 D 284812 CDS SPCC188.06c 19075709 2539290 complement(join(1483088..1484578,1485059..1485136)) 1 NC_003421.2 signal recognition particle subunit Srp54 1485136 srp54 2539290 srp54 Schizosaccharomyces pombe 972h- signal recognition particle subunit Srp54 NP_588209.1 1483088 R 284812 CDS SPCC188.07 19075710 2539352 1486303..1488510 1 NC_003421.2 coiled coil protein quantitatively enriched Ccq1; possibly related to SMC proteins; orthology prediction pers. comm. Charly Chahwan, Ccq1 is now part od HDA2-3 PF11496; telomere maintenance protein Ccq1 1488510 ccq1 2539352 ccq1 Schizosaccharomyces pombe 972h- telomere maintenance protein Ccq1 NP_588210.1 1486303 D 284812 CDS SPCC188.08c 19075711 2539385 complement(join(1488934..1492154,1492234..1492336,1492388..1492390)) 1 NC_003421.2 ubiquitin C-terminal hydrolase Ubp22 1492390 ubp22 2539385 ubp22 Schizosaccharomyces pombe 972h- ubiquitin C-terminal hydrolase Ubp22 NP_588211.1 1488934 R 284812 CDS SPCC188.09c 19075712 2539201 complement(1492938..1494767) 1 NC_003421.2 cell surface glycoprotein (predicted) 1494767 2539201 SPCC188.09c Schizosaccharomyces pombe 972h- cell surface glycoprotein (predicted) NP_588212.1 1492938 R 284812 CDS SPCC188.11 19075713 2538988 join(1502692..1502720,1502764..1504315,1504364..1504456) 1 NC_003421.2 splicing factor Prp45 1504456 prp45 2538988 prp45 Schizosaccharomyces pombe 972h- splicing factor Prp45 NP_588213.1 1502692 D 284812 CDS SPCC188.12 162312120 2538950 join(1504941..1504999,1505062..1506145) 1 NC_003421.2 septin Spn6 1506145 spn6 2538950 spn6 Schizosaccharomyces pombe 972h- septin Spn6 XP_001713168.1 1504941 D 284812 CDS SPCC188.13c 63054443 2538930 complement(1506166..1510290) 1 NC_003421.2 dicer 1510290 dcr1 2538930 dcr1 Schizosaccharomyces pombe 972h- dicer NP_588215.2 1506166 R 284812 CDS SPCC584.11c 19075716 2538896 complement(join(1511583..1512702,1513174..1513196)) 1 NC_003421.2 Svf1 family protein Svf1 1513196 2538896 SPCC584.11c Schizosaccharomyces pombe 972h- Svf1 family protein Svf1 NP_588216.1 1511583 R 284812 CDS SPCC584.12 19075717 2539417 1514795..1515142 1 NC_003421.2 has transcript profile on microarray; sequence orphan 1515142 mug42 2539417 mug42 Schizosaccharomyces pombe 972h- sequence orphan NP_588217.1 1514795 D 284812 CDS SPCC584.13 19075718 2539095 1516386..1518020 1 NC_003421.2 amino acid permease, unknown 14 1518020 2539095 SPCC584.13 Schizosaccharomyces pombe 972h- amino acid permease, unknown 14 NP_588218.1 1516386 D 284812 CDS SPCC584.14 19075719 2539370 1518925..1520220 1 NC_003421.2 human ATXN10 ortholog 1520220 mug160 2539370 mug160 Schizosaccharomyces pombe 972h- human ATXN10 ortholog NP_588219.1 1518925 D 284812 CDS SPCC584.15c 19075720 2539284 complement(join(1520806..1522384,1522446..1522595,1523136..1523191)) 1 NC_003421.2 first intron is unsupported, it may be incorrect, CDS may need trimming to exclude this intron, or there may be another but haven't been able to improve this prediction; arrestin/PY protein 2 1523191 2539284 SPCC584.15c Schizosaccharomyces pombe 972h- arrestin/PY protein 2 NP_588220.1 1520806 R 284812 CDS SPCC584.16c 19075721 2539304 complement(1524517..1525212) 1 NC_003421.2 sequence orphan 1525212 2539304 SPCC584.16c Schizosaccharomyces pombe 972h- sequence orphan NP_588221.1 1524517 R 284812 CDS SPCC584.01c 19075722 2538821 complement(1526472..1529492) 1 NC_003421.2 sulfite reductase NADPH flavoprotein subunit (predicted) 1529492 2538821 SPCC584.01c Schizosaccharomyces pombe 972h- sulfite reductase NADPH flavoprotein subunit (predicted) NP_588222.1 1526472 R 284812 CDS SPCC584.02 19075723 2539483 join(1532126..1532157,1532208..1532300,1532345..1532753) 1 NC_003421.2 Cu metalloregulatory transcription factor Cuf2 1532753 cuf2 2539483 cuf2 Schizosaccharomyces pombe 972h- Cu metalloregulatory transcription factor Cuf2 NP_588223.1 1532126 D 284812 CDS SPCC584.03c 19075724 2539008 complement(1533022..1534677) 1 NC_003421.2 Ran GTP-binding protein (predicted) 1534677 2539008 SPCC584.03c Schizosaccharomyces pombe 972h- Ran GTP-binding protein (predicted) NP_588224.1 1533022 R 284812 CDS SPCC584.04 19075725 2539479 join(1535453..1535582,1535666..1537524) 1 NC_003421.2 translation release factor class II eRF3 1537524 sup35 2539479 sup35 Schizosaccharomyces pombe 972h- translation release factor class II eRF3 NP_588225.1 1535453 D 284812 CDS SPCC584.05 19075726 2538850 join(1538207..1538234,1538273..1538313,1538530..1540542) 1 NC_003421.2 SNARE binding protein Sec1 1540542 sec1 2538850 sec1 Schizosaccharomyces pombe 972h- SNARE binding protein Sec1 NP_588226.1 1538207 D 284812 CDS SPCC1753.01c 63054444 2538781 complement(join(1540948..1541661,1541789..1541914)) 1 NC_003421.2 single-stranded DNA binding protein Ssb2 1541914 ssb2 2538781 ssb2 Schizosaccharomyces pombe 972h- single-stranded DNA binding protein Ssb2 NP_588227.2 1540948 R 284812 CDS SPCC1753.02c 19075728 2538770 complement(1543181..1544581) 1 NC_003421.2 glucose insensitive transcription; G-protein coupled receptor Git3 1544581 git3 2538770 git3 Schizosaccharomyces pombe 972h- G-protein coupled receptor Git3 NP_588228.1 1543181 R 284812 CDS SPCC1753.03c 19075729 2539330 complement(join(1547888..1548640,1548746..1548859,1548917..1549069)) 1 NC_003421.2 deletion mutant results in frequent occurrence of two-spored asci (PMID 11156975); deletion mutant results in frequent nondisjunction of homologous chromosomes at the first meiotic division (PMID 11156975); meiotic recombination protein Rec7 1549069 rec7 2539330 rec7 Schizosaccharomyces pombe 972h- meiotic recombination protein Rec7 NP_588229.1 1547888 R 284812 CDS SPCC1753.04 19075730 2538954 1550004..1551065 1 NC_003421.2 deletion mutant results in sulfite auxotrophy (PMID 10850973); 3'(2'),5'-bisphosphate nucleotidase/inositol-1,4-bisphosphate 1-phosphatase 1551065 tol1 2538954 tol1 Schizosaccharomyces pombe 972h- 3'(2'),5'-bisphosphate nucleotidase/inositol-1,4-bisphosphate 1-phosphatase NP_588230.1 1550004 D 284812 CDS SPCC1753.05 19075731 2538984 1551694..1552584 1 NC_003421.2 RNA export factor Rsm1 1552584 rsm1 2538984 rsm1 Schizosaccharomyces pombe 972h- RNA export factor Rsm1 NP_588231.1 1551694 D 284812 CDS SPCC162.12 19075732 2538993 complement(join(1552781..1553388,1553448..1554195)) 1 NC_003421.2 TORC1 subunit Tco89 1554195 tco89 2538993 tco89 Schizosaccharomyces pombe 972h- TORC1 subunit Tco89 NP_588232.1 1552781 R 284812 CDS SPCC162.11c 19075733 2538946 1556445..1557809 1 NC_003421.2 uridine kinase/uracil phosphoribosyltransferase (predicted) 1557809 2538946 SPCC162.11c Schizosaccharomyces pombe 972h- uridine kinase/uracil phosphoribosyltransferase (predicted) NP_588233.1 1556445 D 284812 CDS SPCC162.10 19075734 2539202 complement(1558224..1559240) 1 NC_003421.2 serine/threonine protein kinase Ppk33 (predicted) 1559240 ppk33 2539202 ppk33 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Ppk33 (predicted) NP_588234.1 1558224 R 284812 CDS SPCC162.09c 19075735 2538999 1561986..1565147 1 NC_003421.2 3-hydroxy-3-methylglutaryl-CoA reductase Hmg1 1565147 hmg1 2538999 hmg1 Schizosaccharomyces pombe 972h- 3-hydroxy-3-methylglutaryl-CoA reductase Hmg1 NP_588235.1 1561986 D 284812 CDS SPCC162.08c 19075736 2538843 1565642..1571155 1 NC_003421.2 nuclear pore complex associated protein 1571155 nup211 2538843 nup211 Schizosaccharomyces pombe 972h- nuclear pore complex associated protein NP_588236.1 1565642 D 284812 CDS SPCC162.07 19075737 2539390 complement(join(1571648..1573733,1574016..1574050)) 1 NC_003421.2 epsin 1574050 ent1 2539390 ent1 Schizosaccharomyces pombe 972h- epsin NP_588237.1 1571648 R 284812 CDS SPCC162.06c 19075738 2538774 join(1577140..1577208,1577266..1577417,1577475..1577886) 1 NC_003421.2 vacuolar sorting protein Vps60 1577886 2538774 SPCC162.06c Schizosaccharomyces pombe 972h- vacuolar sorting protein Vps60 NP_588238.1 1577140 D 284812 CDS SPCC162.05 19075739 2538771 complement(1578220..1579035) 1 NC_003421.2 hexaprenyldihydroxybenzoate methyltransferase Coq3 1579035 coq3 2538771 coq3 Schizosaccharomyces pombe 972h- hexaprenyldihydroxybenzoate methyltransferase Coq3 NP_588239.1 1578220 R 284812 CDS SPCC162.04c 19075740 2538692 complement(join(1580123..1580613,1580650..1581006,1581055..1581327,1581559..1581694)) 1 NC_003421.2 wtf element Wtf13 1581694 wtf13 2538692 wtf13 Schizosaccharomyces pombe 972h- wtf element Wtf13 NP_588240.1 1580123 R 284812 CDS SPCC162.03 19075741 2539382 complement(1582904..1583782) 1 NC_003421.2 short chain dehydrogenase (predicted) 1583782 2539382 SPCC162.03 Schizosaccharomyces pombe 972h- short chain dehydrogenase (predicted) NP_588241.1 1582904 R 284812 CDS SPCC162.02c 19075742 2538929 1584480..1587425 1 NC_003421.2 AMP-binding dehydrogenase (predicted) 1587425 2538929 SPCC162.02c Schizosaccharomyces pombe 972h- AMP-binding dehydrogenase (predicted) NP_588242.1 1584480 D 284812 CDS SPCC162.01c 19075743 2539361 1587869..1588603 1 NC_003421.2 U4/U6 x U5 tri-snRNP complex subunit (predicted) 1588603 2539361 SPCC162.01c Schizosaccharomyces pombe 972h- U4/U6 x U5 tri-snRNP complex subunit (predicted) NP_588243.1 1587869 D 284812 CDS SPCC13B11.01 19075744 2538902 1591359..1592411 1 NC_003421.2 alcohol dehydrogenase Adh1 1592411 adh1 2538902 adh1 Schizosaccharomyces pombe 972h- alcohol dehydrogenase Adh1 NP_588244.1 1591359 D 284812 CDS SPCC13B11.02c 19075745 2538716 complement(1593402..1593818) 1 NC_003421.2 previously annotated as dubious; sequence orphan 1593818 2538716 SPCC13B11.02c Schizosaccharomyces pombe 972h- sequence orphan NP_588245.1 1593402 R 284812 CDS SPCC13B11.03c 19075746 2538985 complement(join(1595042..1595287,1595353..1595758,1595943..1596061)) 1 NC_003421.2 hydroxyacylglutathione hydrolase (predicted) 1596061 2538985 SPCC13B11.03c Schizosaccharomyces pombe 972h- hydroxyacylglutathione hydrolase (predicted) NP_588246.1 1595042 R 284812 CDS SPCC13B11.04c 19075747 2538802 complement(join(1597415..1598530,1598570..1598596)) 1 NC_003421.2 glutathione-dependent formaldehyde dehydrogenase (predicted) 1598596 2538802 SPCC13B11.04c Schizosaccharomyces pombe 972h- glutathione-dependent formaldehyde dehydrogenase (predicted) NP_588247.1 1597415 R 284812 CDS SPCC777.02 63054445 2538869 join(1598981..1599054,1599267..1599291,1599374..1601173) 1 NC_003421.2 09.07.02 added N-terminal exon to extend homology. perhaps pseudo; 28.10.03 replaced N terminal exon with 2 better exons, still not sure its correct but it looks better than before; transcription factor (predicted) 1601173 2538869 SPCC777.02 Schizosaccharomyces pombe 972h- transcription factor (predicted) NP_588248.2 1598981 D 284812 CDS SPCC777.03c 19075749 2538693 complement(1601512..1602702) 1 NC_003421.2 region appears to be a duplication of a region of chromosome I cosmid c11D3, region encompasses SPCC777.02 & SPC777.03; nifs homolog 1602702 2538693 SPCC777.03c Schizosaccharomyces pombe 972h- nifs homolog NP_588249.1 1601512 R 284812 CDS SPCC777.04 19075750 2539583 1602954..1604519 1 NC_003421.2 amino acid transporter (predicted) 1604519 2539583 SPCC777.04 Schizosaccharomyces pombe 972h- amino acid transporter (predicted) NP_588250.1 1602954 D 284812 CDS SPCC777.05 19075751 2539088 join(1605132..1605271,1605353..1606157) 1 NC_003421.2 Gtr1/RagA G protein Gtr2 1606157 gtr2 2539088 gtr2 Schizosaccharomyces pombe 972h- Gtr1/RagA G protein Gtr2 NP_588251.1 1605132 D 284812 CDS SPCC777.06c 19075752 2538874 complement(join(1606665..1607233,1607396..1607732)) 1 NC_003421.2 hydrolase (predicted) 1607732 2538874 SPCC777.06c Schizosaccharomyces pombe 972h- hydrolase (predicted) NP_588252.1 1606665 R 284812 CDS SPCC777.07 19075753 2539591 join(1609810..1610414,1610495..1611026) 1 NC_003421.2 alpha-1,2-mannosyltransferase (predicted) 1611026 2539591 SPCC777.07 Schizosaccharomyces pombe 972h- alpha-1,2-mannosyltransferase (predicted) NP_588253.1 1609810 D 284812 CDS SPCC777.08c 19075754 2538963 complement(1611296..1612564) 1 NC_003421.2 TORC2 subunit Bit61 1612564 bit61 2538963 bit61 Schizosaccharomyces pombe 972h- TORC2 subunit Bit61 NP_588254.1 1611296 R 284812 CDS SPCC777.09c 19075755 2538726 complement(join(1613324..1614577,1614826..1614897)) 1 NC_003421.2 acetylornithine aminotransferase 1614897 arg1 2538726 arg1 Schizosaccharomyces pombe 972h- acetylornithine aminotransferase NP_588255.1 1613324 R 284812 CDS SPCC777.10c 19075756 2539416 complement(join(1615079..1615188,1615436..1615583,1615695..1615783,1615866..1615961,1616028..1616118)) 1 NC_003421.2 NEDD8-conjugating enzyme Ubc12 1616118 ubc12 2539416 ubc12 Schizosaccharomyces pombe 972h- NEDD8-conjugating enzyme Ubc12 NP_588256.1 1615079 R 284812 CDS SPCC777.11 19075757 2539590 1616663..1617049 1 NC_003421.2 sequence orphan 1617049 2539590 SPCC777.11 Schizosaccharomyces pombe 972h- sequence orphan NP_588257.1 1616663 D 284812 CDS SPCC777.12c 19075758 2538879 complement(join(1617210..1617647,1617768..1618046)) 1 NC_003421.2 thioredoxin family protein 1618046 2538879 SPCC777.12c Schizosaccharomyces pombe 972h- thioredoxin family protein NP_588258.1 1617210 R 284812 CDS SPCC777.17c 19075759 2538814 complement(join(1618574..1618713,1618844..1618919,1618969..1619058)) 1 NC_003421.2 mitochondrial ribosomal protein subunit L9 (predicted) 1619058 2538814 SPCC777.17c Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit L9 (predicted) NP_588259.1 1618574 R 284812 CDS SPCC777.13 19075760 2539462 join(1619709..1621163,1621204..1621317,1621361..1621710,1621765..1621822,1621870..1621944,1622032..1622337) 1 NC_003421.2 retromer complex subunit Vps35 1622337 vps35 2539462 vps35 Schizosaccharomyces pombe 972h- retromer complex subunit Vps35 NP_588260.1 1619709 D 284812 CDS SPCC777.14 19075761 2539312 join(1622737..1623730,1623839..1624278) 1 NC_003421.2 serine/threonine protein kinase Prp4 1624278 prp4 2539312 prp4 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Prp4 NP_588261.1 1622737 D 284812 CDS SPCC777.15 19075762 2538996 1624702..1625682 1 NC_003421.2 tRNA dihydrouridine synthase Dus4 (predicted) 1625682 2538996 SPCC777.15 Schizosaccharomyces pombe 972h- tRNA dihydrouridine synthase Dus4 (predicted) NP_588262.1 1624702 D 284812 CDS SPCC663.01c 63054446 2539511 complement(join(1626547..1626561,1626619..1629120)) 1 NC_003421.2 protein phosphatase regulatory subunit Ekc1 (predicted) 1629120 ekc1 2539511 ekc1 Schizosaccharomyces pombe 972h- protein phosphatase regulatory subunit Ekc1 (predicted) NP_588263.2 1626547 R 284812 CDS SPCC663.02 19075764 2539400 join(1630438..1630567,1630639..1630863,1630913..1631226) 1 NC_003421.2 wtf element Wtf14 1631226 wtf14 2539400 wtf14 Schizosaccharomyces pombe 972h- wtf element Wtf14 NP_588264.1 1630438 D 284812 CDS SPCC663.03 19075765 2538709 1635974..1640062 1 NC_003421.2 leptomycin efflux transporter Pmd1 1640062 pmd1 2538709 pmd1 Schizosaccharomyces pombe 972h- leptomycin efflux transporter Pmd1 NP_588265.1 1635974 D 284812 CDS SPCC663.04 19075766 2539277 1641021..1641176 1 NC_003421.2 60S ribosomal protein L39 1641176 rpl39 2539277 rpl39 Schizosaccharomyces pombe 972h- 60S ribosomal protein L39 NP_588266.1 1641021 D 284812 CDS SPCC663.05c 19075767 2539568 complement(1643767..1644555) 1 NC_003421.2 histone chaperone Cia1 1644555 cia1 2539568 cia1 Schizosaccharomyces pombe 972h- histone chaperone Cia1 NP_588267.1 1643767 R 284812 CDS SPCC663.06c 19075768 2539138 complement(1645115..1645876) 1 NC_003421.2 there are 4 tandem copies of this hypothetical protein one (SPCC663.07 ) is frameshifted and has been labelled as a pseudogene; short chain dehydrogenase (predicted) 1645876 2539138 SPCC663.06c Schizosaccharomyces pombe 972h- short chain dehydrogenase (predicted) NP_588268.1 1645115 R 284812 CDS SPCC663.08c 19075769 2538733 complement(1648000..1648761) 1 NC_003421.2 there are 4 tandem copies of this hypo thetical protein, one (SPCC663.07) is frameshifted and has been labelled as a pseudogene); short chain dehydrogenase (predicted) 1648761 2538733 SPCC663.08c Schizosaccharomyces pombe 972h- short chain dehydrogenase (predicted) NP_588269.1 1648000 R 284812 CDS SPCC663.09c 19075770 2539052 complement(1649528..1650289) 1 NC_003421.2 there are 4 tandem copies of this hypothetical protein, one (SPCC663.07 ) is frameshifted and has been labelled as a pseudogene); short chain dehydrogenase (predicted) 1650289 2539052 SPCC663.09c Schizosaccharomyces pombe 972h- short chain dehydrogenase (predicted) NP_588270.1 1649528 R 284812 CDS SPCC663.10 19075771 2538705 1651272..1652780 1 NC_003421.2 methyltransferase, DUF1613 family (predicted) 1652780 2538705 SPCC663.10 Schizosaccharomyces pombe 972h- methyltransferase, DUF1613 family (predicted) NP_588271.1 1651272 D 284812 CDS SPCC663.11 19075772 2539395 1653876..1654712 1 NC_003421.2 Dre4 Interacting Factor; ww domain binding protein 11 (wbp11) ortholog 1654712 2539395 SPCC663.11 Schizosaccharomyces pombe 972h- ww domain binding protein 11 (wbp11) ortholog NP_588272.1 1653876 D 284812 CDS SPCC663.12 19075773 2539423 1655669..1656679 1 NC_003421.2 poly(A) polymerase Cid12 1656679 cid12 2539423 cid12 Schizosaccharomyces pombe 972h- poly(A) polymerase Cid12 NP_588273.1 1655669 D 284812 CDS SPCC663.13c 19075774 2539534 complement(1657082..1657516) 1 NC_003421.2 N-acetyltransferase (predicted) 1657516 2539534 SPCC663.13c Schizosaccharomyces pombe 972h- N-acetyltransferase (predicted) NP_588274.1 1657082 R 284812 CDS SPCC663.14c 19075775 2539514 complement(join(1657631..1658545,1658635..1659783)) 1 NC_003421.2 TRP-like ion channel 1659783 2539514 SPCC663.14c Schizosaccharomyces pombe 972h- TRP-like ion channel NP_588275.1 1657631 R 284812 CDS SPCC663.15c 19075776 2539427 complement(1660282..1662255) 1 NC_003421.2 conserved fungal protein 1662255 2539427 SPCC663.15c Schizosaccharomyces pombe 972h- conserved fungal protein NP_588276.1 1660282 R 284812 CDS SPCC1902.02 19075777 2539333 complement(join(1662895..1664417,1664483..1664644,1664759..1664798)) 1 NC_003421.2 ketopantoate reductase (predicted) 1664798 mug72 2539333 mug72 Schizosaccharomyces pombe 972h- ketopantoate reductase (predicted) NP_588277.1 1662895 R 284812 CDS SPCC1902.01 63054447 2539024 complement(1666310..1668877) 1 NC_003421.2 orthologous to S. cerevisiae YFL021W but missing conserved N-terminal domain; transcription factor Gaf1 1668877 gaf1 2539024 gaf1 Schizosaccharomyces pombe 972h- transcription factor Gaf1 NP_588278.2 1666310 R 284812 CDS SPCC417.02 19075779 2539507 complement(1670321..1670605) 1 NC_003421.2 DASH complex subunit Dad5 1670605 dad5 2539507 dad5 Schizosaccharomyces pombe 972h- DASH complex subunit Dad5 NP_588279.1 1670321 R 284812 CDS SPCC417.03 19075780 2539422 join(1672003..1672051,1672111..1672364) 1 NC_003421.2 sequence orphan 1672364 2539422 SPCC417.03 Schizosaccharomyces pombe 972h- sequence orphan NP_588280.1 1672003 D 284812 CDS SPCC417.04 19075781 2539532 1673314..1673856 1 NC_003421.2 dubious 1673856 2539532 SPCC417.04 Schizosaccharomyces pombe 972h- dubious NP_588281.1 1673314 D 284812 CDS SPCC417.05c 19075782 2539493 complement(1675418..1676956) 1 NC_003421.2 chitin synthase regulatory factor Chr2 (predicted) 1676956 chr2 2539493 chr2 Schizosaccharomyces pombe 972h- chitin synthase regulatory factor Chr2 (predicted) NP_588282.1 1675418 R 284812 CDS SPCC417.06c 19075783 2539482 complement(join(1677471..1678286,1678329..1678778,1678828..1679436)) 1 NC_003421.2 meiosis specific protein kinase Mug27/Slk1 1679436 mug27 2539482 mug27 Schizosaccharomyces pombe 972h- meiosis specific protein kinase Mug27/Slk1 NP_588283.1 1677471 R 284812 CDS SPCC417.07c 19075784 2539467 complement(1679924..1683271) 1 NC_003421.2 primary name changed; pers. comm. S. Venkatram; date=20050415; MT organizer Mto1 1683271 mto1 2539467 mto1 Schizosaccharomyces pombe 972h- MT organizer Mto1 NP_588284.1 1679924 R 284812 CDS SPCC417.08 19075785 2539295 1685666..1688809 1 NC_003421.2 translation elongation factor eEF3 1688809 tef3 2539295 tef3 Schizosaccharomyces pombe 972h- translation elongation factor eEF3 NP_588285.1 1685666 D 284812 CDS SPCC417.09c 19075786 2538965 complement(join(1691782..1692727,1692827..1693416,1693516..1693936,1694086..1694432)) 1 NC_003421.2 transcription factor (predicted) 1694432 2538965 SPCC417.09c Schizosaccharomyces pombe 972h- transcription factor (predicted) NP_588286.1 1691782 R 284812 CDS SPCC417.10 19075787 2539419 1695726..1697252 1 NC_003421.2 membrane transporter 1697252 2539419 SPCC417.10 Schizosaccharomyces pombe 972h- membrane transporter NP_588287.1 1695726 D 284812 CDS SPCC417.11c 19075788 2539111 complement(1698190..1699497) 1 NC_003421.2 glutamate-1-semialdehyde 2,1-aminomutaseaminotransferase (predicted) 1699497 2539111 SPCC417.11c Schizosaccharomyces pombe 972h- glutamate-1-semialdehyde 2,1-aminomutaseaminotransferase (predicted) NP_588288.1 1698190 R 284812 CDS SPCC417.12 19075789 2539430 1699739..1701301 1 NC_003421.2 carboxylesterase-lipase family protein 1701301 2539430 SPCC417.12 Schizosaccharomyces pombe 972h- carboxylesterase-lipase family protein NP_588289.1 1699739 D 284812 CDS SPCC417.15 162312123 5802723 complement(1702711..1702842) 1 NC_003421.2 dubious 1702842 5802723 SPCC417.15 Schizosaccharomyces pombe 972h- dubious XP_001713169.1 1702711 R 284812 CDS SPCC191.01 19075790 2539404 1706461..1706997 1 NC_003421.2 sequence orphan 1706997 2539404 SPCC191.01 Schizosaccharomyces pombe 972h- sequence orphan NP_588290.1 1706461 D 284812 CDS SPCC191.02c 63054448 2539546 complement(1708234..1710222) 1 NC_003421.2 acetyl-CoA ligase (predicted) 1710222 2539546 SPCC191.02c Schizosaccharomyces pombe 972h- acetyl-CoA ligase (predicted) NP_588291.2 1708234 R 284812 CDS SPCC191.03c 19075792 2539193 complement(1710941..1711294) 1 NC_003421.2 sequence orphan 1711294 2539193 SPCC191.03c Schizosaccharomyces pombe 972h- sequence orphan NP_588292.1 1710941 R 284812 CDS SPCC191.04c 19075793 2539254 complement(1711522..1711824) 1 NC_003421.2 dubious 1711824 2539254 SPCC191.04c Schizosaccharomyces pombe 972h- dubious NP_588293.1 1711522 R 284812 CDS SPCC191.05c 19075794 2538933 complement(1712319..1712954) 1 NC_003421.2 nucleoside 2-deoxyribosyltransferase (predicted) 1712954 2538933 SPCC191.05c Schizosaccharomyces pombe 972h- nucleoside 2-deoxyribosyltransferase (predicted) NP_588294.1 1712319 R 284812 CDS SPCC191.06 19075795 2538865 1714139..1714555 1 NC_003421.2 has transcript profile on microarray; sequence orphan 1714555 2538865 SPCC191.06 Schizosaccharomyces pombe 972h- sequence orphan NP_588295.1 1714139 D 284812 CDS SPCC191.07 19075796 2539146 1714735..1715064 1 NC_003421.2 cytochrome c (predicted) 1715064 cyc1 2539146 cyc1 Schizosaccharomyces pombe 972h- cytochrome c (predicted) NP_588296.1 1714735 D 284812 CDS SPCC191.08 19075797 2539204 1716751..1717155 1 NC_003421.2 DUF1715 family protein 1717155 2539204 SPCC191.08 Schizosaccharomyces pombe 972h- DUF1715 family protein NP_588297.1 1716751 D 284812 CDS SPCC191.09c 19075798 2538694 complement(1719325..1720014) 1 NC_003421.2 glutathione S-transferase Gst1 1720014 gst1 2538694 gst1 Schizosaccharomyces pombe 972h- glutathione S-transferase Gst1 NP_588298.1 1719325 R 284812 CDS SPCC191.10 19075799 2538831 1721828..1722277 1 NC_003421.2 sequence orphan 1722277 2538831 SPCC191.10 Schizosaccharomyces pombe 972h- sequence orphan NP_588299.1 1721828 D 284812 CDS SPCC191.11 19075800 2539227 1724306..1726051 1 NC_003421.2 beta-fructofuranosidase 1726051 inv1 2539227 inv1 Schizosaccharomyces pombe 972h- beta-fructofuranosidase NP_588300.1 1724306 D 284812 CDS SPCC1450.02 63054449 2538955 1728861..1730597 1 NC_003421.2 Swr1 complex bromodomain subunit Brf1 1730597 bdf1 2538955 bdf1 Schizosaccharomyces pombe 972h- Swr1 complex bromodomain subunit Brf1 NP_588301.2 1728861 D 284812 CDS SPCC1450.03 19075802 2539316 1731429..1732151 1 NC_003421.2 ribonucleoprotein (RNP) complex (predicted) 1732151 2539316 SPCC1450.03 Schizosaccharomyces pombe 972h- ribonucleoprotein (RNP) complex (predicted) NP_588302.1 1731429 D 284812 CDS SPCC1450.04 19075803 2539275 join(1732774..1732853,1733101..1733665) 1 NC_003421.2 translation elongation factor EF-1 beta subunit (eEF1B) 1733665 tef5 2539275 tef5 Schizosaccharomyces pombe 972h- translation elongation factor EF-1 beta subunit (eEF1B) NP_588303.1 1732774 D 284812 CDS SPCC1450.05c 19075804 2539249 complement(1734767..1735183) 1 NC_003421.2 mediator complex subunit Med19/Rox3 1735183 rox3 2539249 rox3 Schizosaccharomyces pombe 972h- mediator complex subunit Med19/Rox3 NP_588304.1 1734767 R 284812 CDS SPCC1450.06c 19075805 2539000 complement(1735427..1735927) 1 NC_003421.2 monothiol glutaredoxin Grx3 1735927 grx3 2539000 grx3 Schizosaccharomyces pombe 972h- monothiol glutaredoxin Grx3 NP_588305.1 1735427 R 284812 CDS SPCC1450.07c 19075806 2539033 complement(1736606..1737652) 1 NC_003421.2 D-amino acid oxidase (predicted) 1737652 2539033 SPCC1450.07c Schizosaccharomyces pombe 972h- D-amino acid oxidase (predicted) NP_588306.1 1736606 R 284812 CDS SPCC1450.08c 19075807 2539156 complement(join(1739338..1739789,1739835..1740047,1740097..1740342,1740510..1740648)) 1 NC_003421.2 splice prediction may be incorrect; wtf element Wtf16 1740648 wtf16 2539156 wtf16 Schizosaccharomyces pombe 972h- wtf element Wtf16 NP_588307.1 1739338 R 284812 CDS SPCC1450.09c 295442779 2539134 complement(1741588..1743459) 1 NC_003421.2 phospholipase (predicted) 1743459 2539134 SPCC1450.09c Schizosaccharomyces pombe 972h- phospholipase (predicted) NP_588308.2 1741588 R 284812 CDS SPCC1450.10c 19075809 2538783 complement(join(1746294..1747817,1747896..1747988)) 1 NC_003421.2 iron hydrogenase (predicted) 1747988 2538783 SPCC1450.10c Schizosaccharomyces pombe 972h- iron hydrogenase (predicted) NP_588309.1 1746294 R 284812 CDS SPCC1450.11c 19075810 2539208 complement(1748633..1752649) 1 NC_003421.2 serine/threonine protein kinase Cek1 1752649 cek1 2539208 cek1 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Cek1 NP_588310.1 1748633 R 284812 CDS SPCC1450.12 19075811 2538982 join(1754287..1754565,1754634..1754927,1755051..1755558,1755636..1756369,1756557..1757207) 1 NC_003421.2 conserved fungal protein 1757207 2538982 SPCC1450.12 Schizosaccharomyces pombe 972h- conserved fungal protein NP_588311.1 1754287 D 284812 CDS SPCC1450.13c 19075812 2539183 complement(1757487..1758113) 1 NC_003421.2 riboflavin synthase 1758113 2539183 SPCC1450.13c Schizosaccharomyces pombe 972h- riboflavin synthase NP_588312.1 1757487 R 284812 CDS SPCC1450.14c 295442781 2539325 complement(1759295..1760998) 1 NC_003421.2 ER oxidoreductin Ero1b 1760998 ero12 2539325 ero12 Schizosaccharomyces pombe 972h- ER oxidoreductin Ero1b NP_588313.2 1759295 R 284812 CDS SPCC1450.15 19075814 2539289 join(1761516..1761584,1761635..1763077) 1 NC_003421.2 looks like a gene merge but was sequenced independently in redundant clone c1100; pig-F (predicted) 1763077 2539289 SPCC1450.15 Schizosaccharomyces pombe 972h- pig-F (predicted) NP_588314.1 1761516 D 284812 CDS SPCC1450.16c 19075815 2539335 complement(1763497..1765038) 1 NC_003421.2 triacylglycerol lipase 1765038 2539335 SPCC1450.16c Schizosaccharomyces pombe 972h- triacylglycerol lipase NP_588315.1 1763497 R 284812 CDS SPCC1442.01 19075816 2538724 1766086..1768821 1 NC_003421.2 guanyl-nucleotide exchange factor Ste6 1768821 ste6 2538724 ste6 Schizosaccharomyces pombe 972h- guanyl-nucleotide exchange factor Ste6 NP_588316.1 1766086 D 284812 CDS SPCC1442.02 19075817 2538698 join(1768993..1769166,1769224..1770738) 1 NC_003421.2 central kinetochore associated protein (predicted) 1770738 2538698 SPCC1442.02 Schizosaccharomyces pombe 972h- central kinetochore associated protein (predicted) NP_588317.1 1768993 D 284812 CDS SPCC1442.03 19075818 2538899 join(1771492..1771887,1772011..1772631) 1 NC_003421.2 mitochondrial ATP-Mg/Pi carrier (predicted) 1772631 2538899 SPCC1442.03 Schizosaccharomyces pombe 972h- mitochondrial ATP-Mg/Pi carrier (predicted) NP_588318.1 1771492 D 284812 CDS SPCC1442.04c 295442783 3361128 complement(join(1773925..1774239,1774236..1775429)) 1 NC_003421.2 WARNING there are 4 bases missing from this sequence AACATCTTCCAAGTTCTCAT GATC CTTTAAAGATTCCTCAAGGT, which will change the C-terminal region slightly. This will be fixed in the next round of corrections; term=frameshifted; date=20090202; PMID:16823372 predict a frameshift at base 1194; meiotic recombination protein (predicted) 1775429 3361128 SPCC1442.04c Schizosaccharomyces pombe 972h- meiotic recombination protein (predicted) NP_001018853.3 1773925 R 284812 CDS SPCC1442.05c 19075819 2538857 complement(1776594..1777127) 1 NC_003421.2 mitochondrial protein 1777127 2538857 SPCC1442.05c Schizosaccharomyces pombe 972h- mitochondrial protein NP_588319.1 1776594 R 284812 CDS SPCC1442.06 19075820 2539026 join(1778156..1778270,1778367..1778470,1778540..1778694,1778832..1779195) 1 NC_003421.2 20S proteasome component alpha 2, Pre8 (predicted) 1779195 pre8 2539026 pre8 Schizosaccharomyces pombe 972h- 20S proteasome component alpha 2, Pre8 (predicted) NP_588320.1 1778156 D 284812 CDS SPCC1442.07c 19075821 2538751 complement(1779612..1780460) 1 NC_003421.2 ubiquitin/metalloprotease fusion protein 1780460 2538751 SPCC1442.07c Schizosaccharomyces pombe 972h- ubiquitin/metalloprotease fusion protein NP_588321.1 1779612 R 284812 CDS SPCC1442.08c 295442785 2538835 complement(join(1781505..1781563,1781637..1781744,1781830..1781855,1781920..1781935,1781981..1782032)) 1 NC_003421.2 cytochrome c oxidase subunit VIb (predicted) 1782032 cox12 2538835 cox12 Schizosaccharomyces pombe 972h- cytochrome c oxidase subunit VIb (predicted) NP_588322.2 1781505 R 284812 CDS SPCC1442.09 19075823 2538842 join(1783786..1783791,1783975..1785438) 1 NC_003421.2 anthranilate synthase component I 1785438 trp3 2538842 trp3 Schizosaccharomyces pombe 972h- anthranilate synthase component I NP_588323.1 1783786 D 284812 CDS SPCC1442.10c 19075824 2538816 complement(join(1785998..1786761,1786808..1786857,1786900..1786979)) 1 NC_003421.2 The Rpb2p-Rpb3p-Rpb11p complex has DNA binding activity. Alone, Rpb3p exhibits virtually no DNA binding activity (PMID:9325316); RNA polymerase II subunit 3 1786979 rpb3 2538816 rpb3 Schizosaccharomyces pombe 972h- RNA polymerase II subunit 3 NP_588324.1 1785998 R 284812 CDS SPCC1442.19 295442787 9407293 join(1787290..1787429,1787611..1787878) 1 NC_003421.2 mitochondrial ribosomal protein Mrp49 1787878 9407293 SPCC1442.19 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein Mrp49 XP_002788951.1 1787290 D 284812 CDS SPCC1442.11c 19075825 2539068 complement(1788002..1788550) 1 NC_003421.2 sequence orphan 1788550 2539068 SPCC1442.11c Schizosaccharomyces pombe 972h- sequence orphan NP_588325.1 1788002 R 284812 CDS SPCC1442.12 19075826 2538911 join(1789596..1789717,1789805..1790036,1790320..1790718) 1 NC_003421.2 phosphatidylserine synthase Pps1 1790718 pps1 2538911 pps1 Schizosaccharomyces pombe 972h- phosphatidylserine synthase Pps1 NP_588326.1 1789596 D 284812 CDS SPCC1442.13c 295442789 2539327 complement(1791346..1791909) 1 NC_003421.2 C terminal exon added 15.04.2002; old coordinates (26947..27936); new exon extends G-patch domain; 03-12-07 removed this exon as not confirmed by homology or Solexa intron data; RNA-binding protein, G-patch type 1791909 2539327 SPCC1442.13c Schizosaccharomyces pombe 972h- RNA-binding protein, G-patch type NP_588327.3 1791346 R 284812 CDS SPCC1442.14c 19075828 2538824 complement(1792837..1793238) 1 NC_003421.2 adenosine 5'-monophosphoramidase 1793238 2538824 SPCC1442.14c Schizosaccharomyces pombe 972h- adenosine 5'-monophosphoramidase NP_588328.1 1792837 R 284812 CDS SPCC1442.15c 19075829 2539132 complement(1793766..1794374) 1 NC_003421.2 mitochondrial inner membrane protein Cox18 1794374 cox18 2539132 cox18 Schizosaccharomyces pombe 972h- mitochondrial inner membrane protein Cox18 NP_588329.1 1793766 R 284812 CDS SPCC1442.16c 19075830 2538826 complement(1794979..1795968) 1 NC_003421.2 NADPH quinone oxidoreductase/ARE-binding protein (predicted) 1795968 zta1 2538826 zta1 Schizosaccharomyces pombe 972h- NADPH quinone oxidoreductase/ARE-binding protein (predicted) NP_588330.1 1794979 R 284812 CDS SPCC1442.17c 19075831 2539003 complement(join(1796281..1796682,1796758..1796838,1796908..1797240)) 1 NC_003421.2 MVB sorting pathway protein (predicted) 1797240 ist1 2539003 ist1 Schizosaccharomyces pombe 972h- MVB sorting pathway protein (predicted) NP_588331.1 1796281 R 284812 CDS SPCC285.03 19075832 2538809 1797992..1799806 1 NC_003421.2 ATP-dependent RNA helicase Dbp6 1799806 2538809 SPCC285.03 Schizosaccharomyces pombe 972h- ATP-dependent RNA helicase Dbp6 NP_588332.1 1797992 D 284812 CDS SPCC285.04 19075833 2539256 1801071..1801445 1 NC_003421.2 transthyretin (predicted) 1801445 2539256 SPCC285.04 Schizosaccharomyces pombe 972h- transthyretin (predicted) NP_588333.1 1801071 D 284812 CDS SPCC285.05 19075834 2539334 1802662..1803708 1 NC_003421.2 purine nucleoside transporter (predicted) 1803708 2539334 SPCC285.05 Schizosaccharomyces pombe 972h- purine nucleoside transporter (predicted) NP_588334.1 1802662 D 284812 CDS SPCC285.07c 19075835 2539091 complement(join(1807004..1807476,1807513..1807836,1807885..1808157,1808396..1808534)) 1 NC_003421.2 wtf element Wtf18 1808534 wtf18 2539091 wtf18 Schizosaccharomyces pombe 972h- wtf element Wtf18 NP_588335.1 1807004 R 284812 CDS SPCC285.08 19075836 2538953 join(1809365..1809367,1809412..1809451,1809510..1809913,1809984..1810259) 1 NC_003421.2 S. pombe gene appears to be truncated ***possible deletion check***; coatomer delta subunit Ret2 (predicted) 1810259 ret2 2538953 ret2 Schizosaccharomyces pombe 972h- coatomer delta subunit Ret2 (predicted) NP_588336.1 1809365 D 284812 CDS SPCC285.09c 19075837 2539207 complement(join(1811032..1811560,1812013..1812425,1812472..1812480,1812542..1812631)) 1 NC_003421.2 cAMP-specific phosphodiesterase Cgs2 1812631 cgs2 2539207 cgs2 Schizosaccharomyces pombe 972h- cAMP-specific phosphodiesterase Cgs2 NP_588337.1 1811032 R 284812 CDS SPCC285.10c 19075838 2539213 complement(1814335..1815483) 1 NC_003421.2 SPRY domain protein 1815483 2539213 SPCC285.10c Schizosaccharomyces pombe 972h- SPRY domain protein NP_588338.1 1814335 R 284812 CDS SPCC285.11 19075839 2539260 join(1816102..1816209,1816397..1817572) 1 NC_003421.2 UBA/UAS domain protein Ucp10 1817572 ucp10 2539260 ucp10 Schizosaccharomyces pombe 972h- UBA/UAS domain protein Ucp10 NP_588339.1 1816102 D 284812 CDS SPCC285.12 19075840 2538964 join(1818424..1818473,1818528..1818819) 1 NC_003421.2 U6 snRNP-associated protein Lsm7 1818819 lsm7 2538964 lsm7 Schizosaccharomyces pombe 972h- U6 snRNP-associated protein Lsm7 NP_588340.1 1818424 D 284812 CDS SPCC285.13c 19075841 2538801 complement(1819117..1821327) 1 NC_003421.2 nucleoporin Nup60 (predicted) 1821327 2538801 SPCC285.13c Schizosaccharomyces pombe 972h- nucleoporin Nup60 (predicted) NP_588341.1 1819117 R 284812 CDS SPCC285.14 19075842 2538961 join(1823374..1823401,1823451..1823677,1823766..1825436,1825481..1825906,1825949..1827049) 1 NC_003421.2 TRAPP complex subunit Trs130 (predicted) 1827049 2538961 SPCC285.14 Schizosaccharomyces pombe 972h- TRAPP complex subunit Trs130 (predicted) NP_588342.1 1823374 D 284812 CDS SPCC285.15c 19075843 2539085 complement(join(1827104..1827242,1827293..1827360)) 1 NC_003421.2 40S ribosomal protein S28 1827360 rps2802 2539085 rps2802 Schizosaccharomyces pombe 972h- 40S ribosomal protein S28 NP_588343.1 1827104 R 284812 CDS SPCC285.16c 19075844 2539215 complement(join(1827802..1830972,1831088..1831681)) 1 NC_003421.2 MutS protein homolog 1831681 msh6 2539215 msh6 Schizosaccharomyces pombe 972h- MutS protein homolog NP_588344.1 1827802 R 284812 CDS SPCC285.17 19075845 2539310 join(1831983..1832175,1832248..1832459,1832593..1832742,1832914..1833060) 1 NC_003421.2 RNA polymerase I upstream activation factor complex subunit Spp27 1833060 spp27 2539310 spp27 Schizosaccharomyces pombe 972h- RNA polymerase I upstream activation factor complex subunit Spp27 NP_588345.1 1831983 D 284812 CDS SPCC1223.01 63054452 2539079 join(1834613..1834709,1834755..1834952,1835011..1836914) 1 NC_003421.2 ubiquitin-protein ligase E3 (predicted) 1836914 2539079 SPCC1223.01 Schizosaccharomyces pombe 972h- ubiquitin-protein ligase E3 (predicted) NP_588346.2 1834613 D 284812 CDS SPCC1223.02 19075847 2539108 1838485..1839525 1 NC_003421.2 no message in thiamine Nmt1 1839525 nmt1 2539108 nmt1 Schizosaccharomyces pombe 972h- no message in thiamine Nmt1 NP_588347.1 1838485 D 284812 CDS SPCC1223.03c 19075848 2539217 complement(1840687..1842636) 1 NC_003421.2 glycerol-3-phosphate dehydrogenase Gut2 1842636 gut2 2539217 gut2 Schizosaccharomyces pombe 972h- glycerol-3-phosphate dehydrogenase Gut2 NP_588348.1 1840687 R 284812 CDS SPCC1223.04c 19075849 2539232 complement(join(1844960..1845973,1846063..1846194)) 1 NC_003421.2 ribosomal protein lysine methyltransferase Set11 1846194 set11 2539232 set11 Schizosaccharomyces pombe 972h- ribosomal protein lysine methyltransferase Set11 NP_588349.1 1844960 R 284812 CDS SPCC1223.15c 162312127 5802726 complement(join(1846215..1846613,1846663..1846705,1846746..1846762)) 1 NC_003421.2 DASH complex subunit Spc19 1846762 spc19 5802726 spc19 Schizosaccharomyces pombe 972h- DASH complex subunit Spc19 XP_001713170.1 1846215 R 284812 CDS SPCC1223.05c 19075850 2538715 complement(join(1847518..1847558,1847619..1847853)) 1 NC_003421.2 60S ribosomal protein L37 1847853 rpl3702 2538715 rpl3702 Schizosaccharomyces pombe 972h- 60S ribosomal protein L37 NP_588350.1 1847518 R 284812 CDS SPCC1223.06 19075851 2539047 1849018..1852461 1 NC_003421.2 cell end marker Tea1 1852461 tea1 2539047 tea1 Schizosaccharomyces pombe 972h- cell end marker Tea1 NP_588351.1 1849018 D 284812 CDS SPCC1223.07c 19075852 2539278 complement(join(1852712..1854377,1854436..1854512)) 1 NC_003421.2 cytoplasmic aspartate-tRNA ligase Drs1 (predicted) 1854512 drs1 2539278 drs1 Schizosaccharomyces pombe 972h- cytoplasmic aspartate-tRNA ligase Drs1 (predicted) NP_588352.1 1852712 R 284812 CDS SPCC1223.08c 19075853 2539048 join(1855469..1855502,1855705..1857056) 1 NC_003421.2 dihydrofolate reductase Dfr1 1857056 dfr1 2539048 dfr1 Schizosaccharomyces pombe 972h- dihydrofolate reductase Dfr1 NP_588353.1 1855469 D 284812 CDS SPCC1223.09 19075854 2538957 complement(1857343..1858233) 1 NC_003421.2 uricase (predicted) 1858233 2538957 SPCC1223.09 Schizosaccharomyces pombe 972h- uricase (predicted) NP_588354.1 1857343 R 284812 CDS SPCC1223.10c 162312129 2539104 complement(join(1860767..1861258,1861383..1861469,1861635..1861726,1861829..1861913)) 1 NC_003421.2 sequence update pending; RNA polymerase II transcription elongation factor SpEAF 1861913 eaf1 2539104 eaf1 Schizosaccharomyces pombe 972h- RNA polymerase II transcription elongation factor SpEAF XP_001713171.1 1860767 R 284812 CDS SPCC1223.11 19075856 2539252 1863757..1864869 1 NC_003421.2 protein phosphatase 2C Ptc2 1864869 ptc2 2539252 ptc2 Schizosaccharomyces pombe 972h- protein phosphatase 2C Ptc2 NP_588356.1 1863757 D 284812 CDS SPCC1223.12c 19075857 2539046 complement(1868480..1869730) 1 NC_003421.2 GPI anchored cell surface protein (predicted) 1869730 meu10 2539046 meu10 Schizosaccharomyces pombe 972h- GPI anchored cell surface protein (predicted) NP_588357.1 1868480 R 284812 CDS SPCC1223.13 19075858 2539119 1871750..1874641 1 NC_003421.2 CBF1/Su(H)/LAG-1 family transcription factor Cbf12 1874641 cbf12 2539119 cbf12 Schizosaccharomyces pombe 972h- CBF1/Su(H)/LAG-1 family transcription factor Cbf12 NP_588358.1 1871750 D 284812 CDS SPCC1223.14 63054453 2538817 1876299..1877486 1 NC_003421.2 chorismate synthase (predicted) 1877486 2538817 SPCC1223.14 Schizosaccharomyces pombe 972h- chorismate synthase (predicted) NP_588359.2 1876299 D 284812 CDS SPCC297.03 19075860 2538951 1878714..1880672 1 NC_003421.2 serine/threonine protein kinase Ssp1 1880672 ssp1 2538951 ssp1 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Ssp1 NP_588360.1 1878714 D 284812 CDS SPCC297.04c 19075861 2539127 complement(join(1881316..1881726,1882040..1882072)) 1 NC_003421.2 histone lysine methyltransferase Set7 (predicted) 1882072 set7 2539127 set7 Schizosaccharomyces pombe 972h- histone lysine methyltransferase Set7 (predicted) NP_588361.1 1881316 R 284812 CDS SPCC297.05 19075862 2539220 1882768..1885689 1 NC_003421.2 diacylglycerol binding protein (predicted) 1885689 2539220 SPCC297.05 Schizosaccharomyces pombe 972h- diacylglycerol binding protein (predicted) NP_588362.1 1882768 D 284812 CDS SPCC297.06c 63054454 2539229 complement(1885962..1886654) 1 NC_003421.2 was previously annotated as ribosomal protein based on SGD Mrp8, but there is no evidence for this assignment from experimentation or sequence similarity; conserved fungal protein 1886654 2539229 SPCC297.06c Schizosaccharomyces pombe 972h- conserved fungal protein NP_588363.2 1885962 R 284812 CDS SPCC737.02c 19075864 2539439 complement(1887542..1887955) 1 NC_003421.2 ubiquinol-cytochrome-c reductase complex subunit 6 1887955 qcr7 2539439 qcr7 Schizosaccharomyces pombe 972h- ubiquinol-cytochrome-c reductase complex subunit 6 NP_588364.1 1887542 R 284812 CDS SPCC737.03c 19075865 2539185 complement(1888625..1890472) 1 NC_003421.2 Inner MTOC Attachment Site; integral inner nuclear membrane protein Ima1 1890472 ima1 2539185 ima1 Schizosaccharomyces pombe 972h- integral inner nuclear membrane protein Ima1 NP_588365.1 1888625 R 284812 CDS SPCC737.04 19075866 2538872 1892097..1893362 1 NC_003421.2 S. pombe specific UPF0300 family protein 6 1893362 2538872 SPCC737.04 Schizosaccharomyces pombe 972h- S. pombe specific UPF0300 family protein 6 NP_588366.1 1892097 D 284812 CDS SPCC737.05 19075867 2539112 1895065..1895859 1 NC_003421.2 There may be problems with this gene prediction, it appears to be N terminal truncated in comparision to the S. cerevisiae orthologs, although is proximal to N terminal LTR so may have been N-terminally truncated deleted; peroxin Pex28/29 (predicted) 1895859 2539112 SPCC737.05 Schizosaccharomyces pombe 972h- peroxin Pex28/29 (predicted) NP_588367.1 1895065 D 284812 CDS SPCC737.06c 19075868 2539059 complement(join(1896274..1896304,1896346..1896928,1897071..1897215,1897324..1897428)) 1 NC_003421.2 glutamate-cysteine ligase catalytic subunit has EC 6.3.2.2; glutamate-cysteine ligase regulatory subunit (predicted) 1897428 2539059 SPCC737.06c Schizosaccharomyces pombe 972h- glutamate-cysteine ligase regulatory subunit (predicted) NP_588368.1 1896274 R 284812 CDS SPCC737.07c 19075869 2539412 complement(join(1898151..1899681,1899733..1899969,1900028..1900200,1900248..1900289)) 1 NC_003421.2 DNA polymerase alpha-associated DNA helicase A (predicted) 1900289 2539412 SPCC737.07c Schizosaccharomyces pombe 972h- DNA polymerase alpha-associated DNA helicase A (predicted) NP_588369.1 1898151 R 284812 CDS SPCC737.08 19075870 2539491 1900504..1914657 1 NC_003421.2 midasin (predicted) 1914657 2539491 SPCC737.08 Schizosaccharomyces pombe 972h- midasin (predicted) NP_588370.1 1900504 D 284812 CDS SPCC737.09c 162312131 3361134 complement(join(1914928..1917222,1917345..1917542)) 1 NC_003421.2 ATP-binding cassette-type vacuolar membrane transporter Hmt1 1917542 hmt1 3361134 hmt1 Schizosaccharomyces pombe 972h- ATP-binding cassette-type vacuolar membrane transporter Hmt1 NP_588371.3 1914928 R 284812 CDS SPCC74.09 19075873 2539486 1919282..1921246 1 NC_003421.2 RNA-binding protein, rrm type 1921246 mug24 2539486 mug24 Schizosaccharomyces pombe 972h- RNA-binding protein, rrm type NP_588373.1 1919282 D 284812 CDS SPCC74.01 19075874 2539096 join(1923197..1923248,1923312..1923580,1923682..1924769,1924812..1924920,1924974..1925375) 1 NC_003421.2 SNARE binding protein Sly1 (predicted) 1925375 sly1 2539096 sly1 Schizosaccharomyces pombe 972h- SNARE binding protein Sly1 (predicted) NP_588374.1 1923197 D 284812 CDS SPCC74.02c 19075875 2539414 complement(join(1925746..1927417,1927469..1927679,1927800..1927880,1928039..1928207)) 1 NC_003421.2 mRNA cleavage and polyadenylation specificity factor complex associated protein 1928207 2539414 SPCC74.02c Schizosaccharomyces pombe 972h- mRNA cleavage and polyadenylation specificity factor complex associated protein NP_588375.1 1925746 R 284812 CDS SPCC74.03c 19075876 2539109 complement(join(1929817..1930814,1930865..1931216,1931425..1931657,1931710..1931857)) 1 NC_003421.2 serine/threonine protein kinase Ssp2 1931857 ssp2 2539109 ssp2 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Ssp2 NP_588376.1 1929817 R 284812 CDS SPCC74.04 19075877 2539069 1936830..1938503 1 NC_003421.2 amino acid permease, unknown 15 1938503 2539069 SPCC74.04 Schizosaccharomyces pombe 972h- amino acid permease, unknown 15 NP_588377.1 1936830 D 284812 CDS SPCC74.05 19075878 2539336 join(1939265..1939291,1939361..1939744) 1 NC_003421.2 60S ribosomal protein L27 1939744 rpl2702 2539336 rpl2702 Schizosaccharomyces pombe 972h- 60S ribosomal protein L27 NP_588378.1 1939265 D 284812 CDS SPCC74.06 19075879 2539117 1940449..1947483 1 NC_003421.2 histidine kinase Mak3 1947483 mak3 2539117 mak3 Schizosaccharomyces pombe 972h- histidine kinase Mak3 NP_588379.1 1940449 D 284812 CDS SPCC18.01c 63054457 2539118 complement(1948578..1951973) 1 NC_003421.2 ace2 dependent gene; beta-glucosidase Adg3 (predicted) 1951973 adg3 2539118 adg3 Schizosaccharomyces pombe 972h- beta-glucosidase Adg3 (predicted) NP_588380.2 1948578 R 284812 CDS SPCC18.02 19075881 2538923 1953655..1955001 1 NC_003421.2 membrane transporter 1955001 2538923 SPCC18.02 Schizosaccharomyces pombe 972h- membrane transporter NP_588381.1 1953655 D 284812 CDS SPCC18.03 19075882 2538928 1955764..1958997 1 NC_003421.2 shuttle craft like transcriptional regulator 1958997 2538928 SPCC18.03 Schizosaccharomyces pombe 972h- shuttle craft like transcriptional regulator NP_588382.1 1955764 D 284812 CDS SPCC18.04 19075883 2539324 join(1960130..1962477,1962528..1962798) 1 NC_003421.2 F-box protein Pof6 1962798 pof6 2539324 pof6 Schizosaccharomyces pombe 972h- F-box protein Pof6 NP_588383.1 1960130 D 284812 CDS SPCC18.05c 19075884 2539380 complement(join(1963108..1963719,1963770..1964066,1964125..1964520,1964571..1964774)) 1 NC_003421.2 notchless-like protein 1964774 2539380 SPCC18.05c Schizosaccharomyces pombe 972h- notchless-like protein NP_588384.1 1963108 R 284812 CDS SPCC18.06c 19075885 2539041 complement(1965839..1966837) 1 NC_003421.2 CCR4-Not complex subunit Caf1 1966837 caf1 2539041 caf1 Schizosaccharomyces pombe 972h- CCR4-Not complex subunit Caf1 NP_588385.1 1965839 R 284812 CDS SPCC18.07 19075886 2538851 1969337..1970329 1 NC_003421.2 DNA-directed RNA polymerase III complex subunit Rpc53 (predicted) 1970329 rpc53 2538851 rpc53 Schizosaccharomyces pombe 972h- DNA-directed RNA polymerase III complex subunit Rpc53 (predicted) NP_588386.1 1969337 D 284812 CDS SPCC18.08 19075887 2539141 1971017..1972612 1 NC_003421.2 YNL073W is not the top Blast hit for SPCC18.08 (top hit YDR037W). However, the domain structure of SPCC18.08 corresponds better to YNL073W than YDR037W; mitochondrial lysine-tRNA ligase (predicted) 1972612 2539141 SPCC18.08 Schizosaccharomyces pombe 972h- mitochondrial lysine-tRNA ligase (predicted) NP_588387.1 1971017 D 284812 CDS SPCC18.09c 19075888 2539198 complement(join(1972757..1973427,1973663..1973690)) 1 NC_003421.2 human aprataxin homolog 1973690 2539198 SPCC18.09c Schizosaccharomyces pombe 972h- human aprataxin homolog NP_588388.1 1972757 R 284812 CDS SPCC18.10 19075889 2538966 join(1974771..1974824,1974870..1974978,1975121..1975427,1975519..1976071) 1 NC_003421.2 pyridoxine-pyridoxal-pyridoxamine kinase (predicted) 1976071 2538966 SPCC18.10 Schizosaccharomyces pombe 972h- pyridoxine-pyridoxal-pyridoxamine kinase (predicted) NP_588389.1 1974771 D 284812 CDS SPCC18.11c 19075890 2539145 complement(join(1976023..1976263,1976348..1976436)) 1 NC_003421.2 Dpy-30 domain protein Sdc1 1976436 sdc1 2539145 sdc1 Schizosaccharomyces pombe 972h- Dpy-30 domain protein Sdc1 NP_588390.1 1976023 R 284812 CDS SPCC18.12c 19075891 2539158 complement(join(1977223..1977827,1978012..1978101,1978214..1978301)) 1 NC_003421.2 rRNA processing protein (predicted) 1978301 2539158 SPCC18.12c Schizosaccharomyces pombe 972h- rRNA processing protein (predicted) NP_588391.1 1977223 R 284812 CDS SPCC18.13 19075892 2539246 join(1978895..1979574,1979648..1980233) 1 NC_003421.2 tRNA (guanine-N7-)-methyltransferase subunit Trm82 (predicted) 1980233 2539246 SPCC18.13 Schizosaccharomyces pombe 972h- tRNA (guanine-N7-)-methyltransferase subunit Trm82 (predicted) NP_588392.1 1978895 D 284812 CDS SPCC18.14c 19075893 2538893 complement(join(1980629..1980781,1981106..1981891)) 1 NC_003421.2 60S acidic ribosomal protein Rpp0 (predicted) 1981891 rpp0 2538893 rpp0 Schizosaccharomyces pombe 972h- 60S acidic ribosomal protein Rpp0 (predicted) NP_588393.1 1980629 R 284812 CDS SPCC18.15 19075894 2539212 join(1983372..1983547,1984126..1984882) 1 NC_003421.2 WD repeat protein, human WRDR85 family 1984882 2539212 SPCC18.15 Schizosaccharomyces pombe 972h- WD repeat protein, human WRDR85 family NP_588394.1 1983372 D 284812 CDS SPCC18.16c 19075895 2539192 complement(1985451..1985942) 1 NC_003421.2 riboflavin kinase Fmn1 1985942 fmn1 2539192 fmn1 Schizosaccharomyces pombe 972h- riboflavin kinase Fmn1 NP_588395.1 1985451 R 284812 CDS SPCC18.17c 19075896 2539160 complement(1986673..1988139) 1 NC_003421.2 sequence orphan 1988139 2539160 SPCC18.17c Schizosaccharomyces pombe 972h- sequence orphan NP_588396.1 1986673 R 284812 CDS SPCC18.18c 295442792 2539345 complement(join(1988631..1990100,1990630..1990722)) 1 NC_003421.2 fumarate hydratase 1990722 fum1 2539345 fum1 Schizosaccharomyces pombe 972h- fumarate hydratase NP_588397.3 1988631 R 284812 CDS SPCC290.02 19075898 2538992 join(1992766..1993001,1993176..1993845) 1 NC_003421.2 DNA-directed RNA polymerase III complex subunit Rpc34 1993845 rpc34 2538992 rpc34 Schizosaccharomyces pombe 972h- DNA-directed RNA polymerase III complex subunit Rpc34 NP_588398.1 1992766 D 284812 CDS SPCC290.03c 19075899 2538754 complement(join(1994322..1994581,1994633..1999316)) 1 NC_003421.2 nucleoporin Nup186 1999316 nup186 2538754 nup186 Schizosaccharomyces pombe 972h- nucleoporin Nup186 NP_588399.1 1994322 R 284812 CDS SPCC290.04 63054459 2539242 join(2001292..2001331,2001429..2003482) 1 NC_003421.2 cell cycle regulated GATA-type transcription factor Ams2 2003482 ams2 2539242 ams2 Schizosaccharomyces pombe 972h- cell cycle regulated GATA-type transcription factor Ams2 NP_588400.2 2001292 D 284812 CDS SPCC4F11.02 19075901 2539495 2004679..2005722 1 NC_003421.2 protein phosphatase 2C Ptc1 2005722 ptc1 2539495 ptc1 Schizosaccharomyces pombe 972h- protein phosphatase 2C Ptc1 NP_588401.1 2004679 D 284812 CDS SPCC4F11.03c 19075902 2539354 complement(2006732..2007739) 1 NC_003421.2 shows similar to FG repeat units of GLFG family of nucleoporins; possible alternative in frame intron at 5894..5962, does not improve homology; sequence orphan 2007739 2539354 SPCC4F11.03c Schizosaccharomyces pombe 972h- sequence orphan NP_588402.1 2006732 R 284812 CDS SPCC4F11.04c 19075903 2538722 complement(2008159..2009196) 1 NC_003421.2 mannosyltransferase (predicted) 2009196 2538722 SPCC4F11.04c Schizosaccharomyces pombe 972h- mannosyltransferase (predicted) NP_588403.1 2008159 R 284812 CDS SPCC4F11.05 19075904 2539512 join(2010502..2010601,2010647..2010789) 1 NC_003421.2 dubious 2010789 2539512 SPCC4F11.05 Schizosaccharomyces pombe 972h- dubious NP_588404.1 2010502 D 284812 CDS SPCC1906.01 19075905 2538743 2012842..2013933 1 NC_003421.2 deletion mutant results in G2/M arrest (cell size checkpoint) activation mediated be Wee1; mannose-1-phosphate guanyltransferase Mpg1 2013933 mpg1 2538743 mpg1 Schizosaccharomyces pombe 972h- mannose-1-phosphate guanyltransferase Mpg1 NP_588405.1 2012842 D 284812 CDS SPCC1906.02c 19075906 2538764 complement(2014833..2016578) 1 NC_003421.2 CUE domain protein Cue3 (predicted) 2016578 2538764 SPCC1906.02c Schizosaccharomyces pombe 972h- CUE domain protein Cue3 (predicted) NP_588406.1 2014833 R 284812 CDS SPCC1906.03 19075907 2539257 join(2017717..2017852,2018068..2018397,2018447..2018824,2018861..2019052,2019093..2019155,2019206..2019288) 1 NC_003421.2 wtf element Wtf19 2019288 wtf19 2539257 wtf19 Schizosaccharomyces pombe 972h- wtf element Wtf19 NP_588407.1 2017717 D 284812 CDS SPCC1906.04 19075908 2539340 join(2020201..2020339,2020578..2020850,2020899..2021132,2021173..2021226,2021281..2021357) 1 NC_003421.2 wtf element Wtf20 2021357 wtf20 2539340 wtf20 Schizosaccharomyces pombe 972h- wtf element Wtf20 NP_588408.1 2020201 D 284812 CDS SPCC1739.01 63054460 2539315 join(2025579..2025699,2025808..2027330) 1 NC_003421.2 zf-CCCH type zinc finger protein 2027330 2539315 SPCC1739.01 Schizosaccharomyces pombe 972h- zf-CCCH type zinc finger protein NP_588409.2 2025579 D 284812 CDS SPCC1739.02c 19075910 2538941 complement(2028281..2029030) 1 NC_003421.2 mitochondrial ribosomal protein subunit L22 2029030 mrpl22 2538941 mrpl22 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit L22 NP_588410.1 2028281 R 284812 CDS SPCC1739.03 19075911 2539248 join(2029655..2031992,2032034..2032495,2032538..2032785) 1 NC_003421.2 Helicase Required for RNAi-mediated heterochromatin assembly Hrr1 2032785 hrr1 2539248 hrr1 Schizosaccharomyces pombe 972h- Helicase Required for RNAi-mediated heterochromatin assembly Hrr1 NP_588411.1 2029655 D 284812 CDS SPCC1739.04c 19075912 2539009 complement(join(2033032..2033545,2033597..2033874,2033932..2034006)) 1 NC_003421.2 sequence orphan 2034006 2539009 SPCC1739.04c Schizosaccharomyces pombe 972h- sequence orphan NP_588412.1 2033032 R 284812 CDS SPCC1739.05 19075913 2538853 2035761..2036720 1 NC_003421.2 histone lysine methyltransferase Set5 (predicted) 2036720 set5 2538853 set5 Schizosaccharomyces pombe 972h- histone lysine methyltransferase Set5 (predicted) NP_588413.1 2035761 D 284812 CDS SPCC1739.06c 19075914 2538945 complement(2037952..2039442) 1 NC_003421.2 uroporphyrin methyltransferase (predicted) 2039442 2538945 SPCC1739.06c Schizosaccharomyces pombe 972h- uroporphyrin methyltransferase (predicted) NP_588414.1 2037952 R 284812 CDS SPCC1739.07 19075915 2539105 2041284..2041685 1 NC_003421.2 substrate-specific nuclear cofactor for exosome activity (predicted) 2041685 2539105 SPCC1739.07 Schizosaccharomyces pombe 972h- substrate-specific nuclear cofactor for exosome activity (predicted) NP_588415.1 2041284 D 284812 CDS SPCC1739.08c 19075916 2539211 complement(2043282..2044067) 1 NC_003421.2 short chain dehydrogenase (predicted) 2044067 2539211 SPCC1739.08c Schizosaccharomyces pombe 972h- short chain dehydrogenase (predicted) NP_588416.1 2043282 R 284812 CDS SPCC1739.09c 19075917 2538807 complement(join(2046661..2046700,2046785..2046844,2046897..2046951,2047000..2047049,2047100..2047124,2047173..2047335)) 1 NC_003421.2 cytochrome c oxidase subunit VIa (predicted) 2047335 cox13 2538807 cox13 Schizosaccharomyces pombe 972h- cytochrome c oxidase subunit VIa (predicted) NP_588417.1 2046661 R 284812 CDS SPCC1739.10 19075918 2539381 2047936..2048946 1 NC_003421.2 conserved fungal protein 2048946 mug33 2539381 mug33 Schizosaccharomyces pombe 972h- conserved fungal protein NP_588418.1 2047936 D 284812 CDS SPCC1739.11c 19075919 2539149 complement(2049415..2052552) 1 NC_003421.2 SIN component scaffold protein Cdc11 2052552 cdc11 2539149 cdc11 Schizosaccharomyces pombe 972h- SIN component scaffold protein Cdc11 NP_588419.1 2049415 R 284812 CDS SPCC1739.12 19075920 2538758 2053618..2054535 1 NC_003421.2 serine/threonine protein phosphatase Ppe1 2054535 ppe1 2538758 ppe1 Schizosaccharomyces pombe 972h- serine/threonine protein phosphatase Ppe1 NP_588420.1 2053618 D 284812 CDS SPCC1739.13 19075921 2539225 2057243..2059186 1 NC_003421.2 heat shock protein Ssa2 2059186 ssa2 2539225 ssa2 Schizosaccharomyces pombe 972h- heat shock protein Ssa2 NP_588421.1 2057243 D 284812 CDS SPCC1739.14 19075922 2539077 join(2059929..2060152,2060315..2062892) 1 NC_003421.2 nucleoporin Npp106 2062892 npp106 2539077 npp106 Schizosaccharomyces pombe 972h- nucleoporin Npp106 NP_588422.1 2059929 D 284812 CDS SPCC1739.15 19075923 2538972 join(2064452..2064590,2064758..2065003,2065051..2065296,2065333..2065524,2065565..2065627,2065678..2065781) 1 NC_003421.2 wtf element Wtf21 2065781 wtf21 2538972 wtf21 Schizosaccharomyces pombe 972h- wtf element Wtf21 NP_588423.1 2064452 D 284812 CDS SPCPB1C11.01 19075924 2539332 2069806..2071299 1 NC_003421.2 ammonium transporter Amt1 2071299 amt1 2539332 amt1 Schizosaccharomyces pombe 972h- ammonium transporter Amt1 NP_588424.1 2069806 D 284812 CDS SPCPB1C11.02 19075925 2539031 2072967..2074484 1 NC_003421.2 amino acid permease, unknown 16 2074484 2539031 SPCPB1C11.02 Schizosaccharomyces pombe 972h- amino acid permease, unknown 16 NP_588425.1 2072967 D 284812 CDS SPCPB1C11.03 19075926 2539453 2077083..2078795 1 NC_003421.2 cysteine transporter (predicted) 2078795 2539453 SPCPB1C11.03 Schizosaccharomyces pombe 972h- cysteine transporter (predicted) NP_588426.1 2077083 D 284812 CDS SPCC576.01c 63054461 2539549 complement(2079421..2080662) 1 NC_003421.2 sulfonate dioxygenase (predicted) 2080662 2539549 SPCC576.01c Schizosaccharomyces pombe 972h- sulfonate dioxygenase (predicted) NP_588427.2 2079421 R 284812 CDS SPCC576.19c 19075928 2539025 complement(2081247..2081606) 1 NC_003421.2 dubious 2081606 2539025 SPCC576.19c Schizosaccharomyces pombe 972h- dubious NP_588428.1 2081247 R 284812 CDS SPCC576.02 19075929 2539531 2082647..2083357 1 NC_003421.2 hydantoin racemase family (predicted) 2083357 2539531 SPCC576.02 Schizosaccharomyces pombe 972h- hydantoin racemase family (predicted) NP_588429.1 2082647 D 284812 CDS SPCC576.03c 19075930 2539572 complement(2085036..2085614) 1 NC_003421.2 thioredoxin peroxidase Tpx1 2085614 tpx1 2539572 tpx1 Schizosaccharomyces pombe 972h- thioredoxin peroxidase Tpx1 NP_588430.1 2085036 R 284812 CDS SPCC576.04 19075931 2539556 2086877..2087677 1 NC_003421.2 conserved eukaryotic protein 2087677 2539556 SPCC576.04 Schizosaccharomyces pombe 972h- conserved eukaryotic protein NP_588431.1 2086877 D 284812 CDS SPCC576.05 19075932 2539561 join(2088546..2089052,2089274..2089517,2089619..2090158,2090195..2091978) 1 NC_003421.2 nucear export factor Sac3 (predicted) 2091978 2539561 SPCC576.05 Schizosaccharomyces pombe 972h- nucear export factor Sac3 (predicted) NP_588432.1 2088546 D 284812 CDS SPCC576.06c 19075933 2539529 complement(join(2092202..2092735,2092786..2093524,2093573..2093637)) 1 NC_003421.2 mitochondrial tyrosine-tRNA ligase (predicted) 2093637 2539529 SPCC576.06c Schizosaccharomyces pombe 972h- mitochondrial tyrosine-tRNA ligase (predicted) NP_588433.1 2092202 R 284812 CDS SPCC576.07 19075934 2539522 2093841..2094413 1 NC_003421.2 coatomer zeta subunit (predicted) 2094413 ret3 2539522 ret3 Schizosaccharomyces pombe 972h- coatomer zeta subunit (predicted) NP_588434.1 2093841 D 284812 CDS SPCC576.08c 19075935 2539067 complement(2095227..2095988) 1 NC_003421.2 40S ribosomal protein S2 2095988 rps2 2539067 rps2 Schizosaccharomyces pombe 972h- 40S ribosomal protein S2 NP_588435.1 2095227 R 284812 CDS SPCC576.09 19075936 2539449 2096558..2096914 1 NC_003421.2 40S ribosomal protein S20 2096914 rps20 2539449 rps20 Schizosaccharomyces pombe 972h- 40S ribosomal protein S20 NP_588436.1 2096558 D 284812 CDS SPCC576.10c 19075937 2539539 complement(2097679..2098848) 1 NC_003421.2 19S proteasome regulatory subunit Rpt3 (predicted) 2098848 rpt3 2539539 rpt3 Schizosaccharomyces pombe 972h- 19S proteasome regulatory subunit Rpt3 (predicted) NP_588437.1 2097679 R 284812 CDS SPCC576.11 19075938 2539470 2099879..2100484 1 NC_003421.2 60S ribosomal protein L15 2100484 rpl15 2539470 rpl15 Schizosaccharomyces pombe 972h- 60S ribosomal protein L15 NP_588438.1 2099879 D 284812 CDS SPCC576.12c 19075939 2539408 complement(join(2101432..2101552,2101595..2101743)) 1 NC_003421.2 DUF2008 family protein 2101743 2539408 SPCC576.12c Schizosaccharomyces pombe 972h- DUF2008 family protein NP_588439.1 2101432 R 284812 CDS SPCC576.13 19075940 2539444 2101753..2102400 1 NC_003421.2 Swr1 complex subunit Swc5 2102400 swc5 2539444 swc5 Schizosaccharomyces pombe 972h- Swr1 complex subunit Swc5 NP_588440.1 2101753 D 284812 CDS SPCC576.14 19075941 2539471 join(2102587..2102846,2103132..2103361,2103405..2103536,2103585..2103814) 1 NC_003421.2 diphthine synthase (predicted) 2103814 2539471 SPCC576.14 Schizosaccharomyces pombe 972h- diphthine synthase (predicted) NP_588441.1 2102587 D 284812 CDS SPCC576.15c 19075942 2539517 complement(join(2104371..2105576,2105686..2106258)) 1 NC_003421.2 serine/threonine protein kinase Ksg1 2106258 ksg1 2539517 ksg1 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Ksg1 NP_588442.1 2104371 R 284812 CDS SPCC576.17c 19075943 2539554 complement(join(2111638..2113158,2113334..2113390)) 1 NC_003421.2 membrane transporter 2113390 2539554 SPCC576.17c Schizosaccharomyces pombe 972h- membrane transporter NP_588443.1 2111638 R 284812 CDS SPCC126.01c 63054462 2538691 complement(2115316..2116425) 1 NC_003421.2 conserved fungal protein 2116425 2538691 SPCC126.01c Schizosaccharomyces pombe 972h- conserved fungal protein NP_588444.2 2115316 R 284812 CDS SPCC126.02c 19075945 2539090 complement(join(2117287..2117397,2117451..2117660,2117706..2118895,2118970..2119066,2119138..2119320,2119386..2119418)) 1 NC_003421.2 Ku domain protein Pku70 2119418 pku70 2539090 pku70 Schizosaccharomyces pombe 972h- Ku domain protein Pku70 NP_588445.1 2117287 R 284812 CDS SPCC126.03 19075946 2539082 join(2120665..2121741,2121807..2122162,2122202..2122373) 1 NC_003421.2 tRNA pseudouridine synthase Lsp1 2122373 pus1 2539082 pus1 Schizosaccharomyces pombe 972h- tRNA pseudouridine synthase Lsp1 NP_588446.1 2120665 D 284812 CDS SPCC126.04c 19075947 2538769 complement(join(2122751..2123202,2123274..2123856)) 1 NC_003421.2 SAGA complex subunit Sgf73 (predicted) 2123856 sgf73 2538769 sgf73 Schizosaccharomyces pombe 972h- SAGA complex subunit Sgf73 (predicted) NP_588447.1 2122751 R 284812 CDS SPCC126.05c 19075948 2539103 complement(join(2124545..2124700,2124768..2124866,2125015..2125448,2125543..2125660)) 1 NC_003421.2 mitochondrial ribosomal protein subunit L17 2125660 mrpl17 2539103 mrpl17 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit L17 NP_588448.1 2124545 R 284812 CDS SPCC126.06 19075949 2539064 join(2125950..2125974,2126013..2126090,2126154..2126521,2126630..2126758,2126814..2126949,2126990..2127108,2127151..2127282) 1 NC_003421.2 NAS from (pers. comm. David R. Kovar and Thomas D. Pollard); twinfilin 2127282 twf1 2539064 twf1 Schizosaccharomyces pombe 972h- twinfilin NP_588449.1 2125950 D 284812 CDS SPCC126.07c 19075950 2539058 complement(2127734..2129449) 1 NC_003421.2 human CTD-binding SR-like protein rA9 homolog 2129449 2539058 SPCC126.07c Schizosaccharomyces pombe 972h- human CTD-binding SR-like protein rA9 homolog NP_588450.1 2127734 R 284812 CDS SPCC126.08c 19075951 2538834 complement(2130041..2130979) 1 NC_003421.2 lectin (predicted) 2130979 2538834 SPCC126.08c Schizosaccharomyces pombe 972h- lectin (predicted) NP_588451.1 2130041 R 284812 CDS SPCC126.09 19075952 2539302 2132202..2133458 1 NC_003421.2 vacuolar membrane zinc transporter (predicted) 2133458 2539302 SPCC126.09 Schizosaccharomyces pombe 972h- vacuolar membrane zinc transporter (predicted) NP_588452.1 2132202 D 284812 CDS SPCC126.10 19075953 2539062 2134702..2135442 1 NC_003421.2 isoamyl acetate hydrolytic enzyme Iah1 (predicted) 2135442 iah1 2539062 iah1 Schizosaccharomyces pombe 972h- isoamyl acetate hydrolytic enzyme Iah1 (predicted) NP_588453.1 2134702 D 284812 CDS SPCC126.11c 19075954 2539056 complement(join(2136201..2136653,2136704..2136768,2136821..2136854)) 1 NC_003421.2 RNA-binding protein, rrm type 2136854 2539056 SPCC126.11c Schizosaccharomyces pombe 972h- RNA-binding protein, rrm type NP_588454.1 2136201 R 284812 CDS SPCC126.12 19075955 2539063 join(2138121..2138334,2138388..2138702,2138755..2138925,2138991..2139127) 1 NC_003421.2 NGG1p interacting factor 3 family 2139127 2539063 SPCC126.12 Schizosaccharomyces pombe 972h- NGG1p interacting factor 3 family NP_588455.1 2138121 D 284812 CDS SPCC126.13c 19075956 2539066 complement(join(2140570..2140843,2141011..2141174)) 1 NC_003421.2 histone deacetylase complex subunit, SAP128 family (predicted) 2141174 2539066 SPCC126.13c Schizosaccharomyces pombe 972h- histone deacetylase complex subunit, SAP128 family (predicted) NP_588456.1 2140570 R 284812 CDS SPCC126.14 19075957 2539357 join(2141190..2142146,2142192..2142266) 1 NC_003421.2 U5 snRNP-associated protein Prp18 2142266 prp18 2539357 prp18 Schizosaccharomyces pombe 972h- U5 snRNP-associated protein Prp18 NP_588457.1 2141190 D 284812 CDS SPCC126.15c 19075958 2539061 complement(join(2142679..2143055,2143109..2143331)) 1 NC_003421.2 signal recognition particle subunit Sec65 (predicted) 2143331 sec65 2539061 sec65 Schizosaccharomyces pombe 972h- signal recognition particle subunit Sec65 (predicted) NP_588458.1 2142679 R 284812 CDS SPCC1620.01c 19075959 2538804 complement(join(2144171..2144196,2144255..2144357,2144710..2144811,2144865..2144924)) 1 NC_003421.2 U6 snRNP-associated protein core protein 2144924 lsm2 2538804 lsm2 Schizosaccharomyces pombe 972h- U6 snRNP-associated protein core protein NP_588459.1 2144171 R 284812 CDS SPCC1620.02 19075960 2539166 join(2145761..2145896,2146113..2146442,2146492..2146770,2146807..2146998,2147039..2147101,2147152..2147258) 1 NC_003421.2 wtf element Wtf23 2147258 wtf23 2539166 wtf23 Schizosaccharomyces pombe 972h- wtf element Wtf23 NP_588460.1 2145761 D 284812 CDS SPCC1620.03 19075961 2538805 2148728..2149288 1 NC_003421.2 sequence orphan 2149288 mug163 2538805 mug163 Schizosaccharomyces pombe 972h- sequence orphan NP_588461.1 2148728 D 284812 CDS SPCC1620.04c 19075962 2539258 complement(2149379..2150908) 1 NC_003421.2 Cdc20/Fizzy family WD repeat protein 2150908 mug55 2539258 mug55 Schizosaccharomyces pombe 972h- Cdc20/Fizzy family WD repeat protein NP_588462.1 2149379 R 284812 CDS SPCC1620.05 19075963 2539343 join(2152189..2152191,2152234..2152344,2152391..2152518,2152561..2152748,2152869..2153090,2153164..2153367,2153459..2153637) 1 NC_003421.2 Rab geranylgeranyltransferase alpha subunit (predicted) 2153637 2539343 SPCC1620.05 Schizosaccharomyces pombe 972h- Rab geranylgeranyltransferase alpha subunit (predicted) NP_588463.1 2152189 D 284812 CDS SPCC1620.06c 19075964 2538924 complement(join(2153885..2154412,2154481..2154847,2155000..2155070)) 1 NC_003421.2 ribose-phosphate pyrophosphokinase (predicted) 2155070 2538924 SPCC1620.06c Schizosaccharomyces pombe 972h- ribose-phosphate pyrophosphokinase (predicted) NP_588464.1 2153885 R 284812 CDS SPCC1620.07c 19075965 2538940 complement(join(2156304..2157045,2157130..2157371,2157430..2157450)) 1 NC_003421.2 lunapark homolog 2157450 2538940 SPCC1620.07c Schizosaccharomyces pombe 972h- lunapark homolog NP_588465.1 2156304 R 284812 CDS SPCC1620.08 19075966 2539168 2159599..2160900 1 NC_003421.2 Due to inconsistencies between the annotation of the proposed S. cerevisiae ortholog LSC2 in SWISSPROT:P53312 and SGD:S0003476 succinate-CoA ligase (GDP-forming)/6.2.1.4 and succinate-CoA ligase (ADP-forming) repectively, we have conservatively annotated to EC 6.2.1.- and GO:0004774, succinate-CoA ligase activity. However, this is likely to be ATP utilising (Pfam:PF02222); succinate-CoA ligase (beta subunit) 2160900 2539168 SPCC1620.08 Schizosaccharomyces pombe 972h- succinate-CoA ligase (beta subunit) NP_588466.1 2159599 D 284812 CDS SPCC1620.09c 295442794 2539294 complement(join(2161331..2161515,2161565..2162363,2162405..2162500,2162584..2163123)) 1 NC_003421.2 transcription factor TFIIF complex alpha subunit Tfg1 (predicted) 2163123 tfg1 2539294 tfg1 Schizosaccharomyces pombe 972h- transcription factor TFIIF complex alpha subunit Tfg1 (predicted) NP_588467.2 2161331 R 284812 CDS SPCC1620.10 295442796 2538931 join(2163205..2164118,2164159..2164165) 1 NC_003421.2 complexed with Cdc5 protein Cwf26 2164165 cwf26 2538931 cwf26 Schizosaccharomyces pombe 972h- complexed with Cdc5 protein Cwf26 NP_588468.2 2163205 D 284812 CDS SPCC1620.11 19075969 2538861 join(2165032..2165225,2165275..2167636) 1 NC_003421.2 nucleoporin Nic96 homolog 2167636 nup97 2538861 nup97 Schizosaccharomyces pombe 972h- nucleoporin Nic96 homolog NP_588469.1 2165032 D 284812 CDS SPCC1620.12c 19075970 2538866 complement(2167799..2169586) 1 NC_003421.2 GTPase activating protein (predicted) 2169586 2538866 SPCC1620.12c Schizosaccharomyces pombe 972h- GTPase activating protein (predicted) NP_588470.1 2167799 R 284812 CDS SPCC1620.13 19075971 2539394 2171468..2172316 1 NC_003421.2 phosphoglycerate mutase family 2172316 2539394 SPCC1620.13 Schizosaccharomyces pombe 972h- phosphoglycerate mutase family NP_588471.1 2171468 D 284812 CDS SPCC1620.14c 63054463 2538881 complement(2172623..2177665) 1 NC_003421.2 ATP-dependent DNA helicase Snf22 2177665 snf22 2538881 snf22 Schizosaccharomyces pombe 972h- ATP-dependent DNA helicase Snf22 NP_588472.2 2172623 R 284812 CDS SPCC830.03 19075973 2539329 join(2183807..2183840,2183918..2186094) 1 NC_003421.2 AAA family ATPase Grc3 (predicted) 2186094 2539329 SPCC830.03 Schizosaccharomyces pombe 972h- AAA family ATPase Grc3 (predicted) NP_588473.1 2183807 D 284812 CDS SPCC830.04c 19075974 2539089 complement(2186723..2187154) 1 NC_003421.2 has transcript profile on microarray; sequence orphan 2187154 mug128 2539089 mug128 Schizosaccharomyces pombe 972h- sequence orphan NP_588474.1 2186723 R 284812 CDS SPCC830.05c 19075975 2539428 complement(join(2188535..2190040,2190562..2190729)) 1 NC_003421.2 NuA4 histone acetyltransferase complex Epl1 2190729 epl1 2539428 epl1 Schizosaccharomyces pombe 972h- NuA4 histone acetyltransferase complex Epl1 NP_588475.1 2188535 R 284812 CDS SPCC830.06 19075976 2538786 join(2192204..2192255,2192449..2192685,2192748..2192860,2192914..2193036) 1 NC_003421.2 calcineurin regulatory subunit (predicted) 2193036 2538786 SPCC830.06 Schizosaccharomyces pombe 972h- calcineurin regulatory subunit (predicted) NP_588476.1 2192204 D 284812 CDS SPCC830.07c 19075977 2539002 complement(2193953..2195092) 1 NC_003421.2 DNAJ domain protein Psi1 2195092 psi1 2539002 psi1 Schizosaccharomyces pombe 972h- DNAJ domain protein Psi1 NP_588477.1 2193953 R 284812 CDS SPCC830.08c 19075978 2539171 complement(join(2196308..2196522,2196646..2196928,2197062..2197112)) 1 NC_003421.2 2 predicted transmembrane helices; ER membrane protein DP1/Yop1 (predicted) 2197112 2539171 SPCC830.08c Schizosaccharomyces pombe 972h- ER membrane protein DP1/Yop1 (predicted) NP_588478.1 2196308 R 284812 CDS SPCC830.09c 19075979 2538895 complement(2199274..2199693) 1 NC_003421.2 RNase P and RNase MRP subunit (predicted) 2199693 2538895 SPCC830.09c Schizosaccharomyces pombe 972h- RNase P and RNase MRP subunit (predicted) NP_588479.1 2199274 R 284812 CDS SPCC830.10 19075980 2539034 join(2201518..2201524,2201629..2201730,2201788..2201852,2201989..2202062,2202109..2202140,2202182..2202351,2202397..2202513) 1 NC_003421.2 nucleoside triphosphatase (predicted) 2202513 2539034 SPCC830.10 Schizosaccharomyces pombe 972h- nucleoside triphosphatase (predicted) NP_588480.1 2201518 D 284812 CDS SPCC830.11c 19075981 2538752 complement(join(2203184..2203658,2203754..2203806)) 1 NC_003421.2 nucleoside-triphosphatase (predicted) 2203806 2538752 SPCC830.11c Schizosaccharomyces pombe 972h- nucleoside-triphosphatase (predicted) NP_588481.1 2203184 R 284812 CDS SPCC1919.01 162312133 3361146 join(2204298..2204495,2204616..2204868,2204966..2205085,2205138..2205295,2205336..2205484,2205549..2205735) 1 NC_003421.2 serine/threonine protein kinase Ppk34 2205735 ppk34 3361146 ppk34 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Ppk34 NP_588482.2 2204298 D 284812 CDS SPCC1919.02 19075984 2539243 join(2206373..2206497,2206541..2206604,2206661..2207470) 1 NC_003421.2 pig-X 2207470 2539243 SPCC1919.02 Schizosaccharomyces pombe 972h- pig-X NP_588484.1 2206373 D 284812 CDS SPCC1919.03c 19075985 2539130 complement(join(2207736..2207774,2207823..2208291,2208388..2208490,2208661..2208921,2208975..2208999)) 1 NC_003421.2 AMP-activated protein kinase beta subunit (predicted) 2208999 2539130 SPCC1919.03c Schizosaccharomyces pombe 972h- AMP-activated protein kinase beta subunit (predicted) NP_588485.1 2207736 R 284812 CDS SPCC1919.04 19075986 2538919 2211103..2211873 1 NC_003421.2 sequence orphan 2211873 2538919 SPCC1919.04 Schizosaccharomyces pombe 972h- sequence orphan NP_588486.1 2211103 D 284812 CDS SPCC1919.05 19075987 2539136 2212760..2216929 1 NC_003421.2 Ski complex TPR repeat subunit Ski3 (predicted) 2216929 2539136 SPCC1919.05 Schizosaccharomyces pombe 972h- Ski complex TPR repeat subunit Ski3 (predicted) NP_588487.1 2212760 D 284812 CDS SPCC1919.07 19075989 2539318 2221583..2222203 1 NC_003421.2 sequence orphan 2222203 2539318 SPCC1919.07 Schizosaccharomyces pombe 972h- sequence orphan NP_588489.1 2221583 D 284812 CDS SPCC1919.08c 19075990 2539139 complement(join(2222223..2222466,2222522..2222571)) 1 NC_003421.2 mitochondrial ribosomal protein subunit YmL33 2222571 mrpl33 2539139 mrpl33 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit YmL33 NP_588490.1 2222223 R 284812 CDS SPCC1919.09 19075991 2539126 join(2223154..2223188,2223243..2223314,2223630..2224257) 1 NC_003421.2 translation initiation factor eIF6 2224257 tif6 2539126 tif6 Schizosaccharomyces pombe 972h- translation initiation factor eIF6 NP_588491.1 2223154 D 284812 CDS SPCC1919.10c 19075992 2538846 complement(join(2225048..2229460,2229535..2229643,2229703..2229731)) 1 NC_003421.2 myosin type V 2229731 myo52 2538846 myo52 Schizosaccharomyces pombe 972h- myosin type V NP_588492.1 2225048 R 284812 CDS SPCC1919.11 19075993 2539113 join(2231761..2231786,2231853..2231862,2231970..2232045,2232089..2232136,2232194..2232298,2232337..2232895,2232943..2233381) 1 NC_003421.2 BAR adaptor protein 2233381 mug137 2539113 mug137 Schizosaccharomyces pombe 972h- BAR adaptor protein NP_588493.1 2231761 D 284812 CDS SPCC1919.12c 19075994 2539157 complement(2233448..2235979) 1 NC_003421.2 aminopeptidase (predicted) 2235979 2539157 SPCC1919.12c Schizosaccharomyces pombe 972h- aminopeptidase (predicted) NP_588494.1 2233448 R 284812 CDS SPCC1919.13c 19075995 2539319 complement(join(2236152..2236513,2236637..2237123)) 1 NC_003421.2 conserved eukaryotic protein 2237123 2539319 SPCC1919.13c Schizosaccharomyces pombe 972h- conserved eukaryotic protein NP_588495.1 2236152 R 284812 CDS SPCC1919.14c 19075996 2538909 complement(join(2237547..2237788,2237833..2237980,2238019..2238668,2238719..2239202)) 1 NC_003421.2 N-terminal may be incorrectly rredicted; transcription factor TFIIIB complex subunit Bdp1 (predicted) 2239202 bdp1 2538909 bdp1 Schizosaccharomyces pombe 972h- transcription factor TFIIIB complex subunit Bdp1 (predicted) NP_588496.1 2237547 R 284812 CDS SPCC1919.15 19075997 2539102 2239975..2242053 1 NC_003421.2 ubiquitin-protein ligase E3 Brl1 2242053 brl1 2539102 brl1 Schizosaccharomyces pombe 972h- ubiquitin-protein ligase E3 Brl1 NP_588497.1 2239975 D 284812 CDS SPCC790.02 19075998 2539053 join(2242505..2242754,2242804..2243268,2243319..2243992,2244041..2245354) 1 NC_003421.2 NOTE: May have an additional C-term exon; ubiquitin-protein ligase E3 (predicted) 2245354 pep3 2539053 pep3 Schizosaccharomyces pombe 972h- ubiquitin-protein ligase E3 (predicted) NP_588498.1 2242505 D 284812 CDS SPCC790.03 19075999 2539469 join(2245969..2246125,2246172..2246448,2246603..2246915) 1 NC_003421.2 rhomboid family protease 2246915 2539469 SPCC790.03 Schizosaccharomyces pombe 972h- rhomboid family protease NP_588499.1 2245969 D 284812 CDS SPCC1840.01c 19076000 2539036 complement(2247592..2248164) 1 NC_003421.2 Ran GTPase binding protein Mog1 2248164 mog1 2539036 mog1 Schizosaccharomyces pombe 972h- Ran GTPase binding protein Mog1 NP_588500.1 2247592 R 284812 CDS SPCC1840.02c 19076001 2538822 complement(2249279..2255146) 1 NC_003421.2 1,3-beta-glucan synthase subunit Bgs4 2255146 bgs4 2538822 bgs4 Schizosaccharomyces pombe 972h- 1,3-beta-glucan synthase subunit Bgs4 NP_588501.1 2249279 R 284812 CDS SPCC1840.03 19076002 2539387 2260282..2263569 1 NC_003421.2 karyopherin Sal3 2263569 sal3 2539387 sal3 Schizosaccharomyces pombe 972h- karyopherin Sal3 NP_588502.1 2260282 D 284812 CDS SPCC1840.04 19076003 2538976 join(2263967..2264420,2264467..2264526,2264568..2264665,2264712..2264735,2264776..2264944,2264984..2265456) 1 NC_003421.2 Pombe CAspase 1; metacaspase Pca1 2265456 pca1 2538976 pca1 Schizosaccharomyces pombe 972h- metacaspase Pca1 NP_588503.1 2263967 D 284812 CDS SPCC1840.05c 19076004 2538920 complement(join(2265658..2267270,2267708..2267807,2267870..2267920)) 1 NC_003421.2 phosphoglucomutase (predicted) 2267920 2538920 SPCC1840.05c Schizosaccharomyces pombe 972h- phosphoglucomutase (predicted) NP_588504.1 2265658 R 284812 CDS SPCC1840.06 19076005 2539241 complement(join(2268884..2268894,2268970..2269488,2269601..2269721)) 1 NC_003421.2 F0-ATPase delta subunit 2269721 atp5 2539241 atp5 Schizosaccharomyces pombe 972h- F0-ATPase delta subunit NP_588505.1 2268884 R 284812 CDS SPCC1840.07c 19076006 2538780 complement(2270637..2271635) 1 NC_003421.2 phosphoprotein phosphatase (predicted) 2271635 2538780 SPCC1840.07c Schizosaccharomyces pombe 972h- phosphoprotein phosphatase (predicted) NP_588506.1 2270637 R 284812 CDS SPCC1840.08c 19076007 2539355 complement(2272159..2273844) 1 NC_003421.2 protein disulfide isomerase (predicted) 2273844 2539355 SPCC1840.08c Schizosaccharomyces pombe 972h- protein disulfide isomerase (predicted) NP_588507.1 2272159 R 284812 CDS SPCC1840.09 19076008 2538806 complement(2274368..2275198) 1 NC_003421.2 NAD dependent epimerase/dehydratase family protein 2275198 2538806 SPCC1840.09 Schizosaccharomyces pombe 972h- NAD dependent epimerase/dehydratase family protein NP_588508.1 2274368 R 284812 CDS SPCC1840.10 19076009 2539322 join(2277902..2277926,2277981..2278149,2278213..2278303) 1 NC_003421.2 U6 snRNP-associated protein Lsm8 (predicted) 2278303 lsm8 2539322 lsm8 Schizosaccharomyces pombe 972h- U6 snRNP-associated protein Lsm8 (predicted) NP_588509.1 2277902 D 284812 CDS SPCC1840.11 19076010 2539351 2279333..2279878 1 NC_003421.2 exosome subunit Csl4 2279878 csl4 2539351 csl4 Schizosaccharomyces pombe 972h- exosome subunit Csl4 NP_588510.1 2279333 D 284812 CDS SPCC1840.12 63054465 2538969 join(2281612..2281912,2282027..2284101) 1 NC_003421.2 OPT oligopeptide transporter family 2284101 2538969 SPCC1840.12 Schizosaccharomyces pombe 972h- OPT oligopeptide transporter family NP_588512.2 2281612 D 284812 CDS SPCC965.03 19076013 2539581 join(2285073..2285113,2285154..2285271,2285531..2286229) 1 NC_003421.2 V-type ATPase subunit D (predicted) 2286229 vma8 2539581 vma8 Schizosaccharomyces pombe 972h- V-type ATPase subunit D (predicted) NP_588513.1 2285073 D 284812 CDS SPCC965.04c 19076014 2538746 complement(join(2286997..2289093,2289195..2289227)) 1 NC_003421.2 mitochondrial inner membrane i-AAA protease complex subunit Yme1 (predicted) 2289227 2538746 SPCC965.04c Schizosaccharomyces pombe 972h- mitochondrial inner membrane i-AAA protease complex subunit Yme1 (predicted) NP_588514.1 2286997 R 284812 CDS SPCC965.05c 19076015 2539432 complement(2291004..2291981) 1 NC_003421.2 uracil DNA N-glycosylase Thp1 2291981 thp1 2539432 thp1 Schizosaccharomyces pombe 972h- uracil DNA N-glycosylase Thp1 NP_588515.1 2291004 R 284812 CDS SPCC965.06 19076016 2539573 2293287..2294321 1 NC_003421.2 potassium channel subunit (predicted) 2294321 2539573 SPCC965.06 Schizosaccharomyces pombe 972h- potassium channel subunit (predicted) NP_588516.1 2293287 D 284812 CDS SPCC965.07c 19076017 2539601 complement(2295375..2296067) 1 NC_003421.2 glutathione S-transferase Gst2 2296067 gst2 2539601 gst2 Schizosaccharomyces pombe 972h- glutathione S-transferase Gst2 NP_588517.1 2295375 R 284812 CDS SPCC965.08c 19076018 2538742 complement(2297563..2298690) 1 NC_003421.2 alanine racemase Alr1 2298690 alr1 2538742 alr1 Schizosaccharomyces pombe 972h- alanine racemase Alr1 NP_588518.1 2297563 R 284812 CDS SPCC965.09 19076019 2539328 2300696..2301514 1 NC_003421.2 nitrilase family protein (predicted) 2301514 2539328 SPCC965.09 Schizosaccharomyces pombe 972h- nitrilase family protein (predicted) NP_588519.1 2300696 D 284812 CDS SPCC965.10 19076020 2539398 2302549..2304126 1 NC_003421.2 transcription factor (predicted) 2304126 2539398 SPCC965.10 Schizosaccharomyces pombe 972h- transcription factor (predicted) NP_588520.1 2302549 D 284812 CDS SPCC965.11c 19076021 2539173 complement(2304137..2305750) 1 NC_003421.2 amino acid transporter (predicted) 2305750 2539173 SPCC965.11c Schizosaccharomyces pombe 972h- amino acid transporter (predicted) NP_588521.1 2304137 R 284812 CDS SPCC965.12 19076022 2539107 2306292..2307542 1 NC_003421.2 dipeptidyl peptidase (predicted) 2307542 2539107 SPCC965.12 Schizosaccharomyces pombe 972h- dipeptidyl peptidase (predicted) NP_588522.1 2306292 D 284812 CDS SPCC965.13 19076023 2538962 2312480..2314093 1 NC_003421.2 membrane transporter 2314093 2538962 SPCC965.13 Schizosaccharomyces pombe 972h- membrane transporter NP_588523.1 2312480 D 284812 CDS SPCC965.14c 19076024 2539595 2314802..2315290 1 NC_003421.2 cytosine deaminase (predicted) 2315290 2539595 SPCC965.14c Schizosaccharomyces pombe 972h- cytosine deaminase (predicted) NP_588524.1 2314802 D 284812 CDS SPCC1494.01 63054466 2539234 join(2316442..2317121,2317163..2317448) 1 NC_003421.2 iron/ascorbate oxidoreductase family 2317448 2539234 SPCC1494.01 Schizosaccharomyces pombe 972h- iron/ascorbate oxidoreductase family NP_588526.2 2316442 D 284812 CDS SPCC1494.02c 295442798 2538695 complement(join(2318335..2318508,2318579..2318676,2318903..2318966)) 1 NC_003421.2 splicing tentative, 1st exon may not be real - also last two exons; transcription factor TFIID complex subunit Taf13 (predicted) 2318966 taf13 2538695 taf13 Schizosaccharomyces pombe 972h- transcription factor TFIID complex subunit Taf13 (predicted) NP_588527.2 2318335 R 284812 CDS SPCC1494.03 19076028 2539339 2325172..2326650 1 NC_003421.2 armadillo repeat containing, Zfs1 target number 1 2326650 arz1 2539339 arz1 Schizosaccharomyces pombe 972h- armadillo repeat containing, Zfs1 target number 1 NP_588528.1 2325172 D 284812 CDS SPCC1494.04c 19076029 2539274 complement(join(2327154..2328363,2328463..2328548)) 1 NC_003421.2 prephenate dehydrogenase [NADP+] Tyr1 (predicted) 2328548 tyr1 2539274 tyr1 Schizosaccharomyces pombe 972h- prephenate dehydrogenase [NADP+] Tyr1 (predicted) NP_588529.1 2327154 R 284812 CDS SPCC1494.05c 19076030 2538990 complement(2329468..2332407) 1 NC_003421.2 ubiquitin C-terminal hydrolase Ubp12 2332407 ubp12 2538990 ubp12 Schizosaccharomyces pombe 972h- ubiquitin C-terminal hydrolase Ubp12 NP_588530.1 2329468 R 284812 CDS SPCC1494.06c 19076031 2538776 complement(2332929..2334716) 1 NC_003421.2 ATP-dependent RNA helicase Dbp9 (predicted) 2334716 2538776 SPCC1494.06c Schizosaccharomyces pombe 972h- ATP-dependent RNA helicase Dbp9 (predicted) NP_588531.1 2332929 R 284812 CDS SPCC1494.07 19076032 2539238 2336790..2341298 1 NC_003421.2 human THADA ortholog 2341298 2539238 SPCC1494.07 Schizosaccharomyces pombe 972h- human THADA ortholog NP_588532.1 2336790 D 284812 CDS SPCC1494.08c 19076033 2539001 complement(2341559..2342383) 1 NC_003421.2 conserved fungal protein 2342383 2539001 SPCC1494.08c Schizosaccharomyces pombe 972h- conserved fungal protein NP_588533.1 2341559 R 284812 CDS SPCC1494.09c 19076034 2539184 complement(join(2343056..2343437,2343506..2343597)) 1 NC_003421.2 sequence orphan 2343597 2539184 SPCC1494.09c Schizosaccharomyces pombe 972h- sequence orphan NP_588534.1 2343056 R 284812 CDS SPCC1494.10 63054467 2538721 2345367..2348261 1 NC_003421.2 transcription factor (predicted) 2348261 adn3 2538721 adn3 Schizosaccharomyces pombe 972h- transcription factor (predicted) NP_588535.2 2345367 D 284812 CDS SPCC70.02c 19076036 2539524 complement(2349365..2349637) 1 NC_003421.2 mitochondrial ATPase inhibitor (predicted) 2349637 2539524 SPCC70.02c Schizosaccharomyces pombe 972h- mitochondrial ATPase inhibitor (predicted) NP_588536.1 2349365 R 284812 CDS SPCC70.03c 19076037 2539452 complement(2350728..2352206) 1 NC_003421.2 proline dehydrogenase (predicted) 2352206 2539452 SPCC70.03c Schizosaccharomyces pombe 972h- proline dehydrogenase (predicted) NP_588537.1 2350728 R 284812 CDS SPCC70.04c 19076038 2539057 complement(join(2353571..2353701,2353746..2353913,2353974..2354409)) 1 NC_003421.2 sequence orphan 2354409 2539057 SPCC70.04c Schizosaccharomyces pombe 972h- sequence orphan NP_588538.1 2353571 R 284812 CDS SPCC70.12c 295442800 9406964 complement(2355545..2355787) 1 NC_003421.2 predicted as non coding RNA from Solexa data; extender of the chronological lifespan protein Ecl1 2355787 ecl1 9406964 ecl1 Schizosaccharomyces pombe 972h- extender of the chronological lifespan protein Ecl1 XP_002788952.1 2355545 R 284812 CDS SPCC70.05c 19076039 2538820 complement(2359078..2361423) 1 NC_003421.2 serine/threonine protein kinase (predicted) 2361423 2538820 SPCC70.05c Schizosaccharomyces pombe 972h- serine/threonine protein kinase (predicted) NP_588539.1 2359078 R 284812 CDS SPCC70.06 19076041 2539567 join(2364897..2365548,2365585..2366151,2366195..2366352) 1 NC_003421.2 nuclear export factor (predicted) 2366352 2539567 SPCC70.06 Schizosaccharomyces pombe 972h- nuclear export factor (predicted) NP_588540.1 2364897 D 284812 CDS SPCC70.07c 19076042 2538707 complement(join(2366564..2366866,2366959..2367155,2367209..2367341)) 1 NC_003421.2 thymidylate kinase Tmp1 2367341 tmp1 2538707 tmp1 Schizosaccharomyces pombe 972h- thymidylate kinase Tmp1 NP_588542.1 2366564 R 284812 CDS SPCC70.08c 19076043 2539586 complement(join(2367804..2368569,2368620..2368636)) 1 NC_003421.2 methyltransferase (predicted) 2368636 2539586 SPCC70.08c Schizosaccharomyces pombe 972h- methyltransferase (predicted) NP_588543.1 2367804 R 284812 CDS SPCC70.09c 19076044 2539342 complement(join(2369108..2369592,2369649..2369790)) 1 NC_003421.2 conserved fungal protein 2369790 mug9 2539342 mug9 Schizosaccharomyces pombe 972h- conserved fungal protein NP_588544.1 2369108 R 284812 CDS SPCC70.10 19076045 2538735 2370893..2371360 1 NC_003421.2 confirmed by mRNA; sequence orphan 2371360 2538735 SPCC70.10 Schizosaccharomyces pombe 972h- sequence orphan NP_588545.1 2370893 D 284812 CDS SPCC1827.08c 63054468 2539142 complement(2371994..2373079) 1 NC_003421.2 F-box protein Pof7 2373079 pof7 2539142 pof7 Schizosaccharomyces pombe 972h- F-box protein Pof7 NP_588546.2 2371994 R 284812 CDS SPCC1827.01c 19076047 2538900 complement(2374120..2376078) 1 NC_003421.2 DUF1253 family protein 2376078 2538900 SPCC1827.01c Schizosaccharomyces pombe 972h- DUF1253 family protein NP_588547.1 2374120 R 284812 CDS SPCC1827.02c 295442802 2539176 complement(2377039..2378127) 1 NC_003421.2 cholinephosphate cytidylyltransferase (predicted) 2378127 2539176 SPCC1827.02c Schizosaccharomyces pombe 972h- cholinephosphate cytidylyltransferase (predicted) NP_588548.2 2377039 R 284812 CDS SPCC1827.03c 19076049 2539253 complement(2378485..2380023) 1 NC_003421.2 acetyl-CoA ligase (predicted) 2380023 2539253 SPCC1827.03c Schizosaccharomyces pombe 972h- acetyl-CoA ligase (predicted) NP_588549.1 2378485 R 284812 CDS SPCC1827.04 19076050 2539188 2382732..2384534 1 NC_003421.2 ankyrin repeat protein, unknown biological role 2384534 2539188 SPCC1827.04 Schizosaccharomyces pombe 972h- ankyrin repeat protein, unknown biological role NP_588550.1 2382732 D 284812 CDS SPCC1827.05c 19076051 2539389 complement(join(2384697..2385104,2385182..2385567,2385623..2385659)) 1 NC_003421.2 nucleolar RNA-binding protein NIFK (predicted) 2385659 2539389 SPCC1827.05c Schizosaccharomyces pombe 972h- nucleolar RNA-binding protein NIFK (predicted) NP_588551.1 2384697 R 284812 CDS SPCC1827.06c 19076052 2539267 complement(join(2386150..2387186,2387491..2387527)) 1 NC_003421.2 aspartate semialdehyde dehydrogenase (predicted) 2387527 2539267 SPCC1827.06c Schizosaccharomyces pombe 972h- aspartate semialdehyde dehydrogenase (predicted) NP_588552.1 2386150 R 284812 CDS SPCC1827.07c 162312135 3361154 complement(join(2388627..2388785,2388861..2389952,2390018..2390290,2390357..2390706,2390759..2390763,2390804..2390933,2390990..2391015,2391058..2391071)) 1 NC_003421.2 SPX/EXS domain protein 2391071 3361154 SPCC1827.07c Schizosaccharomyces pombe 972h- SPX/EXS domain protein NP_588554.2 2388627 R 284812 CDS SPCP1E11.02 19076055 2539030 join(2392272..2392395,2392441..2392571,2392640..2393087,2393142..2394391) 1 NC_003421.2 Ark1/Prk1 family protein kinase Ppk38 2394391 ppk38 2539030 ppk38 Schizosaccharomyces pombe 972h- Ark1/Prk1 family protein kinase Ppk38 NP_588555.1 2392272 D 284812 CDS SPCP1E11.03 19076056 2539600 join(2394675..2395324,2395363..2395612,2395671..2396002,2396048..2396096) 1 NC_003421.2 arrestin 2396096 mug170 2539600 mug170 Schizosaccharomyces pombe 972h- arrestin NP_588556.1 2394675 D 284812 CDS SPCP1E11.04c 19076057 2539537 complement(join(2396625..2397737,2397984..2398148)) 1 NC_003421.2 pears and lemons (PMID 15975911); membrane associated protein Pal1 2398148 pal1 2539537 pal1 Schizosaccharomyces pombe 972h- membrane associated protein Pal1 NP_588557.1 2396625 R 284812 CDS SPCP1E11.05c 19076058 2538854 complement(2398955..2400373) 1 NC_003421.2 acyl-coA-sterol acyltransferase (predicted) 2400373 2538854 SPCP1E11.05c Schizosaccharomyces pombe 972h- acyl-coA-sterol acyltransferase (predicted) NP_588558.1 2398955 R 284812 CDS SPCP1E11.06 19076059 2539311 2401980..2404577 1 NC_003421.2 May use internal initiator MET; AP-1 adaptor complex gamma subunit Apl4 (predicted) 2404577 apl4 2539311 apl4 Schizosaccharomyces pombe 972h- AP-1 adaptor complex gamma subunit Apl4 (predicted) NP_588559.1 2401980 D 284812 CDS SPCP1E11.07c 19076060 2538901 complement(2405115..2405543) 1 NC_003421.2 complexed with Cdc5 protein Cwf18 2405543 cwf18 2538901 cwf18 Schizosaccharomyces pombe 972h- complexed with Cdc5 protein Cwf18 NP_588560.1 2405115 R 284812 CDS SPCP1E11.08 19076061 2539413 join(2406373..2406443,2406504..2406623,2406755..2407346) 1 NC_003421.2 ribosome biogenesis protein Nsa2 (predicted) 2407346 2539413 SPCP1E11.08 Schizosaccharomyces pombe 972h- ribosome biogenesis protein Nsa2 (predicted) NP_588561.1 2406373 D 284812 CDS SPCP1E11.09c 19076062 2539598 complement(join(2407809..2408069,2408225..2408293)) 1 NC_003421.2 60S acidic ribosomal protein Rpp1-3 2408293 rpp103 2539598 rpp103 Schizosaccharomyces pombe 972h- 60S acidic ribosomal protein Rpp1-3 NP_588562.1 2407809 R 284812 CDS SPCP1E11.10 19076063 2538792 join(2408742..2408804,2408859..2408937,2408980..2409461) 1 NC_003421.2 ankyrin repeat protein, unknown biological role 2409461 2538792 SPCP1E11.10 Schizosaccharomyces pombe 972h- ankyrin repeat protein, unknown biological role NP_588563.1 2408742 D 284812 CDS SPCP1E11.11 19076064 2538833 2409922..2411850 1 NC_003421.2 Puf family RNA-binding protein 2411850 2538833 SPCP1E11.11 Schizosaccharomyces pombe 972h- Puf family RNA-binding protein NP_588564.1 2409922 D 284812 CDS SPCC569.08c 162312137 2538712 2412365..2412988 1 NC_003421.2 SPCC24E4.01, len:207; NOTE:misnamed as ade8 from S. cerevisiae homolog, but actually maps to the ade5 locus; misnamed as ade8 from S. cerevisiae homolog, but maps to the ade5 locus; phosphoribosylglycinamide formyltransferase 2412988 ade5 2538712 ade5 Schizosaccharomyces pombe 972h- phosphoribosylglycinamide formyltransferase XP_001713172.1 2412365 D 284812 CDS SPCC569.09 295442805 9407309 2414254..2414553 1 NC_003421.2 WARNING, this may be a none coding RNA, longest reading frome in solexa transcript SPNG2623; longest ORF with methionine is 99 amino acids; From Solexa transcript SPNG2623; This transcript is upregulated during stress; non-coding RNA or small protein (predicted); sequence orphan 2414553 9407309 SPCC569.09 Schizosaccharomyces pombe 972h- sequence orphan XP_002788953.1 2414254 D 284812 CDS SPCC569.07 19076066 2538779 complement(2415649..2417061) 1 NC_003421.2 aromatic aminotransferase (predicted) 2417061 2538779 SPCC569.07 Schizosaccharomyces pombe 972h- aromatic aminotransferase (predicted) NP_588566.1 2415649 R 284812 CDS SPCC569.06 19076067 2538696 complement(2420664..2422100) 1 NC_003421.2 S. pombe specific multicopy membrane protein family 1 2422100 2538696 SPCC569.06 Schizosaccharomyces pombe 972h- S. pombe specific multicopy membrane protein family 1 NP_588567.1 2420664 R 284812 CDS SPCC569.05c 19076068 2539551 2424336..2426066 1 NC_003421.2 spermidine family transporter (predicted) 2426066 2539551 SPCC569.05c Schizosaccharomyces pombe 972h- spermidine family transporter (predicted) NP_588568.1 2424336 D 284812 CDS SPCC569.04 19076069 2539346 complement(2427219..2427584) 1 NC_003421.2 sequence orphan 2427584 2539346 SPCC569.04 Schizosaccharomyces pombe 972h- sequence orphan NP_588569.1 2427219 R 284812 CDS SPCC569.03 19076070 2538960 complement(2430334..2431524) 1 NC_003421.2 cell surface glycoprotein (predicted), DUF1773 family protein 4 2431524 2538960 SPCC569.03 Schizosaccharomyces pombe 972h- cell surface glycoprotein (predicted), DUF1773 family protein 4 NP_588570.1 2430334 R 284812 CDS SPCC569.02c 19076071 2539456 2432612..2432953 1 NC_003421.2 possibly not coding, may be a spurious ORF; S. pombe specific UPF0321 family protein 2 2432953 2539456 SPCC569.02c Schizosaccharomyces pombe 972h- S. pombe specific UPF0321 family protein 2 NP_588571.1 2432612 D 284812 CDS SPCC569.01c 19076072 2539562 2434691..2435662 1 NC_003421.2 cell surface glycoprotein (predicted), DUF1773 family protein 5 2435662 2539562 SPCC569.01c Schizosaccharomyces pombe 972h- cell surface glycoprotein (predicted), DUF1773 family protein 5 NP_588572.1 2434691 D 284812 CDS SPBC1348.01 19113675 2543090 join(5451..5940,5999..6318) 1 NC_003423.3 has late log phase cDNA; S. pombe specific DUF999 protein family 5 6318 2543090 SPBC1348.01 Schizosaccharomyces pombe 972h- S. pombe specific DUF999 protein family 5 NP_592763.1 5451 D 284812 CDS SPBC1348.02 19113676 2541576 7980..9014 1 NC_003423.3 S. pombe specific 5Tm protein family 9014 2541576 SPBC1348.02 Schizosaccharomyces pombe 972h- S. pombe specific 5Tm protein family NP_592764.1 7980 D 284812 CDS SPBC1348.03 19113677 2542943 10569..11009 1 NC_003423.3 dubious 11009 2542943 SPBC1348.03 Schizosaccharomyces pombe 972h- dubious NP_592765.1 10569 D 284812 CDS SPBC1348.04 19113678 2542944 12176..12613 1 NC_003423.3 methyltransferase (predicted) 12613 2542944 SPBC1348.04 Schizosaccharomyces pombe 972h- methyltransferase (predicted) NP_592766.1 12176 D 284812 CDS SPBC1348.05 19113679 2542935 13572..15029 1 NC_003423.3 membrane transporter 15029 2542935 SPBC1348.05 Schizosaccharomyces pombe 972h- membrane transporter NP_592767.1 13572 D 284812 CDS SPBC1348.06c 19113680 2543138 complement(15981..16592) 1 NC_003423.3 conserved fungal family 16592 2543138 SPBC1348.06c Schizosaccharomyces pombe 972h- conserved fungal family NP_592768.1 15981 R 284812 CDS SPBC1348.07 19113681 2543136 join(19641..20058,20109..20383) 1 NC_003423.3 S. pombe specific DUF999 protein family 6 20383 2543136 SPBC1348.07 Schizosaccharomyces pombe 972h- S. pombe specific DUF999 protein family 6 NP_592769.1 19641 D 284812 CDS SPBC1348.08c 19113682 2541886 complement(22279..23529) 1 NC_003423.3 cell surface glycoprotein (predicted) 23529 2541886 SPBC1348.08c Schizosaccharomyces pombe 972h- cell surface glycoprotein (predicted) NP_592770.1 22279 R 284812 CDS SPBC1348.09 19113683 2541718 24916..25626 1 NC_003423.3 short chain dehydrogenase (predicted) 25626 2541718 SPBC1348.09 Schizosaccharomyces pombe 972h- short chain dehydrogenase (predicted) NP_592771.1 24916 D 284812 CDS SPBC1348.10c 19113684 5802732 complement(join(26287..26355,26420..28372)) 1 NC_003423.3 phospholipase (predicted) 28372 5802732 SPBC1348.10c Schizosaccharomyces pombe 972h- phospholipase (predicted) NP_592772.1 26287 R 284812 CDS SPBC1348.14c 162312139 2541736 complement(38587..40143) 1 NC_003423.3 hexose transporter Ght7 40143 ght7 2541736 ght7 Schizosaccharomyces pombe 972h- hexose transporter Ght7 NP_001018762.2 38587 R 284812 CDS SPBPB8B6.02c 68006338 3361185 complement(44810..46831) 1 NC_003423.3 urea transporter (predicted) 46831 3361185 SPBPB8B6.02c Schizosaccharomyces pombe 972h- urea transporter (predicted) NP_001018763.1 44810 R 284812 CDS SPBPB8B6.03 68006340 3361182 47428..49071 1 NC_003423.3 acetamidase (predicted) 49071 3361182 SPBPB8B6.03 Schizosaccharomyces pombe 972h- acetamidase (predicted) NP_001018764.1 47428 D 284812 CDS SPBPB8B6.04c 68006342 3361180 complement(join(49143..50910,50953..51062,51113..51181)) 1 NC_003423.3 transcription factor Grt1 (predicted) 51181 grt1 3361180 grt1 Schizosaccharomyces pombe 972h- transcription factor Grt1 (predicted) NP_001018765.1 49143 R 284812 CDS SPBPB8B6.05c 68006346 3361187 complement(54497..55567) 1 NC_003423.3 L-asparaginase (predicted) 55567 3361187 SPBPB8B6.05c Schizosaccharomyces pombe 972h- L-asparaginase (predicted) NP_001018766.1 54497 R 284812 CDS SPBPB8B6.06c 68006350 3361186 complement(55850..56785) 1 NC_003423.3 CRCB domain protein 56785 3361186 SPBPB8B6.06c Schizosaccharomyces pombe 972h- CRCB domain protein NP_001018767.1 55850 R 284812 CDS SPBPB21E7.01c 162312141 3361181 complement(58324..59646) 1 NC_003423.3 enolase (predicted) 59646 eno102 3361181 eno102 Schizosaccharomyces pombe 972h- enolase (predicted) NP_001018769.2 58324 R 284812 CDS SPBPB21E7.04c 68006360 3361178 complement(64669..65514) 1 NC_003423.3 human COMT homolog 2 65514 3361178 SPBPB21E7.04c Schizosaccharomyces pombe 972h- human COMT homolog 2 NP_001018770.1 64669 R 284812 CDS SPBPB21E7.05 68006366 3361179 66842..67225 1 NC_003423.3 sequence orphan 67225 3361179 SPBPB21E7.05 Schizosaccharomyces pombe 972h- sequence orphan NP_001018771.1 66842 D 284812 CDS SPBPB21E7.07 68006370 3361177 70204..71094 1 NC_003423.3 enhancer of RNA-mediated gene silencing 71094 aes1 3361177 aes1 Schizosaccharomyces pombe 972h- enhancer of RNA-mediated gene silencing NP_001018772.1 70204 D 284812 CDS SPBPB21E7.09 68006372 3361173 76318..77400 1 NC_003423.3 L-asparaginase (predicted) 77400 3361173 SPBPB21E7.09 Schizosaccharomyces pombe 972h- L-asparaginase (predicted) NP_001018773.1 76318 D 284812 CDS SPBPB10D8.01 19111837 2541399 81295..82953 1 NC_003423.3 cysteine transporter (predicted) 82953 2541399 SPBPB10D8.01 Schizosaccharomyces pombe 972h- cysteine transporter (predicted) NP_595045.1 81295 D 284812 CDS SPBPB10D8.02c 19111838 2541396 complement(83767..85431) 1 NC_003423.3 arylsulfatase (predicted) 85431 2541396 SPBPB10D8.02c Schizosaccharomyces pombe 972h- arylsulfatase (predicted) NP_595046.1 83767 R 284812 CDS SPBPB10D8.04c 19111839 2541392 complement(91724..92863) 1 NC_003423.3 membrane transporter (predicted) 92863 2541392 SPBPB10D8.04c Schizosaccharomyces pombe 972h- membrane transporter (predicted) NP_595047.1 91724 R 284812 CDS SPBPB10D8.05c 19111840 2541401 complement(94483..95622) 1 NC_003423.3 membrane transporter (predicted) 95622 2541401 SPBPB10D8.05c Schizosaccharomyces pombe 972h- membrane transporter (predicted) NP_595048.1 94483 R 284812 CDS SPBPB10D8.06c 19111841 2541374 complement(97242..98381) 1 NC_003423.3 membrane transporter (predicted) 98381 2541374 SPBPB10D8.06c Schizosaccharomyces pombe 972h- membrane transporter (predicted) NP_595049.1 97242 R 284812 CDS SPBPB10D8.07c 19111842 2541377 complement(100001..101140) 1 NC_003423.3 membrane transporter (predicted) 101140 2541377 SPBPB10D8.07c Schizosaccharomyces pombe 972h- membrane transporter (predicted) NP_595050.1 100001 R 284812 CDS SPBC359.01 162312143 2540923 105128..106873 1 NC_003423.3 amino acid permease, unknown 7 106873 2540923 SPBC359.01 Schizosaccharomyces pombe 972h- amino acid permease, unknown 7 NP_595051.2 105128 D 284812 CDS SPBC359.02 19111844 2540953 107759..108871 1 NC_003423.3 alanine racemase Alr2 108871 alr2 2540953 alr2 Schizosaccharomyces pombe 972h- alanine racemase Alr2 NP_595052.1 107759 D 284812 CDS SPBC359.03c 19111845 2541042 complement(111309..113048) 1 NC_003423.3 amino acid permease, unknown 8 113048 2541042 SPBC359.03c Schizosaccharomyces pombe 972h- amino acid permease, unknown 8 NP_595053.1 111309 R 284812 CDS SPBC359.04c 19111846 2540935 complement(118252..119328) 1 NC_003423.3 cell surface glycoprotein (prediected), DIPSY family 119328 2540935 SPBC359.04c Schizosaccharomyces pombe 972h- cell surface glycoprotein (prediected), DIPSY family NP_595054.1 118252 R 284812 CDS SPBC359.05 19111847 2540937 122747..127144 1 NC_003423.3 ABC transporter Abc3 127144 abc3 2540937 abc3 Schizosaccharomyces pombe 972h- ABC transporter Abc3 NP_595055.1 122747 D 284812 CDS SPBC359.06 19111848 2540926 128825..129598 1 NC_003423.3 adducin 129598 mug14 2540926 mug14 Schizosaccharomyces pombe 972h- adducin NP_595056.1 128825 D 284812 CDS SPBC1683.01 19111849 2540085 134303..136024 1 NC_003423.3 inorganic phosphate transporter (predicted) 136024 2540085 SPBC1683.01 Schizosaccharomyces pombe 972h- inorganic phosphate transporter (predicted) NP_595057.1 134303 D 284812 CDS SPBC1683.02 19111850 2540165 137044..138063 1 NC_003423.3 adenine deaminase (predicted) 138063 2540165 SPBC1683.02 Schizosaccharomyces pombe 972h- adenine deaminase (predicted) NP_595058.1 137044 D 284812 CDS SPBC1683.03c 19111851 2540164 complement(138525..140084) 1 NC_003423.3 membrane transporter 140084 2540164 SPBC1683.03c Schizosaccharomyces pombe 972h- membrane transporter NP_595059.1 138525 R 284812 CDS SPBC1683.04 19111852 2540167 142412..144910 1 NC_003423.3 glycosyl hydrolase family 3 144910 2540167 SPBC1683.04 Schizosaccharomyces pombe 972h- glycosyl hydrolase family 3 NP_595060.1 142412 D 284812 CDS SPBC1683.05 19111853 2540166 148750..150429 1 NC_003423.3 this does not appear to be a thiamin transporter in S. pombe,thiamine-regulated gene, and does not complement the S. cerevisiae thi7 mutation pers. comm. J. Stolz; membrane transporter (predicted) 150429 2540166 SPBC1683.05 Schizosaccharomyces pombe 972h- membrane transporter (predicted) NP_595061.1 148750 D 284812 CDS SPBC1683.06c 19111854 2540168 complement(151814..152746) 1 NC_003423.3 uridine ribohydrolase (predicted) 152746 2540168 SPBC1683.06c Schizosaccharomyces pombe 972h- uridine ribohydrolase (predicted) NP_595062.1 151814 R 284812 CDS SPBC1683.07 19111855 2539976 153562..155301 1 NC_003423.3 maltase alpha-glucosidase Mal1 155301 mal1 2539976 mal1 Schizosaccharomyces pombe 972h- maltase alpha-glucosidase Mal1 NP_595063.1 153562 D 284812 CDS SPBC1683.08 19111856 2539710 157555..159228 1 NC_003423.3 hexose transporter Ght4 159228 ght4 2539710 ght4 Schizosaccharomyces pombe 972h- hexose transporter Ght4 NP_595064.1 157555 D 284812 CDS SPBC1683.09c 19111857 2539711 complement(160461..162155) 1 NC_003423.3 ferric-chelate reductase Frp1 162155 frp1 2539711 frp1 Schizosaccharomyces pombe 972h- ferric-chelate reductase Frp1 NP_595065.1 160461 R 284812 CDS SPBC1683.10c 19111858 2539895 complement(164430..165158) 1 NC_003423.3 Pombe Ccc1-Like pcl1; ferrous iron transporter Pcl1 165158 pcl1 2539895 pcl1 Schizosaccharomyces pombe 972h- ferrous iron transporter Pcl1 NP_595066.1 164430 R 284812 CDS SPBC1683.11c 19111859 2539803 complement(166792..168348) 1 NC_003423.3 assuming this is mitochondrial and involved in amino acid biosynthesis as YPR006C, rather than peroxizomal involved in glyoxylate pathway as YER065C even though YER065C is more closely related, S. pombe does not have any of the other peroxisomal glyoxylate pathway enzymes; isocitrate lyase 168348 2539803 SPBC1683.11c Schizosaccharomyces pombe 972h- isocitrate lyase NP_595067.1 166792 R 284812 CDS SPBC1683.12 19111860 2539910 168671..170119 1 NC_003423.3 nicotinic acid plasma membrane transporter (predicted) 170119 2539910 SPBC1683.12 Schizosaccharomyces pombe 972h- nicotinic acid plasma membrane transporter (predicted) NP_595068.1 168671 D 284812 CDS SPBC1683.13c 19111861 2540000 complement(join(170167..171862,171909..171991,172040..172064,172105..172157)) 1 NC_003423.3 transcription factor (predicted) 172157 2540000 SPBC1683.13c Schizosaccharomyces pombe 972h- transcription factor (predicted) NP_595069.1 170167 R 284812 CDS SPBC1198.01 19111862 2540059 172991..174262 1 NC_003423.3 glutathione-dependent formaldehyde dehydrogenase (predicted) 174262 2540059 SPBC1198.01 Schizosaccharomyces pombe 972h- glutathione-dependent formaldehyde dehydrogenase (predicted) NP_595070.1 172991 D 284812 CDS SPBC1198.02 19111863 2540066 174842..175945 1 NC_003423.3 adenine deaminase Dea2 175945 dea2 2540066 dea2 Schizosaccharomyces pombe 972h- adenine deaminase Dea2 NP_595071.1 174842 D 284812 CDS SPBC1198.03c 19111864 2540041 complement(176297..177046) 1 NC_003423.3 sequence orphan 177046 2540041 SPBC1198.03c Schizosaccharomyces pombe 972h- sequence orphan NP_595072.1 176297 R 284812 CDS SPBC1198.04c 19111865 2539907 complement(join(177556..177608,177656..178291,178344..178651,178690..178811,178857..178988,179032..179283,179322..179387,179440..180416,180461..180608)) 1 NC_003423.3 alternative splicing (EMBL:AF199436); zinc finger protein Zas1 180608 zas1 2539907 zas1 Schizosaccharomyces pombe 972h- zinc finger protein Zas1 NP_595073.1 177556 R 284812 CDS SPBC1198.05 19111866 2539674 181695..182303 1 NC_003423.3 guanylate kinase (predicted) 182303 2539674 SPBC1198.05 Schizosaccharomyces pombe 972h- guanylate kinase (predicted) NP_595074.1 181695 D 284812 CDS SPBC1198.06c 19111867 2539944 complement(182825..184225) 1 NC_003423.3 mannan endo-1,6-alpha-mannosidase (predicted) 184225 2539944 SPBC1198.06c Schizosaccharomyces pombe 972h- mannan endo-1,6-alpha-mannosidase (predicted) NP_595075.1 182825 R 284812 CDS SPBC1198.07c 19111868 2539836 complement(join(185289..186535,186594..186870)) 1 NC_003423.3 mannan endo-1,6-alpha-mannosidase (predicted) 186870 2539836 SPBC1198.07c Schizosaccharomyces pombe 972h- mannan endo-1,6-alpha-mannosidase (predicted) NP_595076.1 185289 R 284812 CDS SPBC1198.08 19111869 2539648 join(187430..187455,187581..188979) 1 NC_003423.3 dipeptidase Dug1 (predicted) 188979 2539648 SPBC1198.08 Schizosaccharomyces pombe 972h- dipeptidase Dug1 (predicted) NP_595077.1 187430 D 284812 CDS SPBC1198.09 19111870 2539961 join(189665..189919,189978..190205) 1 NC_003423.3 ubiquitin conjugating enzyme Ubc16 190205 ubc16 2539961 ubc16 Schizosaccharomyces pombe 972h- ubiquitin conjugating enzyme Ubc16 NP_595078.1 189665 D 284812 CDS SPBC1198.10c 19111871 2539632 complement(join(190207..191217,191288..191414,191489..191676)) 1 NC_003423.3 mitochondrial asparagine-tRNA ligase Slm5 (predicted) 191676 slm5 2539632 slm5 Schizosaccharomyces pombe 972h- mitochondrial asparagine-tRNA ligase Slm5 (predicted) NP_595079.1 190207 R 284812 CDS SPBC1198.11c 19111872 2539930 complement(join(191936..192146,192198..192524,192566..193542)) 1 NC_003423.3 RNA polymerase I transcription termination factor Reb1 193542 reb1 2539930 reb1 Schizosaccharomyces pombe 972h- RNA polymerase I transcription termination factor Reb1 NP_595080.1 191936 R 284812 CDS SPBC1198.12 19111873 2540043 join(194678..194798,194845..195989) 1 NC_003423.3 fizzy-related protein Mfr1 195989 mfr1 2540043 mfr1 Schizosaccharomyces pombe 972h- fizzy-related protein Mfr1 NP_595081.1 194678 D 284812 CDS SPBC1198.13c 19111874 2539924 complement(join(195990..196244,196348..196491,196551..197075)) 1 NC_003423.3 transcription factor TFIIF complex beta subunit Tfg2 (predicted) 197075 tfg2 2539924 tfg2 Schizosaccharomyces pombe 972h- transcription factor TFIIF complex beta subunit Tfg2 (predicted) NP_595082.1 195990 R 284812 CDS SPBC1198.14c 162312145 2540031 complement(198099..199142) 1 NC_003423.3 fructose-1,6-bisphosphatase Fbp1 199142 fbp1 2540031 fbp1 Schizosaccharomyces pombe 972h- fructose-1,6-bisphosphatase Fbp1 NP_595083.2 198099 R 284812 CDS SPBC660.05 19111876 2541133 202536..202967 1 NC_003423.3 conserved fungal protein 202967 2541133 SPBC660.05 Schizosaccharomyces pombe 972h- conserved fungal protein NP_595084.1 202536 D 284812 CDS SPBC660.06 19111877 2541137 204649..205470 1 NC_003423.3 conserved fungal protein 205470 2541137 SPBC660.06 Schizosaccharomyces pombe 972h- conserved fungal protein NP_595085.1 204649 D 284812 CDS SPBC660.07 19111878 2541115 207078..209285 1 NC_003423.3 alpha,alpha-trehalase Ntp1 209285 ntp1 2541115 ntp1 Schizosaccharomyces pombe 972h- alpha,alpha-trehalase Ntp1 NP_595086.1 207078 D 284812 CDS SPBC660.08 19111879 2541085 209985..211172 1 NC_003423.3 sequence orphan 211172 2541085 SPBC660.08 Schizosaccharomyces pombe 972h- sequence orphan NP_595087.1 209985 D 284812 CDS SPBC660.09 19111880 2541138 211511..211858 1 NC_003423.3 sequence orphan 211858 mug168 2541138 mug168 Schizosaccharomyces pombe 972h- sequence orphan NP_595088.1 211511 D 284812 CDS SPBC660.10 19111881 2541108 join(212375..212491,212575..214899) 1 NC_003423.3 mitochondrial translation elongation factor G 214899 2541108 SPBC660.10 Schizosaccharomyces pombe 972h- mitochondrial translation elongation factor G NP_595089.1 212375 D 284812 CDS SPBC660.11 19111882 2541062 join(215147..215355,215606..215807,215861..216496) 1 NC_003423.3 single-stranded telomeric binding protein Tgc1 216496 tcg1 2541062 tcg1 Schizosaccharomyces pombe 972h- single-stranded telomeric binding protein Tgc1 NP_595090.1 215147 D 284812 CDS SPBC660.12c 19111883 2541092 complement(217001..218179) 1 NC_003423.3 aminotransferase (predicted) 218179 2541092 SPBC660.12c Schizosaccharomyces pombe 972h- aminotransferase (predicted) NP_595091.1 217001 R 284812 CDS SPBC660.13c 19111884 2541158 complement(join(219362..221150,221220..221260)) 1 NC_003423.3 DNA replication factor A subunit Ssb1 221260 ssb1 2541158 ssb1 Schizosaccharomyces pombe 972h- DNA replication factor A subunit Ssb1 NP_595092.1 219362 R 284812 CDS SPBC660.14 19111885 2540885 join(221699..222907,222976..223512) 1 NC_003423.3 mitotic inhibitor kinase Mik1 223512 mik1 2540885 mik1 Schizosaccharomyces pombe 972h- mitotic inhibitor kinase Mik1 NP_595093.1 221699 D 284812 CDS SPBC660.15 19111886 2541150 join(224329..224375,224424..224864,224937..224977,225299..225462,225508..226239) 1 NC_003423.3 NAS from PMID:16794580, not yet annotated at SGD; mRNA cleavage factor complex subunit (predicted) 226239 2541150 SPBC660.15 Schizosaccharomyces pombe 972h- mRNA cleavage factor complex subunit (predicted) NP_595094.1 224329 D 284812 CDS SPBC660.16 19111887 2541146 join(230368..230384,230446..230450,230616..230679,231497..231564,231737..233061) 1 NC_003423.3 PMID 10099784 is pending curation; phosphogluconate dehydrogenase, decarboxylating 233061 2541146 SPBC660.16 Schizosaccharomyces pombe 972h- phosphogluconate dehydrogenase, decarboxylating NP_595095.1 230368 D 284812 CDS SPBC660.17c 19111888 2540569 complement(join(233634..234070,234167..234248)) 1 NC_003423.3 sequence orphan 234248 2540569 SPBC660.17c Schizosaccharomyces pombe 972h- sequence orphan NP_595096.1 233634 R 284812 CDS SPBC31E1.01c 162312147 3361214 complement(join(234503..234523,234594..239513)) 1 NC_003423.3 autophagy associated protein Mug36 239513 atg2 3361214 atg2 Schizosaccharomyces pombe 972h- autophagy associated protein Mug36 XP_001713120.1 234503 R 284812 CDS SPBC31E1.02c 19111890 2540383 complement(240370..243069) 1 NC_003423.3 P-type ATPase, calcium transporting Pmr1 243069 pmr1 2540383 pmr1 Schizosaccharomyces pombe 972h- P-type ATPase, calcium transporting Pmr1 NP_595098.1 240370 R 284812 CDS SPBC31E1.03 19111891 2540389 complement(join(244611..244713,244763..244864,244935..244951)) 1 NC_003423.3 ubiquitin-like protein modifier Hub1 244951 hub1 2540389 hub1 Schizosaccharomyces pombe 972h- ubiquitin-like protein modifier Hub1 NP_595099.1 244611 R 284812 CDS SPBC31E1.04 19111892 2540289 join(245718..246297,246428..246585,246640..246855) 1 NC_003423.3 SNARE Pep12 246855 pep12 2540289 pep12 Schizosaccharomyces pombe 972h- SNARE Pep12 NP_595100.1 245718 D 284812 CDS SPBC31E1.05 19111893 2540395 join(247261..247398,247449..248753) 1 NC_003423.3 RNA export factor Gle1 248753 gle1 2540395 gle1 Schizosaccharomyces pombe 972h- RNA export factor Gle1 NP_595101.1 247261 D 284812 CDS SPBC31E1.06 63054700 2540390 join(249087..249188,249236..252499) 1 NC_003423.3 GTP binding protein Bms1 252499 bms1 2540390 bms1 Schizosaccharomyces pombe 972h- GTP binding protein Bms1 NP_595102.2 249087 D 284812 CDS SPBC800.02 19111895 2540918 join(253148..253231,253310..253984) 1 NC_003423.3 WHIskey; cell cycle transcriptional repressor Whi5 253984 whi5 2540918 whi5 Schizosaccharomyces pombe 972h- cell cycle transcriptional repressor Whi5 NP_595103.1 253148 D 284812 CDS SPBC800.03 19111896 2540821 254822..256885 1 NC_003423.3 cryptic loci regulator; histone deacetylase (class II) Clr3 256885 clr3 2540821 clr3 Schizosaccharomyces pombe 972h- histone deacetylase (class II) Clr3 NP_595104.1 254822 D 284812 CDS SPBC800.04c 19111897 2540682 complement(join(259577..259704,259805..259961)) 1 NC_003423.3 60S ribosomal protein L37a 259961 rpl4301 2540682 rpl4301 Schizosaccharomyces pombe 972h- 60S ribosomal protein L37a NP_595105.1 259577 R 284812 CDS SPBC800.05c 19111898 2540936 complement(260725..262074) 1 NC_003423.3 tubulin alpha 2 262074 atb2 2540936 atb2 Schizosaccharomyces pombe 972h- tubulin alpha 2 NP_595106.1 260725 R 284812 CDS SPBC800.06 19111899 2540268 262763..263650 1 NC_003423.3 ribosome biogenesis protein Brx1 263650 brx1 2540268 brx1 Schizosaccharomyces pombe 972h- ribosome biogenesis protein Brx1 NP_595107.1 262763 D 284812 CDS SPBC800.07c 19111900 2540692 complement(263915..264814) 1 NC_003423.3 mitochondrial translation elongation factor EF-Ts Tsf1 264814 tsf1 2540692 tsf1 Schizosaccharomyces pombe 972h- mitochondrial translation elongation factor EF-Ts Tsf1 NP_595108.1 263915 R 284812 CDS SPBC800.08 19111901 2540699 join(265374..265468,265605..266898) 1 NC_003423.3 tRNA (m1A) methyltransferase, translation initiation factor eIF-3 gamma subunit Gcd10 266898 gcd10 2540699 gcd10 Schizosaccharomyces pombe 972h- tRNA (m1A) methyltransferase, translation initiation factor eIF-3 gamma subunit Gcd10 NP_595109.1 265374 D 284812 CDS SPBC800.09 19111902 2540829 join(267490..267542,267581..267639,267678..267859,267968..268954) 1 NC_003423.3 Supressor of Uncontrolled Mitosis 2; G2/M transition checkpoint protein Sum2 268954 sum2 2540829 sum2 Schizosaccharomyces pombe 972h- G2/M transition checkpoint protein Sum2 NP_595110.1 267490 D 284812 CDS SPBC800.14c 19111903 2540696 complement(269707..270189) 1 NC_003423.3 DUF1772 family protein 270189 2540696 SPBC800.14c Schizosaccharomyces pombe 972h- DUF1772 family protein NP_595111.1 269707 R 284812 CDS SPBC800.10c 19111904 2540824 complement(270987..274337) 1 NC_003423.3 EPS15 repeat family actin cortical patch component (predicted) 274337 2540824 SPBC800.10c Schizosaccharomyces pombe 972h- EPS15 repeat family actin cortical patch component (predicted) NP_595112.1 270987 R 284812 CDS SPBC800.11 19111905 2540496 275907..277076 1 NC_003423.3 inosine-uridine preferring nucleoside hydrolase (predicted) 277076 2540496 SPBC800.11 Schizosaccharomyces pombe 972h- inosine-uridine preferring nucleoside hydrolase (predicted) NP_595113.1 275907 D 284812 CDS SPBC800.12c 19111906 2540807 complement(join(278247..278488,278530..278593,278651..278758)) 1 NC_003423.3 there may be some additional C-terminal exons; the ubiquitin domain appears to be truncated; ubiquitin family protein, unknown 278758 2540807 SPBC800.12c Schizosaccharomyces pombe 972h- ubiquitin family protein, unknown NP_595114.1 278247 R 284812 CDS SPBC800.13 19111907 2540915 279664..281103 1 NC_003423.3 histone H4 variant 281103 2540915 SPBC800.13 Schizosaccharomyces pombe 972h- histone H4 variant NP_595115.1 279664 D 284812 CDS SPBC1773.01 19111908 2539970 join(281629..281787,281825..282051,282096..283548) 1 NC_003423.3 striatin homolog 283548 2539970 SPBC1773.01 Schizosaccharomyces pombe 972h- striatin homolog NP_595116.1 281629 D 284812 CDS SPBC1773.02c 19111909 2539615 complement(283938..284525) 1 NC_003423.3 thioredoxin peroxidase 284525 2539615 SPBC1773.02c Schizosaccharomyces pombe 972h- thioredoxin peroxidase NP_595117.1 283938 R 284812 CDS SPBC1773.03c 19111910 2539964 complement(286039..287418) 1 NC_003423.3 aminotransferase class-III, unknown specificty 287418 2539964 SPBC1773.03c Schizosaccharomyces pombe 972h- aminotransferase class-III, unknown specificty NP_595118.1 286039 R 284812 CDS SPBC1773.04 19111911 2539735 289625..290635 1 NC_003423.3 flavonol reductase/cinnamoyl-CoA reductase family 290635 2539735 SPBC1773.04 Schizosaccharomyces pombe 972h- flavonol reductase/cinnamoyl-CoA reductase family NP_595119.1 289625 D 284812 CDS SPBC1773.05c 19111912 2540119 complement(290876..291958) 1 NC_003423.3 hexitol dehydrogenase (predicted) 291958 tms1 2540119 tms1 Schizosaccharomyces pombe 972h- hexitol dehydrogenase (predicted) NP_595120.1 290876 R 284812 CDS SPBC1773.06c 19111913 2540139 complement(293466..294506) 1 NC_003423.3 alcohol dehydrogenase (predicted) 294506 2540139 SPBC1773.06c Schizosaccharomyces pombe 972h- alcohol dehydrogenase (predicted) NP_595121.1 293466 R 284812 CDS SPBC1773.07c 19111914 2540142 complement(join(296236..296306,296405..296533,296706..297153)) 1 NC_003423.3 Ran GTPase binding protein Sbp1 297153 sbp1 2540142 sbp1 Schizosaccharomyces pombe 972h- Ran GTPase binding protein Sbp1 NP_595122.1 296236 R 284812 CDS SPBC1773.08c 19111915 2540179 complement(297771..298946) 1 NC_003423.3 mannosyltransferase complex subunit (predicted) 298946 2540179 SPBC1773.08c Schizosaccharomyces pombe 972h- mannosyltransferase complex subunit (predicted) NP_595123.1 297771 R 284812 CDS SPBC1773.09c 19111916 2540016 complement(join(299347..300074,300231..301108,301165..301214)) 1 NC_003423.3 meiotically upregulated gene Mug184 301214 mug184 2540016 mug184 Schizosaccharomyces pombe 972h- meiotically upregulated gene Mug184 NP_595124.1 299347 R 284812 CDS SPBC1773.10c 19111917 2540046 complement(301982..303688) 1 NC_003423.3 cytoplasmic asparagine-tRNA ligase Nrs1 (predicted) 303688 nrs1 2540046 nrs1 Schizosaccharomyces pombe 972h- cytoplasmic asparagine-tRNA ligase Nrs1 (predicted) NP_595125.1 301982 R 284812 CDS SPBC1773.11c 19111918 2539922 complement(305301..306491) 1 NC_003423.3 CDC50 domain protein 306491 mug89 2539922 mug89 Schizosaccharomyces pombe 972h- CDC50 domain protein NP_595126.1 305301 R 284812 CDS SPBC1773.12 19111919 2540137 308160..309944 1 NC_003423.3 transcription factor (predicted) 309944 2540137 SPBC1773.12 Schizosaccharomyces pombe 972h- transcription factor (predicted) NP_595127.1 308160 D 284812 CDS SPBC1773.13 19111920 2540092 310702..312147 1 NC_003423.3 aromatic aminotransferase (predicted) 312147 2540092 SPBC1773.13 Schizosaccharomyces pombe 972h- aromatic aminotransferase (predicted) NP_595128.1 310702 D 284812 CDS SPBC1773.14 19111921 2539980 313297..314682 1 NC_003423.3 argininosuccinate lyase 314682 arg7 2539980 arg7 Schizosaccharomyces pombe 972h- argininosuccinate lyase NP_595129.1 313297 D 284812 CDS SPBC1773.15 19111922 2539757 315962..317455 1 NC_003423.3 membrane transporter 317455 2539757 SPBC1773.15 Schizosaccharomyces pombe 972h- membrane transporter NP_595130.1 315962 D 284812 CDS SPBC1773.16c 19111923 2539785 complement(318693..320480) 1 NC_003423.3 transcription factor (predicted) 320480 2539785 SPBC1773.16c Schizosaccharomyces pombe 972h- transcription factor (predicted) NP_595131.1 318693 R 284812 CDS SPBC1773.17c 162312149 2540160 complement(321662..322684) 1 NC_003423.3 glyoxylate reductase (predicted) 322684 2540160 SPBC1773.17c Schizosaccharomyces pombe 972h- glyoxylate reductase (predicted) NP_595132.2 321662 R 284812 CDS SPBP26C9.02c 19111925 2541313 complement(324191..325162) 1 NC_003423.3 arginase Car1 325162 car1 2541313 car1 Schizosaccharomyces pombe 972h- arginase Car1 NP_595133.1 324191 R 284812 CDS SPBP26C9.03c 19111926 2541302 complement(327992..329746) 1 NC_003423.3 iron/zinc ion transporter (predicted) 329746 fet4 2541302 fet4 Schizosaccharomyces pombe 972h- iron/zinc ion transporter (predicted) NP_595134.1 327992 R 284812 CDS SPBC1271.15c 19111927 2540181 334388..336448 1 NC_003423.3 mitochondrial translation initiation factor IF-2Mt 336448 2540181 SPBC1271.15c Schizosaccharomyces pombe 972h- mitochondrial translation initiation factor IF-2Mt NP_595135.1 334388 D 284812 CDS SPBC1271.14 19111928 2539792 complement(336801..338138) 1 NC_003423.3 glutamate N-acetyltransferase (predicted) 338138 2539792 SPBC1271.14 Schizosaccharomyces pombe 972h- glutamate N-acetyltransferase (predicted) NP_595136.1 336801 R 284812 CDS SPBC1271.13 19111929 2540205 complement(join(340970..341519,341583..341656)) 1 NC_003423.3 mitochondrial ribosomal protein subunit L8 341656 mrpl8 2540205 mrpl8 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit L8 NP_595137.1 340970 R 284812 CDS SPBC1271.12 19111930 2540206 complement(join(342409..342950,343010..343322,343505..343627,343771..343849,344022..344047,344123..344135,344186..344256)) 1 NC_003423.3 oxysterol binding protein (predicted) 344256 kes1 2540206 kes1 Schizosaccharomyces pombe 972h- oxysterol binding protein (predicted) NP_595138.1 342409 R 284812 CDS SPBC1271.11 19111931 2540171 complement(join(345364..345947,346058..346178,346246..346253,346310..346337,346403..346438)) 1 NC_003423.3 mitochodrial tricarboxylate transporter (predicted) 346438 2540171 SPBC1271.11 Schizosaccharomyces pombe 972h- mitochodrial tricarboxylate transporter (predicted) NP_595139.1 345364 R 284812 CDS SPBC1271.10c 19111932 2540204 348314..350059 1 NC_003423.3 membrane transporter 350059 2540204 SPBC1271.10c Schizosaccharomyces pombe 972h- membrane transporter NP_595140.1 348314 D 284812 CDS SPBC1271.09 19111933 2539731 complement(join(350692..350740,350787..352369)) 1 NC_003423.3 glycerophosphodiester transporter 352369 2539731 SPBC1271.09 Schizosaccharomyces pombe 972h- glycerophosphodiester transporter NP_595141.1 350692 R 284812 CDS SPBC1271.08c 19111934 2539866 356910..357332 1 NC_003423.3 has transcript profile on microarray; sequence orphan 357332 2539866 SPBC1271.08c Schizosaccharomyces pombe 972h- sequence orphan NP_595142.1 356910 D 284812 CDS SPBC1271.07c 19111935 2539810 358855..359346 1 NC_003423.3 N-acetyltransferase (predicted) 359346 2539810 SPBC1271.07c Schizosaccharomyces pombe 972h- N-acetyltransferase (predicted) NP_595143.1 358855 D 284812 CDS SPBC1271.06c 19111936 2541409 359903..360343 1 NC_003423.3 has transcript profile on microarray; sequence orphan 360343 mug96 2541409 mug96 Schizosaccharomyces pombe 972h- sequence orphan NP_595144.1 359903 D 284812 CDS SPBC1271.05c 19111937 2539988 363442..364089 1 NC_003423.3 zf-AN1 type zinc finger protein 364089 2539988 SPBC1271.05c Schizosaccharomyces pombe 972h- zf-AN1 type zinc finger protein NP_595145.1 363442 D 284812 CDS SPBC1271.04c 19111938 2539832 join(365415..365630,365766..366542,366595..366654) 1 NC_003423.3 eIF-5A-deoxyhypusine synthase 366654 2539832 SPBC1271.04c Schizosaccharomyces pombe 972h- eIF-5A-deoxyhypusine synthase NP_595146.1 365415 D 284812 CDS SPBC1271.03c 19111939 2541320 367594..368328 1 NC_003423.3 NLI interacting factor family phosphatase (predicted) 368328 2541320 SPBC1271.03c Schizosaccharomyces pombe 972h- NLI interacting factor family phosphatase (predicted) NP_595147.1 367594 D 284812 CDS SPBC1271.02 19111940 2540190 complement(join(368558..370716,370776..370875)) 1 NC_003423.3 oligosaccharyltransferase subunit Stt3 370875 stt3 2540190 stt3 Schizosaccharomyces pombe 972h- oligosaccharyltransferase subunit Stt3 NP_595148.1 368558 R 284812 CDS SPBC1271.01c 19111941 2540187 372359..373549 1 NC_003423.3 otholog candidate YMR094W ? check?; F-box protein Pof13 373549 pof13 2540187 pof13 Schizosaccharomyces pombe 972h- F-box protein Pof13 NP_595149.1 372359 D 284812 CDS SPBC106.01 162312151 2540060 373889..375925 1 NC_003423.3 dual specificity protein kinase Mph1 375925 mph1 2540060 mph1 Schizosaccharomyces pombe 972h- dual specificity protein kinase Mph1 NP_595150.2 373889 D 284812 CDS SPBC106.02c 19111943 2540069 complement(376462..376836) 1 NC_003423.3 sulfiredoxin 376836 srx1 2540069 srx1 Schizosaccharomyces pombe 972h- sulfiredoxin NP_595151.1 376462 R 284812 CDS SPBC106.03 19111944 2540049 378627..379700 1 NC_003423.3 DUF1776 family protein 379700 2540049 SPBC106.03 Schizosaccharomyces pombe 972h- DUF1776 family protein NP_595152.1 378627 D 284812 CDS SPBC106.04 19111945 2540105 join(380228..380265,380383..380560,380624..382948) 1 NC_003423.3 adenosine deaminase Ada1 (predicted) 382948 ada1 2540105 ada1 Schizosaccharomyces pombe 972h- adenosine deaminase Ada1 (predicted) NP_595153.1 380228 D 284812 CDS SPBC106.05c 295442807 2540063 complement(join(383527..383612,383703..383874,383940..383960)) 1 NC_003423.3 F0-ATPase subunit E 383960 tim11 2540063 tim11 Schizosaccharomyces pombe 972h- F0-ATPase subunit E NP_595154.3 383527 R 284812 CDS SPBC106.06 19111947 2540053 384321..385904 1 NC_003423.3 chaperonin-containing T-complex delta subunit Cct4 385904 cct4 2540053 cct4 Schizosaccharomyces pombe 972h- chaperonin-containing T-complex delta subunit Cct4 NP_595155.1 384321 D 284812 CDS SPBC106.07c 19111948 2540058 complement(386506..387009) 1 NC_003423.3 was previously annotated as an acetyltransferase based on S. cerevisiae data, but this annotation was unconfirmed and has subsequently been removed in SGD; N alpha-acetylation related protein Nat2 (predicted) 387009 2540058 SPBC106.07c Schizosaccharomyces pombe 972h- N alpha-acetylation related protein Nat2 (predicted) NP_595156.1 386506 R 284812 CDS SPBC106.08c 19111949 2540107 complement(387841..388731) 1 NC_003423.3 cell surface glycoprotein (predicted), DUF1773 family protein 1 388731 mug2 2540107 mug2 Schizosaccharomyces pombe 972h- cell surface glycoprotein (predicted), DUF1773 family protein 1 NP_595157.1 387841 R 284812 CDS SPBC106.09 19111950 2539639 390989..395365 1 NC_003423.3 anaphase-promoting complex subunit Apc1 395365 cut4 2539639 cut4 Schizosaccharomyces pombe 972h- anaphase-promoting complex subunit Apc1 NP_595158.1 390989 D 284812 CDS SPBC106.10 19111951 2539781 396992..398530 1 NC_003423.3 glucose insensitive transcription 6; cAMP-dependent protein kinase catalytic subunit Pka1 398530 pka1 2539781 pka1 Schizosaccharomyces pombe 972h- cAMP-dependent protein kinase catalytic subunit Pka1 NP_595159.1 396992 D 284812 CDS SPBC106.11c 19111952 2539799 complement(399368..400684) 1 NC_003423.3 phospholipase A2, PAF family homolog 400684 plg7 2539799 plg7 Schizosaccharomyces pombe 972h- phospholipase A2, PAF family homolog NP_595160.1 399368 R 284812 CDS SPBC106.12c 19111953 2540184 complement(join(401165..401683,401844..401910,402017..402141,402195..402263,402305..402349)) 1 NC_003423.3 THO complex subunit (predicted) 402349 2540184 SPBC106.12c Schizosaccharomyces pombe 972h- THO complex subunit (predicted) NP_595161.1 401165 R 284812 CDS SPBC106.13 19111954 2540173 join(402696..402923,402986..403507,403558..404022) 1 NC_003423.3 conserved eukaryotic cytoskeletal protein 404022 2540173 SPBC106.13 Schizosaccharomyces pombe 972h- conserved eukaryotic cytoskeletal protein NP_595162.1 402696 D 284812 CDS SPBC106.14c 19111955 2539889 complement(404262..406421) 1 NC_003423.3 GO:0005515 IPI (pers. comm. Rosa Aligue); SDA1 family protein 406421 sda1 2539889 sda1 Schizosaccharomyces pombe 972h- SDA1 family protein NP_595163.1 404262 R 284812 CDS SPBC106.15 19111956 2540174 join(406874..406991,407056..407394,407451..407677) 1 NC_003423.3 isopentenyl-diphosphate delta-isomerase Idi1 407677 idi1 2540174 idi1 Schizosaccharomyces pombe 972h- isopentenyl-diphosphate delta-isomerase Idi1 NP_595164.1 406874 D 284812 CDS SPBC106.16 19111957 2540175 join(409496..409594,409655..410028,410147..410453) 1 NC_003423.3 20S proteasome component alpha 4 Pre6 410453 pre6 2540175 pre6 Schizosaccharomyces pombe 972h- 20S proteasome component alpha 4 Pre6 NP_595165.1 409496 D 284812 CDS SPBC106.17c 19111958 2539905 complement(411120..412634) 1 NC_003423.3 appears to be a gene loss in S. cerevisiae, their is no syntenic ortholog of the Ashbya protein AEL098W in S. cerevisiae; homoserine O-acetyltransferase (predicted) 412634 cys2 2539905 cys2 Schizosaccharomyces pombe 972h- homoserine O-acetyltransferase (predicted) NP_595166.1 411120 R 284812 CDS SPBC106.18 19111959 2539701 join(413556..413653,413894..414221) 1 NC_003423.3 60S ribosomal protein L25 (predicted) 414221 rpl2501 2539701 rpl2501 Schizosaccharomyces pombe 972h- 60S ribosomal protein L25 (predicted) NP_595167.1 413556 D 284812 CDS SPBC106.19 19111960 2539630 415111..416658 1 NC_003423.3 MAY USE INTERNAL INITITATOR MET; sequence orphan 416658 2539630 SPBC106.19 Schizosaccharomyces pombe 972h- sequence orphan NP_595168.1 415111 D 284812 CDS SPBC106.20 63054704 2540127 join(417319..417320,417371..417399,417460..417618,417665..419219,419273..419309,419411..419476) 1 NC_003423.3 exocyst complex subunit Exo70 (predicted) 419476 exo70 2540127 exo70 Schizosaccharomyces pombe 972h- exocyst complex subunit Exo70 (predicted) NP_595170.2 417319 D 284812 CDS SPBC582.03 19111963 2540880 421123..422571 1 NC_003423.3 G2/M B-type cyclin Cdc13 422571 cdc13 2540880 cdc13 Schizosaccharomyces pombe 972h- G2/M B-type cyclin Cdc13 NP_595171.1 421123 D 284812 CDS SPBC582.04c 295442809 2540902 complement(join(423269..423598,423669..423738,423782..423871,423912..424373,424424..424692,424747..424872,424921..425160,425223..425350,425410..425446)) 1 NC_003423.3 conserved fungal protein 425446 2540902 SPBC582.04c Schizosaccharomyces pombe 972h- conserved fungal protein NP_595172.2 423269 R 284812 CDS SPBC582.05c 19111965 2541071 complement(join(426160..428547,428634..428771,428903..429013)) 1 NC_003423.3 NAS from PMID: 16569515, not yet annotated at SGD; BRCT domain protein Brc1 429013 brc1 2541071 brc1 Schizosaccharomyces pombe 972h- BRCT domain protein Brc1 NP_595173.1 426160 R 284812 CDS SPBC582.06c 19111966 2541097 complement(429183..430166) 1 NC_003423.3 horsetail movement protein Hrs1/Mcp6 430166 mcp6 2541097 mcp6 Schizosaccharomyces pombe 972h- horsetail movement protein Hrs1/Mcp6 NP_595174.1 429183 R 284812 CDS SPBC582.07c 19111967 2540794 complement(430551..431780) 1 NC_003423.3 19S proteasome regulatory subunit Rpn7 431780 rpn7 2540794 rpn7 Schizosaccharomyces pombe 972h- 19S proteasome regulatory subunit Rpn7 NP_595175.1 430551 R 284812 CDS SPBC582.08 19111968 2540891 join(432550..433012,433204..434003,434057..434311) 1 NC_003423.3 alanine aminotransferase (predicted) 434311 2540891 SPBC582.08 Schizosaccharomyces pombe 972h- alanine aminotransferase (predicted) NP_595176.1 432550 D 284812 CDS SPBC582.09 19111969 2541114 join(434873..434917,434962..434991,435283..435761,435811..435973) 1 NC_003423.3 peroxisomal biogenesis factor 11 435973 pex11 2541114 pex11 Schizosaccharomyces pombe 972h- peroxisomal biogenesis factor 11 NP_595177.1 434873 D 284812 CDS SPBC582.10c 19111970 2540907 complement(join(436233..437936,437989..438777)) 1 NC_003423.3 ATP-dependent DNA helicase Rhp16b (predicted) 438777 2540907 SPBC582.10c Schizosaccharomyces pombe 972h- ATP-dependent DNA helicase Rhp16b (predicted) NP_595178.1 436233 R 284812 CDS SPBC428.01c 68009955 3361255 complement(join(439274..441187,441229..441337,441392..441484,441541..441667,441718..441751,441793..441840,441916..441975)) 1 NC_003423.3 alternative N terminal exon, and alteration to first intron acceptor adds 16 amino acids (pers. comm. Valerie Doye) Nov 17 2003; nucleoporin Nup107 441975 nup107 3361255 nup107 Schizosaccharomyces pombe 972h- nucleoporin Nup107 NP_001018780.1 439274 R 284812 CDS SPBC428.02c 19111972 2540831 complement(442631..443773) 1 NC_003423.3 branched chain amino acid aminotransferase Eca39 443773 eca39 2540831 eca39 Schizosaccharomyces pombe 972h- branched chain amino acid aminotransferase Eca39 NP_595180.1 442631 R 284812 CDS SPBC428.03c 19111973 2540606 complement(445417..446808) 1 NC_003423.3 thiamine-repressible acid phosphatase Pho4 446808 pho4 2540606 pho4 Schizosaccharomyces pombe 972h- thiamine-repressible acid phosphatase Pho4 NP_595181.1 445417 R 284812 CDS SPBC428.04 19111974 2541009 448934..449281 1 NC_003423.3 sequence orphan 449281 2541009 SPBC428.04 Schizosaccharomyces pombe 972h- sequence orphan NP_595182.1 448934 D 284812 CDS SPBC428.05c 19111975 2541050 complement(449771..451003) 1 NC_003423.3 argininosuccinate synthase (predicted) 451003 arg12 2541050 arg12 Schizosaccharomyces pombe 972h- argininosuccinate synthase (predicted) NP_595183.1 449771 R 284812 CDS SPBC428.06c 19111976 2540689 complement(join(451989..452416,452597..452705,452749..452879,452930..452964,453014..453039)) 1 NC_003423.3 NAS inferred from PMID: 16275642; histone deacetylase complex subunit Rxt2 453039 rxt2 2540689 rxt2 Schizosaccharomyces pombe 972h- histone deacetylase complex subunit Rxt2 NP_595184.1 451989 R 284812 CDS SPBC428.07 19111977 2540776 join(454230..454597,454668..454944,455002..456312) 1 NC_003423.3 meiotic chromosome segregation protein Meu6 456312 meu6 2540776 meu6 Schizosaccharomyces pombe 972h- meiotic chromosome segregation protein Meu6 NP_595185.1 454230 D 284812 CDS SPBC428.08c 19111978 2540825 complement(456575..458047) 1 NC_003423.3 histone H3 methyltransferase Clr4 458047 clr4 2540825 clr4 Schizosaccharomyces pombe 972h- histone H3 methyltransferase Clr4 NP_595186.1 456575 R 284812 CDS SPBC428.10 19111980 2540818 461306..463561 1 NC_003423.3 sequence orphan 463561 2540818 SPBC428.10 Schizosaccharomyces pombe 972h- sequence orphan NP_595188.1 461306 D 284812 CDS SPBC428.11 19111981 2540849 465633..466922 1 NC_003423.3 name from PMID:18808426; homocysteine synthase Met17 466922 2540849 SPBC428.11 Schizosaccharomyces pombe 972h- homocysteine synthase Met17 NP_595189.1 465633 D 284812 CDS SPBC428.12c 19111982 2540852 complement(join(468134..468198,468260..468418,468514..468609,468799..468829)) 1 NC_003423.3 RNA-binding protein 468829 2540852 SPBC428.12c Schizosaccharomyces pombe 972h- RNA-binding protein NP_595190.1 468134 R 284812 CDS SPBC428.13c 19111983 2540845 complement(join(469388..469445,469494..469893,469951..470125)) 1 NC_003423.3 Sid2p-Mob1p kinase complex regulatory subunit Mob1 470125 mob1 2540845 mob1 Schizosaccharomyces pombe 972h- Sid2p-Mob1p kinase complex regulatory subunit Mob1 NP_595191.1 469388 R 284812 CDS SPBC428.14 19111984 2540846 470652..471704 1 NC_003423.3 1-acylglycerol-3-phosphate acyltransferase (predicted) 471704 2540846 SPBC428.14 Schizosaccharomyces pombe 972h- 1-acylglycerol-3-phosphate acyltransferase (predicted) NP_595192.1 470652 D 284812 CDS SPBC428.15 19111985 2540972 472210..473439 1 NC_003423.3 care, no evidence for GTPase activity; GTP binding protein (predicted) 473439 2540972 SPBC428.15 Schizosaccharomyces pombe 972h- GTP binding protein (predicted) NP_595193.1 472210 D 284812 CDS SPBC428.16c 19111986 2540853 complement(join(473827..474063,474118..474376,474436..474497)) 1 NC_003423.3 Rheb GTPase Rhb1 474497 rhb1 2540853 rhb1 Schizosaccharomyces pombe 972h- Rheb GTPase Rhb1 NP_595194.1 473827 R 284812 CDS SPBC428.17c 19111987 2540860 complement(join(474627..474881,474927..474979,475020..476520)) 1 NC_003423.3 Wings apart-like homolog Wapl 476520 wpl1 2540860 wpl1 Schizosaccharomyces pombe 972h- Wings apart-like homolog Wapl NP_595195.1 474627 R 284812 CDS SPBC428.18 19111988 2540847 477365..478699 1 NC_003423.3 PMID 11836525 for similarity; replication licensing factor Cdt1 478699 cdt1 2540847 cdt1 Schizosaccharomyces pombe 972h- replication licensing factor Cdt1 NP_595196.1 477365 D 284812 CDS SPBC428.19c 19111989 2540858 complement(join(479203..480369,480579..480896)) 1 NC_003423.3 U3 snoRNP protein Utp15 (predicted) 480896 2540858 SPBC428.19c Schizosaccharomyces pombe 972h- U3 snoRNP protein Utp15 (predicted) NP_595197.1 479203 R 284812 CDS SPBC428.20c 162312153 2540690 complement(join(481076..481552,481639..483437,483478..483539,483579..483706)) 1 NC_003423.3 gamma tubulin complex Spc98/GCP3 subunit Alp6 483706 alp6 2540690 alp6 Schizosaccharomyces pombe 972h- gamma tubulin complex Spc98/GCP3 subunit Alp6 XP_001713121.1 481076 R 284812 CDS SPBC902.02c 19111992 2541270 complement(join(483949..484312,484362..484492,484573..486960)) 1 NC_003423.3 Ctf18 RFC-like complex is required in the absence of Rfc1 (PMID 16040599); DNA replication factor C complex subunit Ctf18 486960 ctf18 2541270 ctf18 Schizosaccharomyces pombe 972h- DNA replication factor C complex subunit Ctf18 NP_595200.1 483949 R 284812 CDS SPBC902.03 19111993 2541282 488230..488772 1 NC_003423.3 Spo7 homolog 488772 2541282 SPBC902.03 Schizosaccharomyces pombe 972h- Spo7 homolog NP_595201.1 488230 D 284812 CDS SPBC902.04 19111994 2541281 join(489882..489911,489950..489987,490078..491620,491675..491833) 1 NC_003423.3 RNA-binding protein 491833 2541281 SPBC902.04 Schizosaccharomyces pombe 972h- RNA-binding protein NP_595202.1 489882 D 284812 CDS SPBC902.05c 19111995 2541260 complement(join(492162..492268,492319..493083,493238..493286,493334..493477,493584..493655)) 1 NC_003423.3 isocitrate dehydrogenase (NAD+) subunit 2 493655 idh2 2541260 idh2 Schizosaccharomyces pombe 972h- isocitrate dehydrogenase (NAD+) subunit 2 NP_595203.1 492162 R 284812 CDS SPBC902.06 19111996 2541264 494742..495935 1 NC_003423.3 MT organizer Mto2 495935 mto2 2541264 mto2 Schizosaccharomyces pombe 972h- MT organizer Mto2 NP_595204.1 494742 D 284812 CDS SPBC1685.01 19111997 2540019 496813..497649 1 NC_003423.3 suppressor of calcineurin deficiency (PMID 9427748); dual-specificity MAP kinase phosphatase Pmp1 497649 pmp1 2540019 pmp1 Schizosaccharomyces pombe 972h- dual-specificity MAP kinase phosphatase Pmp1 NP_595205.1 496813 D 284812 CDS SPBC1685.02c 19111998 2540015 complement(join(498487..498543,498601..498990)) 1 NC_003423.3 40S ribosomal protein S12 498990 rps1202 2540015 rps1202 Schizosaccharomyces pombe 972h- 40S ribosomal protein S12 NP_595206.1 498487 R 284812 CDS SPBC1685.03 19111999 2539654 join(499374..499397,499556..499869,499930..500161) 1 NC_003423.3 signal peptidase subunit Sec11 (predicted) 500161 sec11 2539654 sec11 Schizosaccharomyces pombe 972h- signal peptidase subunit Sec11 (predicted) NP_595207.1 499374 D 284812 CDS SPBC1685.16 68010075 3361294 join(501695..501735,501802..501862) 1 NC_003423.3 found in directed search for VMA9 ortholog, possibly still missing a bit at the N-term July 18th 2004; V-type ATPase subunit e 501862 vma9 3361294 vma9 Schizosaccharomyces pombe 972h- V-type ATPase subunit e NP_001018781.1 501695 D 284812 CDS SPBC1685.04 19112000 2539740 502873..503850 1 NC_003423.3 sequence orphan 503850 2539740 SPBC1685.04 Schizosaccharomyces pombe 972h- sequence orphan NP_595208.1 502873 D 284812 CDS SPBC1685.05 19112001 2539936 505923..508916 1 NC_003423.3 serine protease (predicted) 508916 2539936 SPBC1685.05 Schizosaccharomyces pombe 972h- serine protease (predicted) NP_595209.1 505923 D 284812 CDS SPBC1685.06 19112002 2539762 join(509502..509895,509942..510984) 1 NC_003423.3 poly(A) polymerase Cid11 (predicted) 510984 cid11 2539762 cid11 Schizosaccharomyces pombe 972h- poly(A) polymerase Cid11 (predicted) NP_595210.1 509502 D 284812 CDS SPBC1685.07c 19112003 2540081 complement(511204..512466) 1 NC_003423.3 vacuolar amino acid transporter (predicted) 512466 2540081 SPBC1685.07c Schizosaccharomyces pombe 972h- vacuolar amino acid transporter (predicted) NP_595211.1 511204 R 284812 CDS SPBC1685.08 19112004 2539769 join(514216..514553,514724..514927,514972..515704) 1 NC_003423.3 histone deacetylase complex subunit Cti6 515704 cti6 2539769 cti6 Schizosaccharomyces pombe 972h- histone deacetylase complex subunit Cti6 NP_595212.1 514216 D 284812 CDS SPBC1685.09 19112005 2539643 join(516442..516503,516555..516654,516727..516735) 1 NC_003423.3 40S ribosomal protein S29 516735 rps29 2539643 rps29 Schizosaccharomyces pombe 972h- 40S ribosomal protein S29 NP_595213.1 516442 D 284812 CDS SPBC1685.10 19112006 2539969 join(517344..517349,517388..517480,517685..517837) 1 NC_003423.3 40S ribosomal protein S27 517837 rps27 2539969 rps27 Schizosaccharomyces pombe 972h- 40S ribosomal protein S27 NP_595214.1 517344 D 284812 CDS SPBC1685.11 19112007 2539770 518372..519463 1 NC_003423.3 RecA family ATPase Rlp1 519463 rlp1 2539770 rlp1 Schizosaccharomyces pombe 972h- RecA family ATPase Rlp1 NP_595215.1 518372 D 284812 CDS SPBC1685.12c 19112008 2540091 complement(523887..524240) 1 NC_003423.3 dubious 524240 2540091 SPBC1685.12c Schizosaccharomyces pombe 972h- dubious NP_595216.1 523887 R 284812 CDS SPBC1685.13 19112009 2539727 526091..526642 1 NC_003423.3 non classical export pathway protein (predicted) 526642 2539727 SPBC1685.13 Schizosaccharomyces pombe 972h- non classical export pathway protein (predicted) NP_595217.1 526091 D 284812 CDS SPBC1685.14c 19112010 2539965 complement(join(529453..531742,531812..531904,531957..531979)) 1 NC_003423.3 Vid27 family protein 531979 2539965 SPBC1685.14c Schizosaccharomyces pombe 972h- Vid27 family protein NP_595218.1 529453 R 284812 CDS SPBC1685.15c 162312155 2539700 complement(join(532697..535020,535061..535091)) 1 NC_003423.3 kinesin-like protein Klp6 535091 klp6 2539700 klp6 Schizosaccharomyces pombe 972h- kinesin-like protein Klp6 XP_001713122.1 532697 R 284812 CDS SPBC649.02 19112013 2541084 join(535383..535458,535632..535987) 1 NC_003423.3 40S ribosomal protein S19 535987 rps1902 2541084 rps1902 Schizosaccharomyces pombe 972h- 40S ribosomal protein S19 NP_595221.1 535383 D 284812 CDS SPBC649.03 19112014 2541120 536985..537854 1 NC_003423.3 XP-A family homolog Rhp14 537854 rhp14 2541120 rhp14 Schizosaccharomyces pombe 972h- XP-A family homolog Rhp14 NP_595222.1 536985 D 284812 CDS SPBC649.04 19112015 2541391 join(539418..539453,539523..539704,539915..539960) 1 NC_003423.3 UV-induced protein Uvi15 539960 uvi15 2541391 uvi15 Schizosaccharomyces pombe 972h- UV-induced protein Uvi15 NP_595223.1 539418 D 284812 CDS SPBC649.05 19112016 2541141 join(541283..541289,541332..542971) 1 NC_003423.3 spindle pole body protein Cut12 542971 cut12 2541141 cut12 Schizosaccharomyces pombe 972h- spindle pole body protein Cut12 NP_595224.1 541283 D 284812 CDS SPBC354.01 63054708 2540303 join(543421..543438,543484..543552,543668..543838,543892..544725) 1 NC_003423.3 GTP binding protein Gtp1 544725 gtp1 2540303 gtp1 Schizosaccharomyces pombe 972h- GTP binding protein Gtp1 NP_595225.2 543421 D 284812 CDS SPBC354.02c 19112018 2541037 complement(join(545071..546152,546331..546464,546590..546622,546679..546791,546845..546912,546957..546966)) 1 NC_003423.3 translocon alpha subunit Sec61 546966 sec61 2541037 sec61 Schizosaccharomyces pombe 972h- translocon alpha subunit Sec61 NP_595226.1 545071 R 284812 CDS SPBC354.03 19112019 2540929 548670..549812 1 NC_003423.3 WD repeat protein Swd3 549812 swd3 2540929 swd3 Schizosaccharomyces pombe 972h- WD repeat protein Swd3 NP_595227.1 548670 D 284812 CDS SPBC354.04 19112020 2541020 550296..550787 1 NC_003423.3 was previously annotated as dubious; sequence orphan 550787 2541020 SPBC354.04 Schizosaccharomyces pombe 972h- sequence orphan NP_595228.1 550296 D 284812 CDS SPBC354.05c 19112021 2541044 complement(551743..554124) 1 NC_003423.3 membrane-tethered transcription factor (predicted) 554124 sre2 2541044 sre2 Schizosaccharomyces pombe 972h- membrane-tethered transcription factor (predicted) NP_595229.1 551743 R 284812 CDS SPBC354.06 19112022 2541005 join(555893..555969,556399..556612) 1 NC_003423.3 mitochondrial ribosomal protein subunit S16 556612 mrps16 2541005 mrps16 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit S16 NP_595230.1 555893 D 284812 CDS SPBC354.07c 295442811 2540947 complement(join(558335..559225,559273..559474,559942..560028,560151..560163,560231..560246)) 1 NC_003423.3 oxysterol binding protein (predicted) 560246 2540947 SPBC354.07c Schizosaccharomyces pombe 972h- oxysterol binding protein (predicted) NP_595231.2 558335 R 284812 CDS SPBC354.08c 19112024 2540988 complement(join(561504..563928,563965..564137)) 1 NC_003423.3 DUF221 family protein 564137 2540988 SPBC354.08c Schizosaccharomyces pombe 972h- DUF221 family protein NP_595232.1 561504 R 284812 CDS SPBC354.09c 19112025 2540952 complement(565310..567694) 1 NC_003423.3 RCA, computational analysis, details avaiable on request; Tre1 family protein (predicted) 567694 2540952 SPBC354.09c Schizosaccharomyces pombe 972h- Tre1 family protein (predicted) NP_595233.1 565310 R 284812 CDS SPBC354.10 19112026 2540930 571061..573952 1 NC_003423.3 RNAPII degradation factor (predicted) 573952 2540930 SPBC354.10 Schizosaccharomyces pombe 972h- RNAPII degradation factor (predicted) NP_595234.1 571061 D 284812 CDS SPBC354.11c 19112027 2540963 complement(575773..576291) 1 NC_003423.3 changed to dubious based on transcriptome data 08-01-08; dubious 576291 2540963 SPBC354.11c Schizosaccharomyces pombe 972h- dubious NP_595235.1 575773 R 284812 CDS SPBC354.12 19112028 2540975 578731..579738 1 NC_003423.3 glyceraldehyde 3-phosphate dehydrogenase Gpd3 579738 gpd3 2540975 gpd3 Schizosaccharomyces pombe 972h- glyceraldehyde 3-phosphate dehydrogenase Gpd3 NP_595236.1 578731 D 284812 CDS SPBC354.13 19112029 2540304 581247..583448 1 NC_003423.3 Rho-type GTPase activating protein Rga6 583448 rga6 2540304 rga6 Schizosaccharomyces pombe 972h- Rho-type GTPase activating protein Rga6 NP_595237.1 581247 D 284812 CDS SPBC354.14c 19112030 2541010 complement(join(583794..583960,584042..584935,585052..585411,585571..585691,585754..585836,585882..585909)) 1 NC_003423.3 vacuolar protein Vac8 585909 vac8 2541010 vac8 Schizosaccharomyces pombe 972h- vacuolar protein Vac8 NP_595238.1 583794 R 284812 CDS SPBC354.15 19112031 2540916 586543..587781 1 NC_003423.3 L-pipecolate oxidase 587781 fap1 2540916 fap1 Schizosaccharomyces pombe 972h- L-pipecolate oxidase NP_595239.1 586543 D 284812 CDS SPBC1706.01 19112032 2539642 588765..591194 1 NC_003423.3 Win1-interacting SH3 domain protein; tip elongation aberrant protein Tea4 591194 tea4 2539642 tea4 Schizosaccharomyces pombe 972h- tip elongation aberrant protein Tea4 NP_595240.1 588765 D 284812 CDS SPBC1706.03 19112033 2539859 594472..596748 1 NC_003423.3 mitochondrial fusion GTPase protein 596748 fzo1 2539859 fzo1 Schizosaccharomyces pombe 972h- mitochondrial fusion GTPase protein NP_595241.1 594472 D 284812 CDS SPBC839.02 19112034 2541205 join(597611..599124,599256..599334) 1 NC_003423.3 arrestin Aly1 related 599334 2541205 SPBC839.02 Schizosaccharomyces pombe 972h- arrestin Aly1 related NP_595242.1 597611 D 284812 CDS SPBC839.03c 19112035 2541135 complement(599428..600183) 1 NC_003423.3 neddylation protein Dcn1 (predicted) 600183 2541135 SPBC839.03c Schizosaccharomyces pombe 972h- neddylation protein Dcn1 (predicted) NP_595243.1 599428 R 284812 CDS SPBC839.04 19112036 2541191 601281..602042 1 NC_003423.3 60S ribosomal protein L8 602042 rpl803 2541191 rpl803 Schizosaccharomyces pombe 972h- 60S ribosomal protein L8 NP_595244.1 601281 D 284812 CDS SPBC839.05c 19112037 2541229 complement(join(603704..604096,604375..604377)) 1 NC_003423.3 40S ribosomal protein S17 604377 rps1701 2541229 rps1701 Schizosaccharomyces pombe 972h- 40S ribosomal protein S17 NP_595245.1 603704 R 284812 CDS SPBC839.06 19112038 2541204 608171..611284 1 NC_003423.3 Wis1-Sty1 MAPKK-MAPK cascade (PMID 10428498); P-type ATPase, calcium transporting Cta3 611284 cta3 2541204 cta3 Schizosaccharomyces pombe 972h- P-type ATPase, calcium transporting Cta3 NP_595246.1 608171 D 284812 CDS SPBC839.07 19112039 2541214 612670..613086 1 NC_003423.3 Cdc25 family phosphatase Ibp1 613086 ibp1 2541214 ibp1 Schizosaccharomyces pombe 972h- Cdc25 family phosphatase Ibp1 NP_595247.1 612670 D 284812 CDS SPBC839.08c 19112040 2541199 complement(join(613507..616163,616316..616466)) 1 NC_003423.3 pig-N (predicted) 616466 its8 2541199 its8 Schizosaccharomyces pombe 972h- pig-N (predicted) NP_595248.1 613507 R 284812 CDS SPBC839.09c 19112041 2541198 complement(join(617679..617968,618063..618138)) 1 NC_003423.3 mitochondrial ribosomal protein subunit Mrp21 618138 mrp21 2541198 mrp21 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit Mrp21 NP_595249.1 617679 R 284812 CDS SPBC839.10 19112042 2541211 join(618354..618372,618422..620259,620309..620539) 1 NC_003423.3 U1 snRNP-associated protein Usp107 620539 usp107 2541211 usp107 Schizosaccharomyces pombe 972h- U1 snRNP-associated protein Usp107 NP_595250.1 618354 D 284812 CDS SPBC839.11c 19112043 2541206 complement(620635..621603) 1 NC_003423.3 uridine diphosphate-N-acetylglucosamine transporter Hut1 621603 hut1 2541206 hut1 Schizosaccharomyces pombe 972h- uridine diphosphate-N-acetylglucosamine transporter Hut1 NP_595251.1 620635 R 284812 CDS SPBC839.12 19112044 2541197 622332..622964 1 NC_003423.3 DNA-directed RNA polymerase III complex subunit Rpc31 622964 rpc31 2541197 rpc31 Schizosaccharomyces pombe 972h- DNA-directed RNA polymerase III complex subunit Rpc31 NP_595252.1 622332 D 284812 CDS SPBC839.13c 19112045 2541175 complement(join(623400..623952,623999..624039)) 1 NC_003423.3 60S ribosomal protein L13/L16 624039 rpl1601 2541175 rpl1601 Schizosaccharomyces pombe 972h- 60S ribosomal protein L13/L16 NP_595253.1 623400 R 284812 CDS SPBC839.14c 19112046 2541223 complement(join(624426..625101,625157..625197)) 1 NC_003423.3 methyltransferase (predicted) 625197 2541223 SPBC839.14c Schizosaccharomyces pombe 972h- methyltransferase (predicted) NP_595254.1 624426 R 284812 CDS SPBC839.15c 19112047 2539917 complement(626106..627488) 1 NC_003423.3 translation elongation factor EF-1 alpha Ef1a-c 627488 ef1a-c 2539917 ef1a-c Schizosaccharomyces pombe 972h- translation elongation factor EF-1 alpha Ef1a-c NP_595255.1 626106 R 284812 CDS SPBC839.16 19112048 2541217 join(628030..628064,628115..628259,628538..631171) 1 NC_003423.3 C1-5,6,7,8-tetrahydrofolate (THF) synthase 631171 2541217 SPBC839.16 Schizosaccharomyces pombe 972h- C1-5,6,7,8-tetrahydrofolate (THF) synthase NP_595256.1 628030 D 284812 CDS SPBC839.17c 19112049 2541195 complement(join(631842..631881,631929..632142,632248..632267,632396..632433,632616..632642)) 1 NC_003423.3 FKBP-type peptidyl-prolyl cis-trans isomerase Fkh1 632642 fkh1 2541195 fkh1 Schizosaccharomyces pombe 972h- FKBP-type peptidyl-prolyl cis-trans isomerase Fkh1 NP_595257.1 631842 R 284812 CDS SPBC115.03 162312157 2540095 complement(634344..635450) 1 NC_003423.3 gfo/idh/mocA family oxidoreductase (predicted) 635450 2540095 SPBC115.03 Schizosaccharomyces pombe 972h- gfo/idh/mocA family oxidoreductase (predicted) NP_595258.2 634344 R 284812 CDS SPBC115.02c 19112051 2540093 637654..639018 1 NC_003423.3 AFG1 family mitochondrial ATPase 639018 2540093 SPBC115.02c Schizosaccharomyces pombe 972h- AFG1 family mitochondrial ATPase NP_595259.1 637654 D 284812 CDS SPBC115.01c 19112052 2539660 join(639374..639428,639512..640137) 1 NC_003423.3 exosome subunit Rrp46 (predicted) 640137 rrp46 2539660 rrp46 Schizosaccharomyces pombe 972h- exosome subunit Rrp46 (predicted) NP_595260.1 639374 D 284812 CDS SPBC947.15c 19112053 2540211 641686..643341 1 NC_003423.3 NADH dehydrogenase 643341 2540211 SPBC947.15c Schizosaccharomyces pombe 972h- NADH dehydrogenase NP_595261.1 641686 D 284812 CDS SPBC947.14c 19112054 2541262 join(644291..644479,644547..644669) 1 NC_003423.3 sequence orphan 644669 2541262 SPBC947.14c Schizosaccharomyces pombe 972h- sequence orphan NP_595262.1 644291 D 284812 CDS SPBC947.13 19112055 2541271 complement(645220..646578) 1 NC_003423.3 RNA polymerase II associated protein (predicted) 646578 rba50 2541271 rba50 Schizosaccharomyces pombe 972h- RNA polymerase II associated protein (predicted) NP_595263.1 645220 R 284812 CDS SPBC947.12 19112056 2541247 complement(join(647507..648070,648137..648883,648927..648989)) 1 NC_003423.3 spindle pole body protein Kms2 648989 kms2 2541247 kms2 Schizosaccharomyces pombe 972h- spindle pole body protein Kms2 NP_595264.1 647507 R 284812 CDS SPBC947.11c 19112057 2541276 join(649980..651564,651609..652452,652500..652833) 1 NC_003423.3 DNA replication factor C complex subunit Elg1 652833 elg1 2541276 elg1 Schizosaccharomyces pombe 972h- DNA replication factor C complex subunit Elg1 NP_595265.1 649980 D 284812 CDS SPBC947.10 19112058 2541251 complement(join(653091..653363,653432..655189)) 1 NC_003423.3 ubiquitin-protein ligase E3 (predicted) 655189 2541251 SPBC947.10 Schizosaccharomyces pombe 972h- ubiquitin-protein ligase E3 (predicted) NP_595266.1 653091 R 284812 CDS SPBC947.09 19112059 2541295 complement(656323..657108) 1 NC_003423.3 ThiJ domain protein 657108 2541295 SPBC947.09 Schizosaccharomyces pombe 972h- ThiJ domain protein NP_595267.1 656323 R 284812 CDS SPBC947.08c 19112060 2541284 659085..660101 1 NC_003423.3 histone promoter control protein Hpc2 (predicted) 660101 2541284 SPBC947.08c Schizosaccharomyces pombe 972h- histone promoter control protein Hpc2 (predicted) NP_595268.1 659085 D 284812 CDS SPBC947.07 19112061 2541261 complement(660384..661085) 1 NC_003423.3 ribosome biogenesis protein Rrp14-C 661085 2541261 SPBC947.07 Schizosaccharomyces pombe 972h- ribosome biogenesis protein Rrp14-C NP_595269.1 660384 R 284812 CDS SPBC947.06c 19112062 2541275 662940..664436 1 NC_003423.3 spermidine family transporter (predicted) 664436 2541275 SPBC947.06c Schizosaccharomyces pombe 972h- spermidine family transporter (predicted) NP_595270.1 662940 D 284812 CDS SPBC947.05c 19112063 2541227 667125..668819 1 NC_003423.3 ferric-chelate reductase (predicted) 668819 2541227 SPBC947.05c Schizosaccharomyces pombe 972h- ferric-chelate reductase (predicted) NP_595271.1 667125 D 284812 CDS SPBC947.04 19112064 2541237 complement(669740..672661) 1 NC_003423.3 cell surface glycoprotein (predicted), DIPSY family 672661 2541237 SPBC947.04 Schizosaccharomyces pombe 972h- cell surface glycoprotein (predicted), DIPSY family NP_595272.1 669740 R 284812 CDS SPBC947.03c 295442813 2541272 join(676629..676908,677057..677127) 1 NC_003423.3 was previously annotated as dubious 29-09-04; Sm domain protein 677127 2541272 SPBC947.03c Schizosaccharomyces pombe 972h- Sm domain protein NP_595273.2 676629 D 284812 CDS SPBC947.02 19112066 2541255 complement(677583..679634) 1 NC_003423.3 AP-1 adaptor complex subunit Apl2 (predicted) 679634 apl2 2541255 apl2 Schizosaccharomyces pombe 972h- AP-1 adaptor complex subunit Apl2 (predicted) NP_595274.1 677583 R 284812 CDS SPBC947.01 19112067 2541249 complement(join(680549..680766,680814..681222,681271..682626)) 1 NC_003423.3 AAA family ATPase, unknown biological role 682626 2541249 SPBC947.01 Schizosaccharomyces pombe 972h- AAA family ATPase, unknown biological role NP_595275.1 680549 R 284812 CDS SPBPJ4664.01 19112068 2541402 join(684143..685117,685199..685360) 1 NC_003423.3 decaprenyl diphosphate synthase subunit Dps1 685360 dps1 2541402 dps1 Schizosaccharomyces pombe 972h- decaprenyl diphosphate synthase subunit Dps1 NP_595276.1 684143 D 284812 CDS SPBPJ4664.02 19112069 2541363 687716..699631 1 NC_003423.3 ~250-270 copies of a 12 AA repeat, NSSTPITSSSIL; cell surface glycoprotein (predicted) 699631 2541363 SPBPJ4664.02 Schizosaccharomyces pombe 972h- cell surface glycoprotein (predicted) NP_595277.1 687716 D 284812 CDS SPBPJ4664.03 19112070 2541352 join(700364..700476,700544..700556) 1 NC_003423.3 M-factor precursor Mfm3 700556 mfm3 2541352 mfm3 Schizosaccharomyces pombe 972h- M-factor precursor Mfm3 NP_595278.1 700364 D 284812 CDS SPBPJ4664.04 19112071 2541412 701890..705513 1 NC_003423.3 coatomer alpha subunit (predicted) 705513 2541412 SPBPJ4664.04 Schizosaccharomyces pombe 972h- coatomer alpha subunit (predicted) NP_595279.1 701890 D 284812 CDS SPBPJ4664.05 295442815 2541381 join(705932..706077,706141..706666) 1 NC_003423.3 conserved fungal protein 706666 2541381 SPBPJ4664.05 Schizosaccharomyces pombe 972h- conserved fungal protein NP_595280.2 705932 D 284812 CDS SPBPJ4664.06 19112073 2541413 707588..711934 1 NC_003423.3 UDP-glucose-glycoprotein glucosyltransferase Gpt1 711934 gpt1 2541413 gpt1 Schizosaccharomyces pombe 972h- UDP-glucose-glycoprotein glucosyltransferase Gpt1 NP_595281.1 707588 D 284812 CDS SPBC119.01 63054710 2540109 join(712512..712530,712577..712672,712717..714095) 1 NC_003423.3 19S proteasome regulatory subunit Rpn3 714095 rpn3 2540109 rpn3 Schizosaccharomyces pombe 972h- 19S proteasome regulatory subunit Rpn3 NP_595282.2 712512 D 284812 CDS SPBC119.02 19112075 2540083 join(715333..715452,715532..715609,715981..716226) 1 NC_003423.3 ubiquitin conjugating enzyme Ubc4 716226 ubc4 2540083 ubc4 Schizosaccharomyces pombe 972h- ubiquitin conjugating enzyme Ubc4 NP_595283.1 715333 D 284812 CDS SPBC119.03 19112076 2540074 717966..718766 1 NC_003423.3 human COMT homolog 1 718766 2540074 SPBC119.03 Schizosaccharomyces pombe 972h- human COMT homolog 1 NP_595284.1 717966 D 284812 CDS SPBC119.04 19112077 2540070 719806..720252 1 NC_003423.3 meiosis inducing protein Mei3 720252 mei3 2540070 mei3 Schizosaccharomyces pombe 972h- meiosis inducing protein Mei3 NP_595285.1 719806 D 284812 CDS SPBC119.05c 19112078 2539945 complement(721453..722343) 1 NC_003423.3 Wiskott-Aldrich syndrome homolog binding protein Lsb1 (predicted) 722343 2539945 SPBC119.05c Schizosaccharomyces pombe 972h- Wiskott-Aldrich syndrome homolog binding protein Lsb1 (predicted) NP_595286.1 721453 R 284812 CDS SPBC119.06 19112079 2539826 723759..724550 1 NC_003423.3 copper chaperone Sco1 724550 sco1 2539826 sco1 Schizosaccharomyces pombe 972h- copper chaperone Sco1 NP_595287.1 723759 D 284812 CDS SPBC119.07 19112080 2539996 join(725343..725428,725481..725608,725683..726260,726318..730646) 1 NC_003423.3 serine/threonine protein kinase Ppk19 730646 ppk19 2539996 ppk19 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Ppk19 NP_595288.1 725343 D 284812 CDS SPBC119.08 19112081 2539920 join(730860..730925,731026..731205,731479..731550,731633..732583) 1 NC_003423.3 MAP kinase Pmk1 732583 pmk1 2539920 pmk1 Schizosaccharomyces pombe 972h- MAP kinase Pmk1 NP_595289.1 730860 D 284812 CDS SPBC119.09c 19112082 2540054 complement(733675..734235) 1 NC_003423.3 ORMDL family protein 734235 2540054 SPBC119.09c Schizosaccharomyces pombe 972h- ORMDL family protein NP_595290.1 733675 R 284812 CDS SPBC119.10 19112083 2539704 735416..737089 1 NC_003423.3 asparagine synthetase 737089 asn1 2539704 asn1 Schizosaccharomyces pombe 972h- asparagine synthetase NP_595291.1 735416 D 284812 CDS SPBC119.11c 19112084 2540084 complement(737704..738795) 1 NC_003423.3 double-strand-specific ribonuclease Pac1 738795 pac1 2540084 pac1 Schizosaccharomyces pombe 972h- double-strand-specific ribonuclease Pac1 NP_595292.1 737704 R 284812 CDS SPBC119.12 19112085 2540061 740275..741480 1 NC_003423.3 Golgi matrix protein (predicted) 741480 2540061 SPBC119.12 Schizosaccharomyces pombe 972h- Golgi matrix protein (predicted) NP_595293.1 740275 D 284812 CDS SPBC119.13c 19112086 2540045 complement(741963..743519) 1 NC_003423.3 U4/U6 x U5 tri-snRNP complex subunit Prp31 743519 prp31 2540045 prp31 Schizosaccharomyces pombe 972h- U4/U6 x U5 tri-snRNP complex subunit Prp31 NP_595294.1 741963 R 284812 CDS SPBC119.18 19112087 2540098 join(744069..744107,744170..744340) 1 NC_003423.3 mitochondrial distribution and morphology protein Mdm35 (predicted) 744340 2540098 SPBC119.18 Schizosaccharomyces pombe 972h- mitochondrial distribution and morphology protein Mdm35 (predicted) NP_595295.1 744069 D 284812 CDS SPBC119.14 19112088 2540121 join(746035..746265,746364..746447,746601..746780,746839..747091,747144..747222,747268..747556) 1 NC_003423.3 Rad22 homolog Rti1 747556 rti1 2540121 rti1 Schizosaccharomyces pombe 972h- Rad22 homolog Rti1 NP_595296.1 746035 D 284812 CDS SPBC119.15 19112089 2540123 join(747852..747909,747984..748137,748194..749085) 1 NC_003423.3 AAA family ATPase, unknown biological role 749085 2540123 SPBC119.15 Schizosaccharomyces pombe 972h- AAA family ATPase, unknown biological role NP_595297.1 747852 D 284812 CDS SPBC119.16c 19112090 2539955 complement(749245..750591) 1 NC_003423.3 conserved fungal protein 750591 2539955 SPBC119.16c Schizosaccharomyces pombe 972h- conserved fungal protein NP_595298.1 749245 R 284812 CDS SPBC119.17 63054711 2540111 join(750786..750905,750957..753815) 1 NC_003423.3 metallopeptidase 753815 2540111 SPBC119.17 Schizosaccharomyces pombe 972h- metallopeptidase NP_595299.2 750786 D 284812 CDS SPBC577.02 19112092 2540910 join(754652..754654,754784..754970,755150..755184) 1 NC_003423.3 60S ribosomal protein L38 755184 rpl3801 2540910 rpl3801 Schizosaccharomyces pombe 972h- 60S ribosomal protein L38 NP_595300.1 754652 D 284812 CDS SPBC577.03c 19112093 2540260 complement(join(755560..756023,756097..756283)) 1 NC_003423.3 GCN5-related N-acetyltransferase (predicted) 756283 2540260 SPBC577.03c Schizosaccharomyces pombe 972h- GCN5-related N-acetyltransferase (predicted) NP_595301.1 755560 R 284812 CDS SPBC577.04 19112094 2541056 join(756660..756973,757057..757345) 1 NC_003423.3 human THOC5 homolog 757345 2541056 SPBC577.04 Schizosaccharomyces pombe 972h- human THOC5 homolog NP_595302.1 756660 D 284812 CDS SPBC577.05c 19112095 2541083 complement(join(757566..757746,757796..757951,758130..758197)) 1 NC_003423.3 meiotic recombination protein Rec27 758197 rec27 2541083 rec27 Schizosaccharomyces pombe 972h- meiotic recombination protein Rec27 NP_595303.1 757566 R 284812 CDS SPBC577.06c 19112096 2540883 complement(join(758408..758421,758475..759495,759535..760340,760382..764166,764222..764229)) 1 NC_003423.3 phosphatidylinositol kinase (predicted) 764229 2540883 SPBC577.06c Schizosaccharomyces pombe 972h- phosphatidylinositol kinase (predicted) NP_595304.1 758408 R 284812 CDS SPBC577.07 19112097 2540864 join(764596..764784,764833..765169,765271..766253) 1 NC_003423.3 ubiquitin C-terminal hydrolase Ubp10 766253 ubp10 2540864 ubp10 Schizosaccharomyces pombe 972h- ubiquitin C-terminal hydrolase Ubp10 NP_595305.1 764596 D 284812 CDS SPBC577.08c 19112098 2541028 complement(join(766554..767202,767255..767478)) 1 NC_003423.3 thioredoxin-like I protein Txl1 767478 txl1 2541028 txl1 Schizosaccharomyces pombe 972h- thioredoxin-like I protein Txl1 NP_595306.1 766554 R 284812 CDS SPBC577.09 19112099 2540861 join(767782..767818,767869..768016,768080..768187,768268..768385,768434..768512,768557..769281) 1 NC_003423.3 ERCC-8 DNA repair homolog (predicted) 769281 2540861 SPBC577.09 Schizosaccharomyces pombe 972h- ERCC-8 DNA repair homolog (predicted) NP_595307.1 767782 D 284812 CDS SPBC577.10 19112100 2540875 769682..770470 1 NC_003423.3 20S proteasome component beta 7 770470 2540875 SPBC577.10 Schizosaccharomyces pombe 972h- 20S proteasome component beta 7 NP_595308.1 769682 D 284812 CDS SPBC577.11 19112101 2541082 join(771318..771575,771756..771855,771986..772347) 1 NC_003423.3 sequence orphan 772347 2541082 SPBC577.11 Schizosaccharomyces pombe 972h- sequence orphan NP_595309.1 771318 D 284812 CDS SPBC577.12 19112102 2540717 join(773480..774485,774581..775395) 1 NC_003423.3 endoribonuclease (predicted) 775395 mug71 2540717 mug71 Schizosaccharomyces pombe 972h- endoribonuclease (predicted) NP_595310.1 773480 D 284812 CDS SPBC577.13 19112103 2541098 join(775773..778006,778052..778270,778316..778367,778418..778582) 1 NC_003423.3 inositol-polyphosphate 5-phosphatase (synaptojanin homolog 2) 778582 syj2 2541098 syj2 Schizosaccharomyces pombe 972h- inositol-polyphosphate 5-phosphatase (synaptojanin homolog 2) NP_595311.1 775773 D 284812 CDS SPBC577.14c 19112104 2540881 complement(join(779188..779667,779669..779869)) 1 NC_003423.3 ornithine decarboxylase antizyme Spa1 779869 spa1 2540881 spa1 Schizosaccharomyces pombe 972h- ornithine decarboxylase antizyme Spa1 NP_595312.1 779188 R 284812 CDS SPBC577.15c 19112105 2540895 complement(781072..782262) 1 NC_003423.3 NASP family CENP-A chaperone 782262 sim3 2540895 sim3 Schizosaccharomyces pombe 972h- NASP family CENP-A chaperone NP_595313.1 781072 R 284812 CDS SPBC530.01 19112106 2540892 785113..786657 1 NC_003423.3 GTPase activating protein Gyp1 (predicted) 786657 gyp1 2540892 gyp1 Schizosaccharomyces pombe 972h- GTPase activating protein Gyp1 (predicted) NP_595314.1 785113 D 284812 CDS SPBC530.02 19112107 2540897 787678..789303 1 NC_003423.3 membrane transporter 789303 2540897 SPBC530.02 Schizosaccharomyces pombe 972h- membrane transporter NP_595315.1 787678 D 284812 CDS SPBC530.03c 19112108 2540564 complement(791259..791879) 1 NC_003423.3 budding yeast presumed ortholog YIL016W does not have N-terminal ubiquitin domain; BAG family molecular chaperone regulator Bag102 791879 bag102 2540564 bag102 Schizosaccharomyces pombe 972h- BAG family molecular chaperone regulator Bag102 NP_595316.1 791259 R 284812 CDS SPBC530.04 19112109 2540894 join(793261..793320,793549..795057) 1 NC_003423.3 Tea1 anchoring protein Mod5 795057 mod5 2540894 mod5 Schizosaccharomyces pombe 972h- Tea1 anchoring protein Mod5 NP_595317.1 793261 D 284812 CDS SPBC530.05 19112110 2540903 796640..798871 1 NC_003423.3 transcription factor (predicted) 798871 2540903 SPBC530.05 Schizosaccharomyces pombe 972h- transcription factor (predicted) NP_595318.1 796640 D 284812 CDS SPBC530.06c 63054712 2540905 complement(join(799142..800838,800840..802651,802839..802851)) 1 NC_003423.3 frameshift but didnt want to flag as pseudo yet, needs checking again; translation initiation factor eIF3 alpha subunit (p135) (predicted) 802851 2540905 SPBC530.06c Schizosaccharomyces pombe 972h- translation initiation factor eIF3 alpha subunit (p135) (predicted) NP_595319.2 799142 R 284812 CDS SPBC530.07c 19112112 2540889 complement(804365..805093) 1 NC_003423.3 phosphomethylpyrimidine kinase (predicted) 805093 2540889 SPBC530.07c Schizosaccharomyces pombe 972h- phosphomethylpyrimidine kinase (predicted) NP_595320.1 804365 R 284812 CDS SPBC530.08 19112113 2540259 806834..809281 1 NC_003423.3 membrane-tethered transcription factor (predicted) 809281 2540259 SPBC530.08 Schizosaccharomyces pombe 972h- membrane-tethered transcription factor (predicted) NP_595321.1 806834 D 284812 CDS SPBC530.09c 19112114 2541064 complement(join(809525..809650,809735..810499)) 1 NC_003423.3 cation dependent mannose-6-phosphate cargo receptor (predicted) 810499 2541064 SPBC530.09c Schizosaccharomyces pombe 972h- cation dependent mannose-6-phosphate cargo receptor (predicted) NP_595322.1 809525 R 284812 CDS SPBC530.10c 19112115 2540900 complement(811413..812381) 1 NC_003423.3 mitochondrial adenine nucleotide carrier Anc1 812381 anc1 2540900 anc1 Schizosaccharomyces pombe 972h- mitochondrial adenine nucleotide carrier Anc1 NP_595323.1 811413 R 284812 CDS SPBC530.11c 19112116 2541068 complement(join(814819..817143,817199..817279,817416..817469)) 1 NC_003423.3 transcription factor (predicted) 817469 2541068 SPBC530.11c Schizosaccharomyces pombe 972h- transcription factor (predicted) NP_595324.1 814819 R 284812 CDS SPBC530.12c 19112117 2540904 complement(821281..823092) 1 NC_003423.3 palmitoyl-protein thioesterase (N-term)/phoshphatidic acid phosphatase PAP2 (C-term); palmitoyl protein thioesterase-dolichol pyrophosphate phosphatase fusion 1 823092 pdf1 2540904 pdf1 Schizosaccharomyces pombe 972h- palmitoyl protein thioesterase-dolichol pyrophosphate phosphatase fusion 1 NP_595325.1 821281 R 284812 CDS SPBC530.13 19112118 2540879 join(824374..824534,824579..824660,824874..824999,825083..825188,825245..825747) 1 NC_003423.3 cyclin Ctk2 825747 2540879 SPBC530.13 Schizosaccharomyces pombe 972h- cyclin Ctk2 NP_595326.1 824374 D 284812 CDS SPBC530.14c 19112119 2539847 complement(826179..827813) 1 NC_003423.3 SR protein-specific kinase Dsk1 827813 dsk1 2539847 dsk1 Schizosaccharomyces pombe 972h- SR protein-specific kinase Dsk1 NP_595327.1 826179 R 284812 CDS SPBC530.15c 162312160 2540262 complement(829091..830641) 1 NC_003423.3 spermidine family transporter (predicted) 830641 2540262 SPBC530.15c Schizosaccharomyces pombe 972h- spermidine family transporter (predicted) NP_595328.2 829091 R 284812 CDS SPBC36.01c 19112121 2540934 complement(833162..834904) 1 NC_003423.3 spermidine family transporter (predicted) 834904 2540934 SPBC36.01c Schizosaccharomyces pombe 972h- spermidine family transporter (predicted) NP_595329.1 833162 R 284812 CDS SPBC36.02c 19112122 2540286 complement(837552..839285) 1 NC_003423.3 spermidine family transporter (predicted) 839285 2540286 SPBC36.02c Schizosaccharomyces pombe 972h- spermidine family transporter (predicted) NP_595330.1 837552 R 284812 CDS SPBC36.03c 19112123 2540940 complement(843508..845124) 1 NC_003423.3 spermidine family transporter (predicted) 845124 2540940 SPBC36.03c Schizosaccharomyces pombe 972h- spermidine family transporter (predicted) NP_595331.1 843508 R 284812 CDS SPBC36.04 19112124 2540946 join(847985..848117,848263..849185) 1 NC_003423.3 cysteine synthase 849185 cys11 2540946 cys11 Schizosaccharomyces pombe 972h- cysteine synthase NP_595332.1 847985 D 284812 CDS SPBC36.05c 19112125 2540368 complement(join(849509..849588,849640..849698,849746..849854,849895..850035,850080..850188,850234..850326,850373..850607,850663..850708,850799..850842,850885..850915,850959..851076,851119..851169,851215..851276,851319..851358)) 1 NC_003423.3 cryptic loci regulator (PMID 9755190); histone deacetylase (class I) Clr6 851358 clr6 2540368 clr6 Schizosaccharomyces pombe 972h- histone deacetylase (class I) Clr6 NP_595333.1 849509 R 284812 CDS SPBC36.06c 19112126 2540933 complement(join(852025..852606,852647..852847,852916..853053,853103..853237)) 1 NC_003423.3 Fps1 appears to have YJL167W has retained the functions YPL069C, Spo9 (Fps1 paralog) appears to have farnesyltransferase like S. cerevisiae BTS1 YPL069C which does not have a direct ortholog in fission yeast; farnesyl pyrophosphate synthetase 853237 spo9 2540933 spo9 Schizosaccharomyces pombe 972h- farnesyl pyrophosphate synthetase NP_595334.1 852025 R 284812 CDS SPBC36.07 19112127 2541017 853631..857392 1 NC_003423.3 elongator subunit Iki3 (predicted) 857392 iki3 2541017 iki3 Schizosaccharomyces pombe 972h- elongator subunit Iki3 (predicted) NP_595335.1 853631 D 284812 CDS SPBC36.08c 19112128 2540377 complement(join(857531..857710,857762..857842,857905..858219)) 1 NC_003423.3 candidate S. cerevisiae COG2 ortholog?; Golgi transport complex subunit Cog2 (predicted) 858219 cog2 2540377 cog2 Schizosaccharomyces pombe 972h- Golgi transport complex subunit Cog2 (predicted) NP_595336.1 857531 R 284812 CDS SPBC36.09 19112129 2540932 join(858488..858687,858740..859884,859940..860073) 1 NC_003423.3 U2 snRNP-associated protein sap61 860073 sap61 2540932 sap61 Schizosaccharomyces pombe 972h- U2 snRNP-associated protein sap61 NP_595337.1 858488 D 284812 CDS SPBC36.10 19112130 2540922 861231..861785 1 NC_003423.3 mitochondrial intermembrane space protein sorting protein 861785 2540922 SPBC36.10 Schizosaccharomyces pombe 972h- mitochondrial intermembrane space protein sorting protein NP_595338.1 861231 D 284812 CDS SPBC36.11 19112131 2540371 863274..864305 1 NC_003423.3 sequence orphan 864305 2540371 SPBC36.11 Schizosaccharomyces pombe 972h- sequence orphan NP_595339.1 863274 D 284812 CDS SPBC36.12c 19112132 2540962 complement(join(864756..865244,865288..865681,865738..865994)) 1 NC_003423.3 glucose insensitive transcription; SGT1-like protein Git7 865994 git7 2540962 git7 Schizosaccharomyces pombe 972h- SGT1-like protein Git7 NP_595340.1 864756 R 284812 CDS SPBC713.02c 19112133 2541131 complement(join(866540..869835,869940..870030,870080..870082)) 1 NC_003423.3 ubiquitin C-terminal hydrolase Ubp21 870082 ubp21 2541131 ubp21 Schizosaccharomyces pombe 972h- ubiquitin C-terminal hydrolase Ubp21 NP_595341.1 866540 R 284812 CDS SPBC713.03 19112134 2541151 join(871546..873109,873157..873173) 1 NC_003423.3 mitochondrial D-lactate dehydrogenase, cytochrome (predicted) 873173 2541151 SPBC713.03 Schizosaccharomyces pombe 972h- mitochondrial D-lactate dehydrogenase, cytochrome (predicted) NP_595342.1 871546 D 284812 CDS SPBC713.04c 19112135 2541182 complement(873358..875922) 1 NC_003423.3 U3 snoRNP-associated protein Utp1 875922 2541182 SPBC713.04c Schizosaccharomyces pombe 972h- U3 snoRNP-associated protein Utp1 NP_595343.1 873358 R 284812 CDS SPBC713.05 19112136 2541181 join(876350..876695,876741..876777,876821..876978,877019..877371) 1 NC_003423.3 WD repeat protein, human MAPK organizer 1 (MORG1) family 877371 2541181 SPBC713.05 Schizosaccharomyces pombe 972h- WD repeat protein, human MAPK organizer 1 (MORG1) family NP_595344.1 876350 D 284812 CDS SPBC713.06 19112137 2541111 877504..879828 1 NC_003423.3 another DNA ligase; DNA ligase (predicted) 879828 adl1 2541111 adl1 Schizosaccharomyces pombe 972h- DNA ligase (predicted) NP_595345.1 877504 D 284812 CDS SPBC713.07c 19112138 2541140 complement(879919..881652) 1 NC_003423.3 vacuolar polyphosphatase (predicted) 881652 2541140 SPBC713.07c Schizosaccharomyces pombe 972h- vacuolar polyphosphatase (predicted) NP_595346.1 879919 R 284812 CDS SPBC713.08 19112139 2541118 882460..882675 1 NC_003423.3 mitochondrial TOM complex assembly protein Mim1 882675 mim1 2541118 mim1 Schizosaccharomyces pombe 972h- mitochondrial TOM complex assembly protein Mim1 NP_595347.1 882460 D 284812 CDS SPBC713.09 19112140 2540755 join(884959..885000,885042..886187) 1 NC_003423.3 sequence orphan 886187 2540755 SPBC713.09 Schizosaccharomyces pombe 972h- sequence orphan NP_595348.1 884959 D 284812 CDS SPBC713.10 19112141 2541152 join(886616..886664,886730..887067) 1 NC_003423.3 TIM23 translocase complex subunit Tim16 887067 tim16 2541152 tim16 Schizosaccharomyces pombe 972h- TIM23 translocase complex subunit Tim16 NP_595349.1 886616 D 284812 CDS SPBC713.11c 19112142 2541129 complement(887999..888151) 1 NC_003423.3 plasma membrane proteolipid Pmp3 888151 pmp3 2541129 pmp3 Schizosaccharomyces pombe 972h- plasma membrane proteolipid Pmp3 NP_595350.1 887999 R 284812 CDS SPBC713.12 19112143 2541106 892679..894052 1 NC_003423.3 squalene monooxygenase Erg1 (predicted) 894052 erg1 2541106 erg1 Schizosaccharomyces pombe 972h- squalene monooxygenase Erg1 (predicted) NP_595351.1 892679 D 284812 CDS SPBC216.01c 162312162 2540726 complement(join(894565..896363,896422..897133)) 1 NC_003423.3 DNA damage response protein (predicted) 897133 2540726 SPBC216.01c Schizosaccharomyces pombe 972h- DNA damage response protein (predicted) XP_001713123.1 894565 R 284812 CDS SPBC216.02 19112146 2540712 898075..900981 1 NC_003423.3 meiotically upregulated gene Mug21; cortical anchoring factor for dynein Mcp5/Num1 900981 mcp5 2540712 mcp5 Schizosaccharomyces pombe 972h- cortical anchoring factor for dynein Mcp5/Num1 NP_595354.1 898075 D 284812 CDS SPBC216.03 19112147 2540613 901942..902685 1 NC_003423.3 conserved fungal protein 902685 2540613 SPBC216.03 Schizosaccharomyces pombe 972h- conserved fungal protein NP_595355.1 901942 D 284812 CDS SPBC216.04c 19112148 2540772 complement(903156..903572) 1 NC_003423.3 methionine sulfoxide (predicted) 903572 2540772 SPBC216.04c Schizosaccharomyces pombe 972h- methionine sulfoxide (predicted) NP_595356.1 903156 R 284812 CDS SPBC216.05 19112149 2540719 904365..911525 1 NC_003423.3 ATR checkpoint kinase Rad3 911525 rad3 2540719 rad3 Schizosaccharomyces pombe 972h- ATR checkpoint kinase Rad3 NP_595357.1 904365 D 284812 CDS SPBC216.06c 19112150 2540728 complement(join(911603..913570,913646..914593)) 1 NC_003423.3 replication fork protection complex subunit Swi1 914593 swi1 2540728 swi1 Schizosaccharomyces pombe 972h- replication fork protection complex subunit Swi1 NP_595358.1 911603 R 284812 CDS SPBC216.07c 162312164 2540720 complement(915271..922284) 1 NC_003423.3 phosphatidylinositol kinase Tor2 922284 tor2 2540720 tor2 Schizosaccharomyces pombe 972h- phosphatidylinositol kinase Tor2 NP_595359.2 915271 R 284812 CDS SPBC646.02 19112152 2541124 922725..926579 1 NC_003423.3 complexed with Cdc5 protein Cwf11 926579 cwf11 2541124 cwf11 Schizosaccharomyces pombe 972h- complexed with Cdc5 protein Cwf11 NP_595360.1 922725 D 284812 CDS SPBC646.03 19112153 2541102 join(926850..927096,927143..927968,928016..928358) 1 NC_003423.3 mitochondrial glutamyl-tRNA amidotransferase alpha subunit (predicted) 928358 2541102 SPBC646.03 Schizosaccharomyces pombe 972h- mitochondrial glutamyl-tRNA amidotransferase alpha subunit (predicted) NP_595361.1 926850 D 284812 CDS SPBC646.04 19112154 2541099 join(928989..930444,930488..930605,930645..930738,930780..930812) 1 NC_003423.3 poly(A) polymerase Pla1 930812 pla1 2541099 pla1 Schizosaccharomyces pombe 972h- poly(A) polymerase Pla1 NP_595362.1 928989 D 284812 CDS SPBC646.05c 19112155 2541110 complement(931060..932442) 1 NC_003423.3 squalene synthase Erg9 932442 erg9 2541110 erg9 Schizosaccharomyces pombe 972h- squalene synthase Erg9 NP_595363.1 931060 R 284812 CDS SPBC646.06c 162312166 2541122 complement(932781..934082) 1 NC_003423.3 PMID:15194814 TAG stop codon changes to TAT which lengthened CDS from 407aa to 433aa; glucan endo-1,3-alpha-glucosidase Agn2 934082 agn2 2541122 agn2 Schizosaccharomyces pombe 972h- glucan endo-1,3-alpha-glucosidase Agn2 XP_001713124.1 932781 R 284812 CDS SPBC646.07c 19112157 2541070 complement(934716..935603) 1 NC_003423.3 enoyl reductase 935603 2541070 SPBC646.07c Schizosaccharomyces pombe 972h- enoyl reductase NP_595365.1 934716 R 284812 CDS SPBC646.08c 19112158 2541093 complement(936541..938091) 1 NC_003423.3 oxysterol binding protein (predicted) 938091 2541093 SPBC646.08c Schizosaccharomyces pombe 972h- oxysterol binding protein (predicted) NP_595366.1 936541 R 284812 CDS SPBC646.09c 19112159 2541089 complement(join(938700..940171,940228..940261)) 1 NC_003423.3 A truncated C-terminal version of Int6 overexpression activated Pap1 dependent transcription , but did not affect Pap1 protein abundance, and a concommitant Pap1 dependent induction of stress response genes particularly those implicated in multidrug resistance (PMID 16278451); eIF3e subunit homolog 940261 int6 2541089 int6 Schizosaccharomyces pombe 972h- eIF3e subunit homolog NP_595367.1 938700 R 284812 CDS SPBC646.10c 19112160 2541087 complement(940825..942318) 1 NC_003423.3 U3 snoRNP protein Nop56 (predicted) 942318 2541087 SPBC646.10c Schizosaccharomyces pombe 972h- U3 snoRNP protein Nop56 (predicted) NP_595368.1 940825 R 284812 CDS SPBC646.11 19112161 2541128 join(942942..942998,943044..943117,943156..943219,943361..944773) 1 NC_003423.3 chaperonin-containing T-complex zeta subunit Cct6 944773 cct6 2541128 cct6 Schizosaccharomyces pombe 972h- chaperonin-containing T-complex zeta subunit Cct6 NP_595369.1 942942 D 284812 CDS SPBC646.12c 19112162 2540440 complement(945102..947402) 1 NC_003423.3 suppressor of activated ras1; GTPase activating protein Gap1 947402 gap1 2540440 gap1 Schizosaccharomyces pombe 972h- GTPase activating protein Gap1 NP_595370.1 945102 R 284812 CDS SPBC646.13 19112163 2541117 950881..952107 1 NC_003423.3 Multicopy suppressor of Overexpressed Cyr1; inducer of sexual development Sds23/Moc1 952107 sds23 2541117 sds23 Schizosaccharomyces pombe 972h- inducer of sexual development Sds23/Moc1 NP_595371.1 950881 D 284812 CDS SPBC646.14c 19112164 2541107 complement(join(952816..953751,953792..953866,953920..954276)) 1 NC_003423.3 origin recognition complex subunit Orc5 954276 orc5 2541107 orc5 Schizosaccharomyces pombe 972h- origin recognition complex subunit Orc5 NP_595372.1 952816 R 284812 CDS SPBC646.15c 19112165 2541063 complement(join(955128..955210,955257..955369,955435..955992,956070..956301,956344..956488)) 1 NC_003423.3 Pex16 family peroxisome import protein 956488 2541063 SPBC646.15c Schizosaccharomyces pombe 972h- Pex16 family peroxisome import protein NP_595373.1 955128 R 284812 CDS SPBC646.16 19112166 2541139 957658..958392 1 NC_003423.3 20S proteasome component alpha 1 (predicted) 958392 2541139 SPBC646.16 Schizosaccharomyces pombe 972h- 20S proteasome component alpha 1 (predicted) NP_595374.1 957658 D 284812 CDS SPBC646.17c 162312168 5802757 complement(join(958669..959574,959614..960216,960264..960389)) 1 NC_003423.3 dynein intermediate chain Dic1 960389 dic1 5802757 dic1 Schizosaccharomyces pombe 972h- dynein intermediate chain Dic1 XP_001713125.1 958669 R 284812 CDS SPBP35G2.16c 295442818 9407128 complement(962261..962515) 1 NC_003423.3 extender of the chronological lifespan protein Ecl2 962515 ecl2 9407128 ecl2 Schizosaccharomyces pombe 972h- extender of the chronological lifespan protein Ecl2 XP_002788940.1 962261 R 284812 CDS SPBP35G2.02 19112169 2541314 966711..967334 1 NC_003423.3 DUF1000 family protein 967334 2541314 SPBP35G2.02 Schizosaccharomyces pombe 972h- DUF1000 family protein NP_595377.1 966711 D 284812 CDS SPBP35G2.03c 19112170 2541326 complement(join(967746..968604,968667..968767)) 1 NC_003423.3 ShuGOshin 1 (Japanese meaning guardian spirit); shugoshin Sgo1 968767 sgo1 2541326 sgo1 Schizosaccharomyces pombe 972h- shugoshin Sgo1 NP_595378.1 967746 R 284812 CDS SPBP35G2.04c 19112171 2541288 complement(join(969008..969265,969451..969871,969964..970034)) 1 NC_003423.3 sequence orphan 970034 2541288 SPBP35G2.04c Schizosaccharomyces pombe 972h- sequence orphan NP_595379.1 969008 R 284812 CDS SPBP35G2.05c 19112172 2541341 complement(join(970957..971919,971985..972133,972201..972270,972323..972448)) 1 NC_003423.3 serine/threonine protein kinase Cki2 972448 cki2 2541341 cki2 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Cki2 NP_595380.1 970957 R 284812 CDS SPBP35G2.06c 295442820 2541330 complement(join(973049..974181,974223..974577,974647..975002,975044..975137,975172..976632)) 1 NC_003423.3 nucleoporin Nup131 976632 nup131 2541330 nup131 Schizosaccharomyces pombe 972h- nucleoporin Nup131 NP_595381.2 973049 R 284812 CDS SPBP35G2.07 19112174 2541345 977109..979118 1 NC_003423.3 acetolactate synthase catalytic subunit 979118 ilv1 2541345 ilv1 Schizosaccharomyces pombe 972h- acetolactate synthase catalytic subunit NP_595382.1 977109 D 284812 CDS SPBP35G2.08c 19112175 2541349 complement(join(979529..980152,980208..980309,980359..980574)) 1 NC_003423.3 zinc knuckle TRAMP complex subunit Air1 980574 air1 2541349 air1 Schizosaccharomyces pombe 972h- zinc knuckle TRAMP complex subunit Air1 NP_595383.1 979529 R 284812 CDS SPBP35G2.09 19112176 2541289 join(981240..981249,981296..981511,981571..981893) 1 NC_003423.3 U1 snRNP-associated protein Usp103 (predicted) 981893 usp103 2541289 usp103 Schizosaccharomyces pombe 972h- U1 snRNP-associated protein Usp103 (predicted) NP_595384.1 981240 D 284812 CDS SPBP35G2.10 19112177 2541336 982068..986324 1 NC_003423.3 CHD like Fission yeast Protein; SHREC complex subunit Mit1 986324 mit1 2541336 mit1 Schizosaccharomyces pombe 972h- SHREC complex subunit Mit1 NP_595385.1 982068 D 284812 CDS SPBP35G2.11c 19112178 2541353 complement(986644..987837) 1 NC_003423.3 transcription related zf-ZZ type zinc finger protein 987837 2541353 SPBP35G2.11c Schizosaccharomyces pombe 972h- transcription related zf-ZZ type zinc finger protein NP_595386.1 986644 R 284812 CDS SPBP35G2.12 19112179 2541356 989558..990175 1 NC_003423.3 ADP-ribose diphosphatase (predicted) 990175 2541356 SPBP35G2.12 Schizosaccharomyces pombe 972h- ADP-ribose diphosphatase (predicted) NP_595387.1 989558 D 284812 CDS SPBP35G2.13c 19112180 2541337 complement(990417..991367) 1 NC_003423.3 NAS from PMID:16299513; Swr1 complex complex subunit Swc2 991367 swc2 2541337 swc2 Schizosaccharomyces pombe 972h- Swr1 complex complex subunit Swc2 NP_595388.1 990417 R 284812 CDS SPBP35G2.14 19112181 2541323 992887..996069 1 NC_003423.3 RNA-binding protein 996069 2541323 SPBP35G2.14 Schizosaccharomyces pombe 972h- RNA-binding protein NP_595389.1 992887 D 284812 CDS SPBC146.01 63054716 2539712 join(996843..997019,997066..1000080) 1 NC_003423.3 mediator complex subunit Med15 (predicted) 1000080 med15 2539712 med15 Schizosaccharomyces pombe 972h- mediator complex subunit Med15 (predicted) NP_595390.2 996843 D 284812 CDS SPBC146.02 19112183 2539896 1001011..1001802 1 NC_003423.3 sequence orphan 1001802 2539896 SPBC146.02 Schizosaccharomyces pombe 972h- sequence orphan NP_595391.1 1001011 D 284812 CDS SPBC146.03c 19112184 2539817 complement(1002489..1006463) 1 NC_003423.3 condensin subunit Cut3 1006463 cut3 2539817 cut3 Schizosaccharomyces pombe 972h- condensin subunit Cut3 NP_595392.1 1002489 R 284812 CDS SPBC146.04 19112185 2539721 1008018..1008596 1 NC_003423.3 sulfhydryl oxidase (predicted) 1008596 2539721 SPBC146.04 Schizosaccharomyces pombe 972h- sulfhydryl oxidase (predicted) NP_595393.1 1008018 D 284812 CDS SPBC146.05c 19112186 2539683 complement(join(1008799..1009894,1009957..1009991)) 1 NC_003423.3 complexed with Cdc5 protein Cwf25 1009991 cwf25 2539683 cwf25 Schizosaccharomyces pombe 972h- complexed with Cdc5 protein Cwf25 NP_595394.1 1008799 R 284812 CDS SPBC146.06c 19112187 2539688 complement(1010601..1012712) 1 NC_003423.3 VRR-NUC nuclease associated domain, human MTMR15 homolog 1012712 2539688 SPBC146.06c Schizosaccharomyces pombe 972h- VRR-NUC nuclease associated domain, human MTMR15 homolog NP_595395.1 1010601 R 284812 CDS SPBC146.07 19112188 2539645 1013555..1015108 1 NC_003423.3 U2AF large subunit (U2AF-59) 1015108 prp2 2539645 prp2 Schizosaccharomyces pombe 972h- U2AF large subunit (U2AF-59) NP_595396.1 1013555 D 284812 CDS SPBC146.08c 19112189 2539677 complement(join(1015332..1015416,1015469..1015767)) 1 NC_003423.3 translation initiation factor eIF1A-like 1015767 2539677 SPBC146.08c Schizosaccharomyces pombe 972h- translation initiation factor eIF1A-like NP_595397.1 1015332 R 284812 CDS SPBC146.09c 19112190 2539805 complement(1016000..1019002) 1 NC_003423.3 S. pombe SPAC23E2.02 has HMG box; histone demethylase SWIRM1 1019002 lsd1 2539805 lsd1 Schizosaccharomyces pombe 972h- histone demethylase SWIRM1 NP_595398.1 1016000 R 284812 CDS SPBC146.10 63054717 2540094 1019753..1020322 1 NC_003423.3 overlaps CDS SPBC146.11c at the 5' end by 7 aa; meiotically upregulated gene Mug57 1020322 mug57 2540094 mug57 Schizosaccharomyces pombe 972h- meiotically upregulated gene Mug57 NP_595399.2 1019753 D 284812 CDS SPBC146.11c 19112192 2540153 complement(1020296..1021303) 1 NC_003423.3 overlaps CDS SPBC146.10 at the 5' end by 7 aa; meiotically upregulated gene Mug97 1021303 mug97 2540153 mug97 Schizosaccharomyces pombe 972h- meiotically upregulated gene Mug97 NP_595400.1 1020296 R 284812 CDS SPBC146.12 19112193 2539672 1022455..1023855 1 NC_003423.3 monooxygenase Coq6 1023855 coq6 2539672 coq6 Schizosaccharomyces pombe 972h- monooxygenase Coq6 NP_595401.1 1022455 D 284812 CDS SPBC146.13c 19112194 2539659 complement(join(1024233..1027883,1027928..1027930)) 1 NC_003423.3 myosin type I 1027930 myo1 2539659 myo1 Schizosaccharomyces pombe 972h- myosin type I NP_595402.1 1024233 R 284812 CDS SPBC146.14c 19112195 2539798 complement(1029116..1031938) 1 NC_003423.3 coatomer beta subunit (predicted) 1031938 sec26 2539798 sec26 Schizosaccharomyces pombe 972h- coatomer beta subunit (predicted) NP_595403.1 1029116 R 284812 CDS SPBC337.03 19112196 2540220 join(1035538..1035685,1035734..1035834,1035903..1036097,1036145..1036864) 1 NC_003423.3 DUF618 family protein, involved in transcription (predicted) 1036864 2540220 SPBC337.03 Schizosaccharomyces pombe 972h- DUF618 family protein, involved in transcription (predicted) NP_595404.1 1035538 D 284812 CDS SPBC337.04 19112197 2540313 join(1037077..1037782,1037850..1038385) 1 NC_003423.3 serine/threonine protein kinase Ppk27 (predicted) 1038385 ppk27 2540313 ppk27 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Ppk27 (predicted) NP_595405.1 1037077 D 284812 CDS SPBC337.05c 19112198 2540305 complement(join(1038547..1039902,1040189..1040310,1040363..1040402,1040456..1040578)) 1 NC_003423.3 chaperonin-containing T-complex theta subunit Cct8 1040578 cct8 2540305 cct8 Schizosaccharomyces pombe 972h- chaperonin-containing T-complex theta subunit Cct8 NP_595406.1 1038547 R 284812 CDS SPBC337.06c 19112199 2540983 complement(join(1041117..1041899,1041959..1041973)) 1 NC_003423.3 complexed with Cdc5 protein Cwf15 1041973 cwf15 2540983 cwf15 Schizosaccharomyces pombe 972h- complexed with Cdc5 protein Cwf15 NP_595407.1 1041117 R 284812 CDS SPBC337.07c 19112200 2541067 complement(join(1042295..1042393,1042434..1042681,1042723..1042851,1042901..1043006,1043048..1043959)) 1 NC_003423.3 carboxypeptidase (predicted) 1043959 2541067 SPBC337.07c Schizosaccharomyces pombe 972h- carboxypeptidase (predicted) NP_595408.1 1042295 R 284812 CDS SPBC337.08c 19112201 2541030 complement(1044418..1045566) 1 NC_003423.3 ubiquitin 1045566 ubi4 2541030 ubi4 Schizosaccharomyces pombe 972h- ubiquitin NP_595409.1 1044418 R 284812 CDS SPBC337.09 19112202 2541026 join(1047535..1047676,1047788..1047878,1047943..1048120) 1 NC_003423.3 Erg28 protein 1048120 erg28 2541026 erg28 Schizosaccharomyces pombe 972h- Erg28 protein NP_595410.1 1047535 D 284812 CDS SPBC337.10c 19112203 2540921 complement(1048564..1049430) 1 NC_003423.3 anamorsin family protein 1049430 2540921 SPBC337.10c Schizosaccharomyces pombe 972h- anamorsin family protein NP_595411.1 1048564 R 284812 CDS SPBC337.11 19112204 2540994 1050315..1051292 1 NC_003423.3 mitochondrial peptidase (predicted) 1051292 2540994 SPBC337.11 Schizosaccharomyces pombe 972h- mitochondrial peptidase (predicted) NP_595412.1 1050315 D 284812 CDS SPBC337.12 19112205 2540291 join(1052080..1052122,1052339..1052368,1052411..1053471) 1 NC_003423.3 human ZC3H3 homolog 1053471 2540291 SPBC337.12 Schizosaccharomyces pombe 972h- human ZC3H3 homolog NP_595413.1 1052080 D 284812 CDS SPBC337.13c 19112206 2540954 complement(1053778..1054704) 1 NC_003423.3 Gtr1/RagA G protein Gtr1 1054704 gtr1 2540954 gtr1 Schizosaccharomyces pombe 972h- Gtr1/RagA G protein Gtr1 NP_595414.1 1053778 R 284812 CDS SPBC337.14 19112207 2541011 join(1055662..1055713,1055752..1055857,1055903..1055980,1056055..1056226) 1 NC_003423.3 DNA-directed RNA polymerase II complex subunit Rpb4 1056226 rpb4 2541011 rpb4 Schizosaccharomyces pombe 972h- DNA-directed RNA polymerase II complex subunit Rpb4 NP_595415.1 1055662 D 284812 CDS SPBC337.15c 19112208 2541024 complement(1056625..1057275) 1 NC_003423.3 ubiquinone biosynthesis protein Coq7 1057275 coq7 2541024 coq7 Schizosaccharomyces pombe 972h- ubiquinone biosynthesis protein Coq7 NP_595416.1 1056625 R 284812 CDS SPBC337.16 19112209 2540995 join(1058347..1058951,1059007..1059067) 1 NC_003423.3 phosphatidyl-N-methylethanolamine N-methyltransferase (predicted) 1059067 cho1 2540995 cho1 Schizosaccharomyces pombe 972h- phosphatidyl-N-methylethanolamine N-methyltransferase (predicted) NP_595417.1 1058347 D 284812 CDS SPBC1734.01c 19112210 2540076 complement(1059522..1061570) 1 NC_003423.3 pre-rRNA processing protein Esf1 (predicted) 1061570 esf1 2540076 esf1 Schizosaccharomyces pombe 972h- pre-rRNA processing protein Esf1 (predicted) NP_595418.1 1059522 R 284812 CDS SPBC1734.02c 19112211 2539627 complement(join(1061970..1062635,1062710..1062817,1062874..1062941,1062996..1063162,1063219..1063274,1063324..1063377)) 1 NC_003423.3 DNA polymerase delta subunit Cdc27 1063377 cdc27 2539627 cdc27 Schizosaccharomyces pombe 972h- DNA polymerase delta subunit Cdc27 NP_595419.1 1061970 R 284812 CDS SPBC1734.03 19112212 2539851 1064341..1066401 1 NC_003423.3 dihydropteroatesynthase/2-amino-4-hydroxy-6- hydro xymethyldihydropteridinediphosphokinase/dihydroneopterin aldolase 1066401 2539851 SPBC1734.03 Schizosaccharomyces pombe 972h- dihydropteroatesynthase/2-amino-4-hydroxy-6- hydro xymethyldihydropteridinediphosphokinase/dihydroneopterin aldolase NP_595420.1 1064341 D 284812 CDS SPBC1734.04 162312170 2539685 1067092..1068384 1 NC_003423.3 mannosyltransferase complex subunit, Anp family (predicted) 1068384 2539685 SPBC1734.04 Schizosaccharomyces pombe 972h- mannosyltransferase complex subunit, Anp family (predicted) NP_595421.2 1067092 D 284812 CDS SPBC1734.05c 19112214 2539772 complement(join(1069110..1069688,1069892..1069942)) 1 NC_003423.3 DNAJ protein Spf31 1069942 spf31 2539772 spf31 Schizosaccharomyces pombe 972h- DNAJ protein Spf31 NP_595422.1 1069110 R 284812 CDS SPBC1734.06 19112215 2539686 1070258..1071421 1 NC_003423.3 Rad18 homolog Rhp18 1071421 rhp18 2539686 rhp18 Schizosaccharomyces pombe 972h- Rad18 homolog Rhp18 NP_595423.1 1070258 D 284812 CDS SPBC1734.07c 19112216 2539876 complement(1071571..1073427) 1 NC_003423.3 TRAPP complex subunit Trs85 (predicted) 1073427 2539876 SPBC1734.07c Schizosaccharomyces pombe 972h- TRAPP complex subunit Trs85 (predicted) NP_595424.1 1071571 R 284812 CDS SPBC1734.08 19112217 2540055 join(1074399..1074526,1074571..1074646,1074820..1075039,1075098..1075795) 1 NC_003423.3 STAM like protein Hse1 1075795 hse1 2540055 hse1 Schizosaccharomyces pombe 972h- STAM like protein Hse1 NP_595425.1 1074399 D 284812 CDS SPBC1734.09 19112218 2539611 1076347..1077297 1 NC_003423.3 NST UDP-N-acetylglucosamine transporter 1077297 2539611 SPBC1734.09 Schizosaccharomyces pombe 972h- NST UDP-N-acetylglucosamine transporter NP_595426.1 1076347 D 284812 CDS SPBC1734.10c 19112219 2539886 complement(join(1077439..1077966,1078448..1078918)) 1 NC_003423.3 mRNA processing protein (predicted) 1078918 2539886 SPBC1734.10c Schizosaccharomyces pombe 972h- mRNA processing protein (predicted) NP_595427.1 1077439 R 284812 CDS SPBC1734.11 19112220 2539671 1081719..1082942 1 NC_003423.3 predicted to be cytoplasmic, but act on mitochondrial proteins - check?; DNAJ domain protein Mas5 (predicted) 1082942 2539671 SPBC1734.11 Schizosaccharomyces pombe 972h- DNAJ domain protein Mas5 (predicted) NP_595428.1 1081719 D 284812 CDS SPBC1734.12c 63054719 2540068 complement(join(1083585..1084081,1084127..1085111,1085160..1085318)) 1 NC_003423.3 alpha-1,6-mannosyltransferase for the addition of the mannose to dolichol-linked Man7GlcNAc2, Alg12 (predicted) 1085318 alg12 2540068 alg12 Schizosaccharomyces pombe 972h- alpha-1,6-mannosyltransferase for the addition of the mannose to dolichol-linked Man7GlcNAc2, Alg12 (predicted) NP_595429.2 1083585 R 284812 CDS SPBC1734.13 19112222 2539839 join(1085936..1086015,1086095..1086920) 1 NC_003423.3 F1-ATPase gamma subunit (predicted) 1086920 atp3 2539839 atp3 Schizosaccharomyces pombe 972h- F1-ATPase gamma subunit (predicted) NP_595430.1 1085936 D 284812 CDS SPBC1734.14c 19112223 2540027 complement(join(1088271..1088378,1088430..1088574,1088690..1088778)) 1 NC_003423.3 cyclin-dependent protein kinase regulatory subunit Suc1 1088778 suc1 2540027 suc1 Schizosaccharomyces pombe 972h- cyclin-dependent protein kinase regulatory subunit Suc1 NP_595431.1 1088271 R 284812 CDS SPBC1734.15 19112224 2539999 join(1089188..1089190,1089239..1089321,1089382..1090924) 1 NC_003423.3 RSC complex subunit Rsc4 1090924 rsc4 2539999 rsc4 Schizosaccharomyces pombe 972h- RSC complex subunit Rsc4 NP_595432.1 1089188 D 284812 CDS SPBC1734.16c 19112225 2539793 complement(join(1091098..1094516,1094608..1094653)) 1 NC_003423.3 SIN3 family co-repressor Pst3 1094653 pst3 2539793 pst3 Schizosaccharomyces pombe 972h- SIN3 family co-repressor Pst3 NP_595433.1 1091098 R 284812 CDS SPBC1709.01 19112226 2540176 join(1095358..1097357,1097405..1098185) 1 NC_003423.3 chitin synthase homolog Chs2 1098185 chs2 2540176 chs2 Schizosaccharomyces pombe 972h- chitin synthase homolog Chs2 NP_595434.1 1095358 D 284812 CDS SPBC1709.02c 19112227 2540197 complement(join(1098300..1101080,1101212..1101285,1101345..1101396,1101437..1101472)) 1 NC_003423.3 assigned cytoplasmic location due to lack of presequence similar to that found on S. cerevisiae YGR094W, used to direct protein to the mitochondria; cytoplasmic valine-tRNA ligase Vrs2 (predicted) 1101472 vrs1 2540197 vrs1 Schizosaccharomyces pombe 972h- cytoplasmic valine-tRNA ligase Vrs2 (predicted) NP_595435.1 1098300 R 284812 CDS SPBC1709.03 19112228 2540196 join(1102449..1103075,1103114..1103683) 1 NC_003423.3 conserved fungal protein 1103683 2540196 SPBC1709.03 Schizosaccharomyces pombe 972h- conserved fungal protein NP_595436.1 1102449 D 284812 CDS SPBC1709.04c 19112229 2540198 complement(join(1103770..1104063,1104141..1104208,1104260..1104306,1104359..1104376,1104461..1104525,1104578..1104607)) 1 NC_003423.3 cyclophilin family peptidyl-prolyl cis-trans isomerase Cyp3 1104607 cyp3 2540198 cyp3 Schizosaccharomyces pombe 972h- cyclophilin family peptidyl-prolyl cis-trans isomerase Cyp3 NP_595437.1 1103770 R 284812 CDS SPBC1709.05 19112230 2540199 1106456..1108297 1 NC_003423.3 ask2 is the name which was given to the spurious orf on the opposite strand; heat shock protein Sks2 1108297 sks2 2540199 sks2 Schizosaccharomyces pombe 972h- heat shock protein Sks2 NP_595438.1 1106456 D 284812 CDS SPBC1709.06 19112231 2540200 join(1108728..1108896,1109135..1109784,1109826..1110446) 1 NC_003423.3 tRNA dihydrouridine synthase Dus2 (predicted) 1110446 dus2 2540200 dus2 Schizosaccharomyces pombe 972h- tRNA dihydrouridine synthase Dus2 (predicted) NP_595439.1 1108728 D 284812 CDS SPBC1709.07 19112232 2540195 join(1110890..1110930,1110978..1111416,1111465..1112001) 1 NC_003423.3 3-keto sterol reductase (predicted) 1112001 erg27 2540195 erg27 Schizosaccharomyces pombe 972h- 3-keto sterol reductase (predicted) NP_595440.1 1110890 D 284812 CDS SPBC1709.20 68011073 3361273 join(1112735..1112787,1112829..1112987,1113045..1113159) 1 NC_003423.3 RNase P and RNase MRP subunit Pop8 (predicted) 1113159 pop8 3361273 pop8 Schizosaccharomyces pombe 972h- RNase P and RNase MRP subunit Pop8 (predicted) NP_001018786.1 1112735 D 284812 CDS SPBC1709.08 19112233 2539694 1113339..1117664 1 NC_003423.3 cleavage factor one Cft1 (predicted) 1117664 cft1 2539694 cft1 Schizosaccharomyces pombe 972h- cleavage factor one Cft1 (predicted) NP_595441.1 1113339 D 284812 CDS SPBC1709.09 19112234 2540194 1118561..1119295 1 NC_003423.3 mitochondrial translation termination factor 1119295 2540194 SPBC1709.09 Schizosaccharomyces pombe 972h- mitochondrial translation termination factor NP_595442.1 1118561 D 284812 CDS SPBC1709.10c 19112235 2540012 complement(join(1119852..1119982,1120106..1120181)) 1 NC_003423.3 copper chaperone Atx1 1120181 atx1 2540012 atx1 Schizosaccharomyces pombe 972h- copper chaperone Atx1 NP_595443.1 1119852 R 284812 CDS SPBC1709.11c 19112236 2539953 complement(join(1120945..1121738,1121786..1121857,1121898..1121949)) 1 NC_003423.3 ING family homolog Png2 1121949 png2 2539953 png2 Schizosaccharomyces pombe 972h- ING family homolog Png2 NP_595444.1 1120945 R 284812 CDS SPBC1709.12 19112237 2539894 join(1122828..1123246,1123385..1123532,1123601..1124137) 1 NC_003423.3 GO tracable author statements (TAS) (pers. comm. Yasmine Mamnun and Takashi Toda); RIng-localized protein with homology to Diaphanous GTPase-binding domain; GTPase binding protein Rid1 1124137 rid1 2539894 rid1 Schizosaccharomyces pombe 972h- GTPase binding protein Rid1 NP_595445.1 1122828 D 284812 CDS SPBC1709.13c 19112238 2539820 complement(1124444..1126087) 1 NC_003423.3 lysine methyltransferase (predicted) 1126087 2539820 SPBC1709.13c Schizosaccharomyces pombe 972h- lysine methyltransferase (predicted) NP_595446.1 1124444 R 284812 CDS SPBC1709.14 19112239 2539952 join(1126628..1126954,1127030..1127206,1127253..1127412,1127458..1127496,1127542..1127840) 1 NC_003423.3 peptide N-glycanase (predicted) 1127840 2539952 SPBC1709.14 Schizosaccharomyces pombe 972h- peptide N-glycanase (predicted) NP_595447.1 1126628 D 284812 CDS SPBC1709.15c 19112240 2539954 complement(join(1127969..1129989,1130053..1130425)) 1 NC_003423.3 NAS from PMID: 17128255, needs replacing with ISS when annotated at SGD; cleavage factor two Cft2/polyadenylation factor CPSF-73 (predicted) 1130425 cft2 2539954 cft2 Schizosaccharomyces pombe 972h- cleavage factor two Cft2/polyadenylation factor CPSF-73 (predicted) NP_595448.1 1127969 R 284812 CDS SPBC1709.16c 19112241 2540104 complement(join(1130896..1131078,1131152..1131460,1131516..1131823,1131979..1132036)) 1 NC_003423.3 aromatic ring-opening dioxygenase (predicted) 1132036 2540104 SPBC1709.16c Schizosaccharomyces pombe 972h- aromatic ring-opening dioxygenase (predicted) NP_595449.1 1130896 R 284812 CDS SPBC1709.17 19112242 2540103 join(1132170..1132253,1132300..1132431,1132741..1134042) 1 NC_003423.3 folylpolyglutamate synthase 1134042 2540103 SPBC1709.17 Schizosaccharomyces pombe 972h- folylpolyglutamate synthase NP_595450.1 1132170 D 284812 CDS SPBC1709.18 19112243 2539870 join(1134499..1134975,1135066..1135205,1135263..1135377) 1 NC_003423.3 translation initiation factor eIF4E 4F complex subunit 1135377 tif452 2539870 tif452 Schizosaccharomyces pombe 972h- translation initiation factor eIF4E 4F complex subunit NP_595451.1 1134499 D 284812 CDS SPBC1709.19c 162312172 2539883 complement(1136807..1137589) 1 NC_003423.3 NifU-like protein 1137589 2539883 SPBC1709.19c Schizosaccharomyces pombe 972h- NifU-like protein NP_595452.2 1136807 R 284812 CDS SPBC409.03 19112245 2540574 join(1138056..1138064,1138117..1138202,1138368..1138530) 1 NC_003423.3 the gene predicted of YHR079C-A was extended to detect this similarity; Swi5 protein 1138530 swi5 2540574 swi5 Schizosaccharomyces pombe 972h- Swi5 protein NP_595453.1 1138056 D 284812 CDS SPBC409.04c 19112246 2540494 complement(1138748..1139527) 1 NC_003423.3 kinetochore protein Mis12 1139527 mis12 2540494 mis12 Schizosaccharomyces pombe 972h- kinetochore protein Mis12 NP_595454.1 1138748 R 284812 CDS SPBC409.05 19112247 2540917 join(1140148..1140196,1140250..1140297,1140372..1140739,1140785..1140805) 1 NC_003423.3 see GNC for naming issues; SCF ubiquitin ligase complex subunit Skp1 1140805 skp1 2540917 skp1 Schizosaccharomyces pombe 972h- SCF ubiquitin ligase complex subunit Skp1 NP_595455.1 1140148 D 284812 CDS SPBC409.06 19112248 2540956 join(1142220..1142344,1142496..1143273) 1 NC_003423.3 ubiquitin C-terminal hydrolase Uch2 1143273 uch2 2540956 uch2 Schizosaccharomyces pombe 972h- ubiquitin C-terminal hydrolase Uch2 NP_595456.1 1142220 D 284812 CDS SPBC409.07c 19112249 2541055 complement(1143967..1145784) 1 NC_003423.3 MAP kinase kinase Wis1 1145784 wis1 2541055 wis1 Schizosaccharomyces pombe 972h- MAP kinase kinase Wis1 NP_595457.1 1143967 R 284812 CDS SPBC409.08 19112250 2541015 join(1152079..1152173,1152216..1153740) 1 NC_003423.3 was originally annotated as a pseudogene, but now has putative predicted splice with no branch site; splice may be incorrect, intron is unsupported, and this could be a single frameshift; spermine family transporter (predicted) 1153740 2541015 SPBC409.08 Schizosaccharomyces pombe 972h- spermine family transporter (predicted) NP_595458.1 1152079 D 284812 CDS SPBC409.09c 19112251 2541047 complement(1154612..1155601) 1 NC_003423.3 PMID:17035632 is pending curation; kinetochore protein Mis13 1155601 mis13 2541047 mis13 Schizosaccharomyces pombe 972h- kinetochore protein Mis13 NP_595459.1 1154612 R 284812 CDS SPBC409.10 19112252 2541029 1157118..1158017 1 NC_003423.3 phosphoribosylamidoimidazolesuccinocarboxamide synthase Ade7 1158017 ade7 2541029 ade7 Schizosaccharomyces pombe 972h- phosphoribosylamidoimidazolesuccinocarboxamide synthase Ade7 NP_595460.1 1157118 D 284812 CDS SPBC409.11 19112253 2540957 1158594..1160255 1 NC_003423.3 sequence orphan 1160255 meu18 2540957 meu18 Schizosaccharomyces pombe 972h- sequence orphan NP_595461.1 1158594 D 284812 CDS SPBC409.12c 162312174 2541052 complement(join(1161896..1162665,1162820..1162918,1162974..1163082)) 1 NC_003423.3 telomere cap complex subunit Stn1 1163082 stn1 2541052 stn1 Schizosaccharomyces pombe 972h- telomere cap complex subunit Stn1 XP_001713126.1 1161896 R 284812 CDS SPBC409.13 19112255 2541125 join(1165481..1165522,1165810..1166247) 1 NC_003423.3 6,7-dimethyl-8-ribityllumazine synthase (predicted) 1166247 2541125 SPBC409.13 Schizosaccharomyces pombe 972h- 6,7-dimethyl-8-ribityllumazine synthase (predicted) NP_595463.1 1165481 D 284812 CDS SPBC409.14c 19112256 2540774 complement(1166932..1167204) 1 NC_003423.3 mitochondrial ribosomal protein subunit S17 1167204 mrps17 2540774 mrps17 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit S17 NP_595464.1 1166932 R 284812 CDS SPBC409.15 19112257 2540813 join(1167534..1167800,1168062..1168334) 1 NC_003423.3 highly acidic C terminus; rRNA processing protein Tsr2 (predicted) 1168334 2540813 SPBC409.15 Schizosaccharomyces pombe 972h- rRNA processing protein Tsr2 (predicted) NP_595465.1 1167534 D 284812 CDS SPBC409.16c 19112258 2541027 complement(1168687..1169049) 1 NC_003423.3 was previously annotated as dubious; recombination protein Saw1 (predicted) 1169049 2541027 SPBC409.16c Schizosaccharomyces pombe 972h- recombination protein Saw1 (predicted) NP_595466.1 1168687 R 284812 CDS SPBC409.17c 19112259 2540826 complement(1169554..1170222) 1 NC_003423.3 DUF1769 family protein 1170222 2540826 SPBC409.17c Schizosaccharomyces pombe 972h- DUF1769 family protein NP_595467.1 1169554 R 284812 CDS SPBC409.18 19112260 2541078 join(1171602..1171796,1171857..1172501) 1 NC_003423.3 phosphatidic acid phosphatase (predicted) 1172501 2541078 SPBC409.18 Schizosaccharomyces pombe 972h- phosphatidic acid phosphatase (predicted) NP_595468.1 1171602 D 284812 CDS SPBC409.19c 19112261 2540958 complement(1172732..1174084) 1 NC_003423.3 metaxin 1 may be the ortholog of S. cerevisiae TOM37. I have multiply aligned it and it has conserved common residues; TOM37 has a C term TMM region like many metaxin 1 family; both are mitochondrial membrane proteins involved in pre-protein import; S. cerevisiae ortholog for metaxin hasn't been identified and vice versa; can't make a Pfam family because it overlaps with glutathionine S-transferase; metaxin 1174084 2540958 SPBC409.19c Schizosaccharomyces pombe 972h- metaxin NP_595469.1 1172732 R 284812 CDS SPBC409.20c 19112262 2540800 complement(join(1174829..1175365,1175755..1175865)) 1 NC_003423.3 ER chaperone SHR3 homologue Psh3 1175865 psh3 2540800 psh3 Schizosaccharomyces pombe 972h- ER chaperone SHR3 homologue Psh3 NP_595470.1 1174829 R 284812 CDS SPBC409.21 19112263 2541043 1176861..1177439 1 NC_003423.3 ER protein translocation subcomplex subunit Sec66 (predicted) 1177439 sec66 2541043 sec66 Schizosaccharomyces pombe 972h- ER protein translocation subcomplex subunit Sec66 (predicted) NP_595471.1 1176861 D 284812 CDS SPBC1306.01c 162312176 2539776 complement(1178080..1180392) 1 NC_003423.3 mitochondrial translation elongation factor G 1180392 2539776 SPBC1306.01c Schizosaccharomyces pombe 972h- mitochondrial translation elongation factor G NP_595472.2 1178080 R 284812 CDS SPBC1306.02 19112265 2539918 join(1181044..1182089,1182143..1182791,1182845..1184104) 1 NC_003423.3 WD repeat protein, human WDR6 family 1184104 2539918 SPBC1306.02 Schizosaccharomyces pombe 972h- WD repeat protein, human WDR6 family NP_595473.1 1181044 D 284812 CDS SPBC4.01 19112266 2540733 join(1184427..1185115,1185267..1185324) 1 NC_003423.3 sequence orphan 1185324 2540733 SPBC4.01 Schizosaccharomyces pombe 972h- sequence orphan NP_595474.1 1184427 D 284812 CDS SPBC4.02c 295442822 2541076 complement(join(1185617..1186640,1186738..1186846,1187087..1187162,1187220..1187324)) 1 NC_003423.3 conserved fungal protein 1187324 2541076 SPBC4.02c Schizosaccharomyces pombe 972h- conserved fungal protein NP_595475.2 1185617 R 284812 CDS SPBC4.03c 19112268 2540710 complement(1188137..1190812) 1 NC_003423.3 NAS from PMID: 18032584; COPII-coated vesicle component Sfb3 (putative) 1190812 2540710 SPBC4.03c Schizosaccharomyces pombe 972h- COPII-coated vesicle component Sfb3 (putative) NP_595476.1 1188137 R 284812 CDS SPBC4.04c 19112269 2540620 complement(join(1191397..1193656,1193876..1194108)) 1 NC_003423.3 MCM complex subunit Mcm2 1194108 mcm2 2540620 mcm2 Schizosaccharomyces pombe 972h- MCM complex subunit Mcm2 NP_595477.1 1191397 R 284812 CDS SPBC4.05 19112270 2540600 1194354..1195343 1 NC_003423.3 zinc finger protein Mlo2 1195343 mlo2 2540600 mlo2 Schizosaccharomyces pombe 972h- zinc finger protein Mlo2 NP_595478.1 1194354 D 284812 CDS SPBC4.06 19112271 2540652 1196014..1197402 1 NC_003423.3 acid phosphatase (predicted) 1197402 2540652 SPBC4.06 Schizosaccharomyces pombe 972h- acid phosphatase (predicted) NP_595479.1 1196014 D 284812 CDS SPBC4.07c 19112272 2540939 complement(join(1197898..1199241,1199377..1199379)) 1 NC_003423.3 19S proteasome regulatory subunit Rpt2 1199379 rpt2 2540939 rpt2 Schizosaccharomyces pombe 972h- 19S proteasome regulatory subunit Rpt2 NP_595480.1 1197898 R 284812 CDS SPBC725.01 19112273 2541186 1200661..1201974 1 NC_003423.3 aspartate aminotransferase (predicted) 1201974 2541186 SPBC725.01 Schizosaccharomyces pombe 972h- aspartate aminotransferase (predicted) NP_595481.1 1200661 D 284812 CDS SPBC725.02 19112274 2541178 1203757..1204644 1 NC_003423.3 S. Pombe YPD1-like protein; histidine-containing response regulator phosphotransferase Mpr1 1204644 mpr1 2541178 mpr1 Schizosaccharomyces pombe 972h- histidine-containing response regulator phosphotransferase Mpr1 NP_595482.1 1203757 D 284812 CDS SPBC725.03 19112275 2541074 1207040..1207813 1 NC_003423.3 conserved fungal protein 1207813 2541074 SPBC725.03 Schizosaccharomyces pombe 972h- conserved fungal protein NP_595483.1 1207040 D 284812 CDS SPBC725.04 19112276 2541142 join(1208965..1210626,1210678..1210722) 1 NC_003423.3 oxalyl-CoA decarboxylase (predicted) 1210722 2541142 SPBC725.04 Schizosaccharomyces pombe 972h- oxalyl-CoA decarboxylase (predicted) NP_595484.1 1208965 D 284812 CDS SPBC725.05c 19112277 2541177 complement(1210895..1212352) 1 NC_003423.3 nucleotide pyrophosphatase (predicted) 1212352 2541177 SPBC725.05c Schizosaccharomyces pombe 972h- nucleotide pyrophosphatase (predicted) NP_595485.1 1210895 R 284812 CDS SPBC725.06c 19112278 2541095 complement(1212823..1215921) 1 NC_003423.3 serine/threonine protein kinase Ppk31 (predicted) 1215921 ppk31 2541095 ppk31 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Ppk31 (predicted) NP_595486.1 1212823 R 284812 CDS SPBC725.07 19112279 2541112 1217019..1218815 1 NC_003423.3 peroxisomal targeting signal receptor Pex5 1218815 pex5 2541112 pex5 Schizosaccharomyces pombe 972h- peroxisomal targeting signal receptor Pex5 NP_595487.1 1217019 D 284812 CDS SPBC725.08 19112280 2541143 join(1219509..1219572,1219625..1219732,1219787..1219817,1219889..1221515) 1 NC_003423.3 zf-C2H2 type zinc finger protein, implicated in RNAi (predicted) 1221515 2541143 SPBC725.08 Schizosaccharomyces pombe 972h- zf-C2H2 type zinc finger protein, implicated in RNAi (predicted) NP_595488.1 1219509 D 284812 CDS SPBC725.09c 19112281 2541160 complement(join(1222360..1223106,1223149..1223196)) 1 NC_003423.3 BAR adaptor protein Hob3 1223196 hob3 2541160 hob3 Schizosaccharomyces pombe 972h- BAR adaptor protein Hob3 NP_595489.1 1222360 R 284812 CDS SPBC725.10 19112282 2541096 1224974..1225462 1 NC_003423.3 tspO homolog/ peripheral benzodiazepine receptor homolog, involved in the transport cytoplas/mitochondrial of haem (predicted) 1225462 2541096 SPBC725.10 Schizosaccharomyces pombe 972h- tspO homolog/ peripheral benzodiazepine receptor homolog, involved in the transport cytoplas/mitochondrial of haem (predicted) NP_595490.1 1224974 D 284812 CDS SPBC725.11c 19112283 2541161 complement(1225910..1226914) 1 NC_003423.3 CCAAT-binding factor complex subunit Php2 1226914 php2 2541161 php2 Schizosaccharomyces pombe 972h- CCAAT-binding factor complex subunit Php2 NP_595491.1 1225910 R 284812 CDS SPBC725.12 295442824 2541173 join(1227762..1227876,1227926..1228094,1228166..1228307) 1 NC_003423.3 Borealin homolog Nbl1 1228307 nbl1 2541173 nbl1 Schizosaccharomyces pombe 972h- Borealin homolog Nbl1 NP_595492.2 1227762 D 284812 CDS SPBC725.13c 19112285 2541194 complement(1228476..1229027) 1 NC_003423.3 Defect in REreplication 13 (PMID:15466421); GINS complex subunit Psf2 1229027 psf2 2541194 psf2 Schizosaccharomyces pombe 972h- GINS complex subunit Psf2 NP_595493.1 1228476 R 284812 CDS SPBC725.14 19112286 2541183 1229291..1230793 1 NC_003423.3 the name arg6 is tentative and was assigned because this is the only gene involved in arginine biosynthesis between ade7 1076817 on contig pB10D8 and ura5 1150778 on contig pB10D8; acetylglutamate synthase Arg6 (predicted) 1230793 arg6 2541183 arg6 Schizosaccharomyces pombe 972h- acetylglutamate synthase Arg6 (predicted) NP_595494.1 1229291 D 284812 CDS SPBC725.15 19112287 2541166 1231079..1231726 1 NC_003423.3 orotate phosphoribosyltransferase Ura5 1231726 ura5 2541166 ura5 Schizosaccharomyces pombe 972h- orotate phosphoribosyltransferase Ura5 NP_595495.1 1231079 D 284812 CDS SPBC725.16 19112288 2541153 join(1233335..1233560,1233688..1235375) 1 NC_003423.3 MBF transcription factor complex subunit Res1 1235375 res1 2541153 res1 Schizosaccharomyces pombe 972h- MBF transcription factor complex subunit Res1 NP_595496.1 1233335 D 284812 CDS SPBC725.17c 19112289 2541184 complement(join(1235651..1235896,1236011..1236367)) 1 NC_003423.3 RNA polymerase I transcription factor subunit Rrn11 (predicted) 1236367 rrn11 2541184 rrn11 Schizosaccharomyces pombe 972h- RNA polymerase I transcription factor subunit Rrn11 (predicted) NP_595497.1 1235651 R 284812 CDS SPBC651.01c 162312178 2541126 complement(join(1236884..1238600,1238821..1238915,1239005..1239100,1239156..1239176)) 1 NC_003423.3 GTP binding protein Nog1 (predicted) 1239176 nog1 2541126 nog1 Schizosaccharomyces pombe 972h- GTP binding protein Nog1 (predicted) XP_001713127.1 1236884 R 284812 CDS SPBC651.02 19112292 2541127 join(1240185..1240331,1240384..1240479,1240530..1240964,1241025..1241040,1241098..1241234) 1 NC_003423.3 bis(5'-adenosyl)-triphosphatase (predicted) 1241234 2541127 SPBC651.02 Schizosaccharomyces pombe 972h- bis(5'-adenosyl)-triphosphatase (predicted) NP_595500.1 1240185 D 284812 CDS SPBC651.03c 19112293 2541149 complement(1241824..1242945) 1 NC_003423.3 GAP for Ypt; GTPase activating protein Gyp10 1242945 gyp10 2541149 gyp10 Schizosaccharomyces pombe 972h- GTPase activating protein Gyp10 NP_595501.1 1241824 R 284812 CDS SPBC651.04 19112294 2541100 1244847..1245560 1 NC_003423.3 sequence orphan 1245560 2541100 SPBC651.04 Schizosaccharomyces pombe 972h- sequence orphan NP_595502.1 1244847 D 284812 CDS SPBC651.05c 19112295 2541147 complement(join(1246102..1246221,1246280..1246918)) 1 NC_003423.3 defective organization of telomeres; EAP30 family protein Dot2 1246918 dot2 2541147 dot2 Schizosaccharomyces pombe 972h- EAP30 family protein Dot2 NP_595503.1 1246102 R 284812 CDS SPBC651.06 295442826 2541103 join(1247484..1248086,1248158..1248241,1248381..1248481,1248692..1248921,1248991..1249073,1249135..1249617) 1 NC_003423.3 COP9/signalosome associated (pers. comm. Tony Carr); merged SPBC651.06 and SPBC651.07 on 26-6-2008, pers. comm. Chary Chahwan; sequence orphan 1249617 mug166 2541103 mug166 Schizosaccharomyces pombe 972h- sequence orphan NP_595504.2 1247484 D 284812 CDS SPBC651.08c 19112298 2541094 complement(join(1250083..1254276,1254327..1254350)) 1 NC_003423.3 DNA-directed RNA polymerase III complex large subunit Rpc1 1254350 rpc1 2541094 rpc1 Schizosaccharomyces pombe 972h- DNA-directed RNA polymerase III complex large subunit Rpc1 NP_595506.1 1250083 R 284812 CDS SPBC651.09c 19112299 2541123 complement(join(1255607..1257026,1257074..1257247,1257298..1257386)) 1 NC_003423.3 RNA polymerase II associated Paf1 complex (predicted) 1257386 2541123 SPBC651.09c Schizosaccharomyces pombe 972h- RNA polymerase II associated Paf1 complex (predicted) NP_595507.1 1255607 R 284812 CDS SPBC651.10 19112300 2540911 1257903..1259069 1 NC_003423.3 Smc5-6 complex non-SMC subunit Nse5 1259069 nse5 2540911 nse5 Schizosaccharomyces pombe 972h- Smc5-6 complex non-SMC subunit Nse5 NP_595508.1 1257903 D 284812 CDS SPBC651.11c 19112301 2541119 complement(join(1259271..1260087,1260136..1260555,1260600..1260640)) 1 NC_003423.3 AP-3 adaptor complex subunit Apm3 (predicted) 1260640 apm3 2541119 apm3 Schizosaccharomyces pombe 972h- AP-3 adaptor complex subunit Apm3 (predicted) NP_595509.1 1259271 R 284812 CDS SPBC651.12c 19112302 2541145 complement(1261019..1261840) 1 NC_003423.3 sequence orphan 1261840 2541145 SPBC651.12c Schizosaccharomyces pombe 972h- sequence orphan NP_595510.1 1261019 R 284812 CDS SPBC31A8.01c 162312180 3361269 complement(1262678..1263604) 1 NC_003423.3 RTNLA designation is also used in other species; reticulon-like protein 1263604 cwl1 3361269 cwl1 Schizosaccharomyces pombe 972h- reticulon-like protein NP_001018789.2 1262678 R 284812 CDS SPBC3D6.02 19112305 2540960 1269748..1270920 1 NC_003423.3 But2 family protein But2 1270920 but2 2540960 but2 Schizosaccharomyces pombe 972h- But2 family protein But2 NP_595513.1 1269748 D 284812 CDS SPBC3D6.03c 19112306 2540985 complement(1271978..1274014) 1 NC_003423.3 tRNA endonuclease Trz1 1274014 trzl 2540985 trzl Schizosaccharomyces pombe 972h- tRNA endonuclease Trz1 NP_595514.1 1271978 R 284812 CDS SPBC3D6.15 19112307 2540965 join(1274250..1274252,1274303..1274543,1274648..1274670) 1 NC_003423.3 40S ribosomal protein S25 1274670 rps2501 2540965 rps2501 Schizosaccharomyces pombe 972h- 40S ribosomal protein S25 NP_595515.1 1274250 D 284812 CDS SPBC3D6.04c 19112308 2540320 complement(join(1274979..1276897,1276948..1277098)) 1 NC_003423.3 mitotic arrest deficient 1; mitotic spindle checkpoint protein Mad1 1277098 mad1 2540320 mad1 Schizosaccharomyces pombe 972h- mitotic spindle checkpoint protein Mad1 NP_595516.1 1274979 R 284812 CDS SPBC3D6.05 19112309 2540998 join(1278358..1278433,1278471..1278709,1279032..1279373) 1 NC_003423.3 phosphatidate cytidylyltransferase Ptp4 (predicted) 1279373 ptp4 2540998 ptp4 Schizosaccharomyces pombe 972h- phosphatidate cytidylyltransferase Ptp4 (predicted) NP_595517.1 1278358 D 284812 CDS SPBC3D6.06c 19112310 2541014 complement(join(1279902..1280820,1281243..1281349)) 1 NC_003423.3 ribose-phosphate pyrophosphokinase (predicted) 1281349 2541014 SPBC3D6.06c Schizosaccharomyces pombe 972h- ribose-phosphate pyrophosphokinase (predicted) NP_595518.1 1279902 R 284812 CDS SPBC3D6.07 19112311 2540986 join(1282754..1282850,1282911..1282990,1283046..1283323,1283367..1283482,1283526..1284325) 1 NC_003423.3 pig-A 1284325 gpi3 2540986 gpi3 Schizosaccharomyces pombe 972h- pig-A NP_595519.1 1282754 D 284812 CDS SPBC3D6.08c 19112312 2540520 complement(join(1284489..1284662,1284740..1284855,1284904..1284972,1285021..1285084)) 1 NC_003423.3 mRNA decapping complex subunit (predicted) 1285084 lsm1 2540520 lsm1 Schizosaccharomyces pombe 972h- mRNA decapping complex subunit (predicted) NP_595520.1 1284489 R 284812 CDS SPBC3D6.09 19112313 2540966 join(1286143..1286315,1286448..1286566,1286605..1286945) 1 NC_003423.3 DNA polymerase epsilon subunit Dpb4 (predicted) 1286945 dpb4 2540966 dpb4 Schizosaccharomyces pombe 972h- DNA polymerase epsilon subunit Dpb4 (predicted) NP_595521.1 1286143 D 284812 CDS SPBC3D6.10 19112314 2540679 join(1287406..1288198,1288236..1289014) 1 NC_003423.3 AP-endonuclease Apn2 1289014 apn2 2540679 apn2 Schizosaccharomyces pombe 972h- AP-endonuclease Apn2 NP_595522.1 1287406 D 284812 CDS SPBC3D6.11c 19112315 2540618 complement(1289151..1289960) 1 NC_003423.3 SUMO-targeted ubiquitin-protein ligase E3 Slx8 (predicted) 1289960 slx8 2540618 slx8 Schizosaccharomyces pombe 972h- SUMO-targeted ubiquitin-protein ligase E3 Slx8 (predicted) NP_595523.1 1289151 R 284812 CDS SPBC3D6.12 19112316 2540971 1290564..1293332 1 NC_003423.3 U3 snoRNA associted protein Dip2 (predicted) 1293332 2540971 SPBC3D6.12 Schizosaccharomyces pombe 972h- U3 snoRNA associted protein Dip2 (predicted) NP_595524.1 1290564 D 284812 CDS SPBC3D6.13c 19112317 2541041 complement(1293702..1295882) 1 NC_003423.3 ER associated protein disulfide isomerase (predicted) 1295882 2541041 SPBC3D6.13c Schizosaccharomyces pombe 972h- ER associated protein disulfide isomerase (predicted) NP_595525.1 1293702 R 284812 CDS SPBC3D6.16 162312182 5802767 join(1296915..1296963,1297022..1297260) 1 NC_003423.3 no evidence from affey/Solexa; dubious 1297260 5802767 SPBC3D6.16 Schizosaccharomyces pombe 972h- dubious XP_001713128.1 1296915 D 284812 CDS SPBC30B4.01c 162312184 2540969 complement(1299491..1300615) 1 NC_003423.3 52 consecutive serines; extended gene prediction at the N-term by 30 amino acids to include hydrophobic segment which is probably a signal peptide (S. cerevisiae orthologs all have sig peps) 12.11.03; transmembrane receptor Wsc1 (predicted) 1300615 wsc1 2540969 wsc1 Schizosaccharomyces pombe 972h- transmembrane receptor Wsc1 (predicted) NP_595526.2 1299491 R 284812 CDS SPBC30B4.02c 19112319 2540416 complement(1301941..1304028) 1 NC_003423.3 R3H and G-patch domain, implicated in splicing 1304028 2540416 SPBC30B4.02c Schizosaccharomyces pombe 972h- R3H and G-patch domain, implicated in splicing NP_595527.1 1301941 R 284812 CDS SPBC30B4.03c 19112320 2540335 complement(1304821..1305996) 1 NC_003423.3 adhesion defective protein 1305996 adn1 2540335 adn1 Schizosaccharomyces pombe 972h- adhesion defective protein NP_595528.1 1304821 R 284812 CDS SPBC30B4.04c 19112321 2540318 complement(1309127..1311724) 1 NC_003423.3 SWI/SNF complex subunit Sol1 1311724 sol1 2540318 sol1 Schizosaccharomyces pombe 972h- SWI/SNF complex subunit Sol1 NP_595529.1 1309127 R 284812 CDS SPBC30B4.05 19112322 2540419 join(1313231..1313288,1313338..1316183) 1 NC_003423.3 karyopherin Kap109 1316183 kap109 2540419 kap109 Schizosaccharomyces pombe 972h- karyopherin Kap109 NP_595530.1 1313231 D 284812 CDS SPBC30B4.06c 19112323 2540415 complement(1316376..1318376) 1 NC_003423.3 mitochondrial tRNA uridine 5-carboxymethylaminomethyl modification enzyme 1318376 2540415 SPBC30B4.06c Schizosaccharomyces pombe 972h- mitochondrial tRNA uridine 5-carboxymethylaminomethyl modification enzyme NP_595531.1 1316376 R 284812 CDS SPBC30B4.07c 19112324 2540343 complement(join(1319538..1319620,1319683..1320493)) 1 NC_003423.3 transcription factor TFIIH complex subunit Tfb4 1320493 tfb4 2540343 tfb4 Schizosaccharomyces pombe 972h- transcription factor TFIIH complex subunit Tfb4 NP_595532.1 1319538 R 284812 CDS SPBC30B4.08 162312186 2540347 join(1320692..1320819,1320897..1321004,1321066..1321471,1321534..1321833) 1 NC_003423.3 gene structure updated as per PMID:16797182; the exonucleolytic trimming to generate mature 3'-end of 5.8S rRNA from tricistronic rRNA transcript function is performed by S. cerevisiae ortholog NRG2 which is not orthologous to eri1 PMID:18438419; double-strand siRNA ribonuclease 1321833 eri1 2540347 eri1 Schizosaccharomyces pombe 972h- double-strand siRNA ribonuclease XP_001713129.1 1320692 D 284812 CDS SPBC27B12.01c 162312188 2540379 complement(join(1321952..1322042,1322087..1322295,1322360..1323100)) 1 NC_003423.3 alternative splicing may exist using internal donors at positions 22869 and 22968; Mdm10/Mdm12/Mmm1 complex subunit Mmm1 (predicted) 1323100 mmm1 2540379 mmm1 Schizosaccharomyces pombe 972h- Mdm10/Mdm12/Mmm1 complex subunit Mmm1 (predicted) NP_595534.2 1321952 R 284812 CDS SPBC27B12.02 19112327 2540369 1323740..1324069 1 NC_003423.3 previously annotated as dubious, may not be protein coding; sequence orphan 1324069 2540369 SPBC27B12.02 Schizosaccharomyces pombe 972h- sequence orphan NP_595535.1 1323740 D 284812 CDS SPBC27B12.03c 162312190 3361266 complement(1324475..1325464) 1 NC_003423.3 lathosterol oxidase (predicted) 1325464 3361266 SPBC27B12.03c Schizosaccharomyces pombe 972h- lathosterol oxidase (predicted) NP_001018791.2 1324475 R 284812 CDS SPBC27B12.04c 19112328 2540495 complement(1326139..1328592) 1 NC_003423.3 conserved eukaryotic protein 1328592 2540495 SPBC27B12.04c Schizosaccharomyces pombe 972h- conserved eukaryotic protein NP_595536.1 1326139 R 284812 CDS SPBC27B12.05 19112329 2540382 join(1329204..1329415,1329458..1329555,1329597..1329720,1329765..1329984,1330039..1330467,1330515..1330607) 1 NC_003423.3 additional C terminal exon to D1022301; WD repeat protein 1330607 2540382 SPBC27B12.05 Schizosaccharomyces pombe 972h- WD repeat protein NP_595537.1 1329204 D 284812 CDS SPBC27B12.06 19112330 2540594 1331066..1333822 1 NC_003423.3 pig-O (predicted) 1333822 gpi13 2540594 gpi13 Schizosaccharomyces pombe 972h- pig-O (predicted) NP_595538.1 1331066 D 284812 CDS SPBC27B12.07 19112331 2540478 join(1334112..1334495,1334607..1334931,1334999..1335162) 1 NC_003423.3 additional C terminal exon TR:D1022299; conserved fungal protein 1335162 2540478 SPBC27B12.07 Schizosaccharomyces pombe 972h- conserved fungal protein NP_595539.1 1334112 D 284812 CDS SPBC27B12.08 19112332 2540316 join(1335724..1335970,1336015..1336093,1336132..1336180,1336230..1339682,1339723..1340938,1340983..1341142,1341187..1341337,1341377..1341578,1341619..1341821) 1 NC_003423.3 Pof6 interacting protein Sip1 1341821 sip1 2540316 sip1 Schizosaccharomyces pombe 972h- Pof6 interacting protein Sip1 NP_595540.1 1335724 D 284812 CDS SPBC27B12.09c 19112333 2540370 complement(1342043..1342876) 1 NC_003423.3 mitochondrial FAD transporter (predicted) 1342876 2540370 SPBC27B12.09c Schizosaccharomyces pombe 972h- mitochondrial FAD transporter (predicted) NP_595541.1 1342043 R 284812 CDS SPBC27B12.10c 19112334 2540502 complement(join(1344032..1344157,1344214..1344237)) 1 NC_003423.3 mitochondrial TOM complex subunit Tom7 1344237 tom7 2540502 tom7 Schizosaccharomyces pombe 972h- mitochondrial TOM complex subunit Tom7 NP_595542.1 1344032 R 284812 CDS SPBC27B12.11c 19112335 2540501 complement(1345249..1347465) 1 NC_003423.3 transcription factor (predicted) 1347465 2540501 SPBC27B12.11c Schizosaccharomyces pombe 972h- transcription factor (predicted) NP_595543.1 1345249 R 284812 CDS SPBC27B12.14 19112336 2540590 join(1348380..1348416,1348504..1348622,1348801..1348863) 1 NC_003423.3 truncated C-terminal; mitochondrial membrane protein complex assembly protein 1348863 2540590 SPBC27B12.14 Schizosaccharomyces pombe 972h- mitochondrial membrane protein complex assembly protein NP_595544.1 1348380 D 284812 CDS SPBC27B12.12c 19112337 2540298 complement(1351331..1353742) 1 NC_003423.3 CorA family magnesium ion transporter (predicted) 1353742 2540298 SPBC27B12.12c Schizosaccharomyces pombe 972h- CorA family magnesium ion transporter (predicted) NP_595545.1 1351331 R 284812 CDS SPBC27B12.13 162312192 2540506 1356317..1357351 1 NC_003423.3 mitochondrial TOM complex subunit Tom40 1357351 tom40 2540506 tom40 Schizosaccharomyces pombe 972h- mitochondrial TOM complex subunit Tom40 NP_595546.2 1356317 D 284812 CDS SPBC8D2.01 19112356 2541233 join(1358692..1358698,1358744..1358925,1359483..1360439) 1 NC_003423.3 serine/threonine protein kinase Gsk31 1360439 gsk31 2541233 gsk31 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Gsk31 NP_595564.1 1358692 D 284812 CDS SPBC8D2.02c 19112357 2541244 complement(join(1361216..1361510,1361664..1361788,1361844..1361936)) 1 NC_003423.3 vacuolar sorting protein Vps68 1361936 2541244 SPBC8D2.02c Schizosaccharomyces pombe 972h- vacuolar sorting protein Vps68 NP_595565.1 1361216 R 284812 CDS SPBC8D2.03c 19112358 2541200 complement(1364512..1364823) 1 NC_003423.3 histone H4 h4.2 1364823 hhf2 2541200 hhf2 Schizosaccharomyces pombe 972h- histone H4 h4.2 NP_595566.1 1364512 R 284812 CDS SPBC8D2.04 19112359 2541220 1365158..1365568 1 NC_003423.3 histone H3 h3.2 1365568 hht2 2541220 hht2 Schizosaccharomyces pombe 972h- histone H3 h3.2 NP_595567.1 1365158 D 284812 CDS SPBC8D2.05c 19112360 2541242 complement(join(1366216..1368668,1368724..1368793)) 1 NC_003423.3 spindle pole body protein Sfi1 1368793 sfi1 2541242 sfi1 Schizosaccharomyces pombe 972h- spindle pole body protein Sfi1 NP_595568.1 1366216 R 284812 CDS SPBC8D2.06 19112361 2541245 1369158..1372352 1 NC_003423.3 cytoplasmic isoleucine-tRNA ligase Irs1 (predicted) 1372352 irs1 2541245 irs1 Schizosaccharomyces pombe 972h- cytoplasmic isoleucine-tRNA ligase Irs1 (predicted) NP_595569.1 1369158 D 284812 CDS SPBC8D2.07c 19112362 2541253 complement(join(1372610..1374338,1374538..1374625,1374684..1374780,1374828..1374935)) 1 NC_003423.3 formed by merging entries SPBC8D2.07c and SPBC8D2.08c; orthology prediction pers comm R. Maraia; transcription factor TFIIIC complex subunit Sfc9 (predicted) 1374935 sfc9 2541253 sfc9 Schizosaccharomyces pombe 972h- transcription factor TFIIIC complex subunit Sfc9 (predicted) NP_595570.1 1372610 R 284812 CDS SPBC8D2.09c 19112363 2541219 complement(join(1375313..1375420,1375494..1375721)) 1 NC_003423.3 U2 snRNP-associated protein Msl1 (predicted) 1375721 2541219 SPBC8D2.09c Schizosaccharomyces pombe 972h- U2 snRNP-associated protein Msl1 (predicted) NP_595571.1 1375313 R 284812 CDS SPBC8D2.10c 19112364 2541248 complement(join(1376341..1377734,1377814..1377909,1378224..1378365)) 1 NC_003423.3 type I ribosomal protein arginine N-methyltransferase Rmt3 1378365 rmt3 2541248 rmt3 Schizosaccharomyces pombe 972h- type I ribosomal protein arginine N-methyltransferase Rmt3 NP_595572.1 1376341 R 284812 CDS SPBC8D2.11 19112365 2541240 1379592..1379960 1 NC_003423.3 sequence orphan 1379960 2541240 SPBC8D2.11 Schizosaccharomyces pombe 972h- sequence orphan NP_595573.1 1379592 D 284812 CDS SPBC8D2.12c 19112366 2541235 complement(join(1380298..1381015,1381080..1381143,1381500..1381599)) 1 NC_003423.3 mitochondrial DNA binding protein (predicted) 1381599 2541235 SPBC8D2.12c Schizosaccharomyces pombe 972h- mitochondrial DNA binding protein (predicted) NP_595574.1 1380298 R 284812 CDS SPBC8D2.13 19112367 2541267 join(1382124..1382198,1382241..1382308,1382398..1382725,1382771..1383507,1383559..1383706) 1 NC_003423.3 box H/ACA snoRNP assembly protein Shq1 (predicted) 1383706 shq1 2541267 shq1 Schizosaccharomyces pombe 972h- box H/ACA snoRNP assembly protein Shq1 (predicted) NP_595575.1 1382124 D 284812 CDS SPBC8D2.14c 19112368 2541263 complement(join(1384008..1384738,1384830..1385028)) 1 NC_003423.3 SNARE Sed5 (predicted) 1385028 sed5 2541263 sed5 Schizosaccharomyces pombe 972h- SNARE Sed5 (predicted) NP_595576.1 1384008 R 284812 CDS SPBC8D2.15 19112369 2541234 join(1386298..1386345,1386387..1387451) 1 NC_003423.3 mitochondrial lipoic acid synthetase (predicted) 1387451 2541234 SPBC8D2.15 Schizosaccharomyces pombe 972h- mitochondrial lipoic acid synthetase (predicted) NP_595577.1 1386298 D 284812 CDS SPBC8D2.16c 19112370 2541259 complement(join(1387747..1388568,1388612..1388737)) 1 NC_003423.3 DUF171 family protein 1388737 2541259 SPBC8D2.16c Schizosaccharomyces pombe 972h- DUF171 family protein NP_595578.1 1387747 R 284812 CDS SPBC8D2.17 295442828 2541250 join(1390183..1391093,1391147..1391222) 1 NC_003423.3 alpha-1,2-galactosyltransferase (predicted) 1391222 2541250 SPBC8D2.17 Schizosaccharomyces pombe 972h- alpha-1,2-galactosyltransferase (predicted) NP_595579.2 1390183 D 284812 CDS SPBC8D2.18c 19112372 2541218 complement(1391667..1392968) 1 NC_003423.3 This gene is not the gene described in Abe and Shimoda (2000), Genetics 154 1497-1508. They describe it as ORF SPBC8D2.18c, and as a kinase homologous to S. cerevisiae IME2 and S. pombe pit1.mde3 but the gene described in this paper corresponds to SPC8D2.19; adenosylhomocysteinase (predicted) 1392968 2541218 SPBC8D2.18c Schizosaccharomyces pombe 972h- adenosylhomocysteinase (predicted) NP_595580.1 1391667 R 284812 CDS SPBC8D2.19 19112373 2541254 join(1393454..1393600,1393647..1393721,1393855..1395312) 1 NC_003423.3 function overlapping with pit1; serine/threonine protein kinase, meiotic Mde3 1395312 mde3 2541254 mde3 Schizosaccharomyces pombe 972h- serine/threonine protein kinase, meiotic Mde3 NP_595581.1 1393454 D 284812 CDS SPBC8D2.20c 19112374 2541273 complement(1395834..1399508) 1 NC_003423.3 COPII-coated vesicle component Sec31 (predicted) 1399508 sec31 2541273 sec31 Schizosaccharomyces pombe 972h- COPII-coated vesicle component Sec31 (predicted) NP_595582.1 1395834 R 284812 CDS SPBC17A3.01c 162312194 2539802 complement(1400418..1401776) 1 NC_003423.3 TIM23 translocase complex subunit Tim50 (predicted) 1401776 tim50 2539802 tim50 Schizosaccharomyces pombe 972h- TIM23 translocase complex subunit Tim50 (predicted) NP_595583.2 1400418 R 284812 CDS SPBC17A3.02 19112376 2540188 join(1403247..1403313,1403355..1403369,1403418..1403511,1403571..1403590,1403812..1403975) 1 NC_003423.3 conserved fungal protein 1403975 2540188 SPBC17A3.02 Schizosaccharomyces pombe 972h- conserved fungal protein NP_595584.1 1403247 D 284812 CDS SPBC17A3.03c 19112377 2540134 complement(join(1404360..1404567,1404619..1404695,1404757..1404842,1404974..1405394)) 1 NC_003423.3 phosphoprotein phosphatase (predicted) 1405394 2540134 SPBC17A3.03c Schizosaccharomyces pombe 972h- phosphoprotein phosphatase (predicted) NP_595585.1 1404360 R 284812 CDS SPBC17A3.04c 19112378 2540052 complement(join(1407408..1409559,1409621..1409699,1409766..1409883)) 1 NC_003423.3 added name rar1 to remove conflicts, mrs1 and mes1 are already implemented as primary names for other genes; cytoplasmic methionine-tRNA ligase Mrs1 (predicted) 1409883 rar1 2540052 rar1 Schizosaccharomyces pombe 972h- cytoplasmic methionine-tRNA ligase Mrs1 (predicted) NP_595586.1 1407408 R 284812 CDS SPBC17A3.05c 19112379 2540130 complement(join(1411362..1412107,1412172..1412608,1412663..1412691)) 1 NC_003423.3 WARNING: does not appear to be HLJ1 which has a different domain arrangement; DNAJ/DUF1977 DNAJB12 homolog 1412691 2540130 SPBC17A3.05c Schizosaccharomyces pombe 972h- DNAJ/DUF1977 DNAJB12 homolog NP_595587.1 1411362 R 284812 CDS SPBC17A3.06 19112380 2540146 1413055..1414047 1 NC_003423.3 phosphoprotein phosphatase (predicted) 1414047 2540146 SPBC17A3.06 Schizosaccharomyces pombe 972h- phosphoprotein phosphatase (predicted) NP_595588.1 1413055 D 284812 CDS SPBC17A3.07 19112381 2540156 join(1414496..1414547,1414603..1415945) 1 NC_003423.3 glutathione reductase 1415945 pgr1 2540156 pgr1 Schizosaccharomyces pombe 972h- glutathione reductase NP_595589.1 1414496 D 284812 CDS SPBC17A3.08 19112382 2539901 join(1416265..1416296,1416351..1416544,1416720..1416918,1416984..1417261,1417325..1417560) 1 NC_003423.3 TatD homolog 1417560 2539901 SPBC17A3.08 Schizosaccharomyces pombe 972h- TatD homolog NP_595590.1 1416265 D 284812 CDS SPBC17A3.09c 19112383 2539766 complement(1417553..1418644) 1 NC_003423.3 lipoate-protein ligase A (predicted) 1418644 2539766 SPBC17A3.09c Schizosaccharomyces pombe 972h- lipoate-protein ligase A (predicted) NP_595591.1 1417553 R 284812 CDS SPBC17A3.10 19112384 2539774 join(1418872..1418908,1418967..1419850) 1 NC_003423.3 peroxisomal ubiquitin-protein ligase E3 (predicted) 1419850 pas4 2539774 pas4 Schizosaccharomyces pombe 972h- peroxisomal ubiquitin-protein ligase E3 (predicted) NP_595592.1 1418872 D 284812 CDS SPBC691.01 162312196 3361262 join(1420542..1420671,1420752..1420802,1420855..1420950,1421012..1421168,1421230..1421391,1421441..1421783) 1 NC_003423.3 palmitoyltransferase (predicted) 1421783 3361262 SPBC691.01 Schizosaccharomyces pombe 972h- palmitoyltransferase (predicted) NP_001018794.2 1420542 D 284812 CDS SPBC691.02c 19112386 2541081 complement(1421873..1423909) 1 NC_003423.3 RINT1 family protein 1423909 2541081 SPBC691.02c Schizosaccharomyces pombe 972h- RINT1 family protein NP_595594.1 1421873 R 284812 CDS SPBC691.03c 19112387 2541162 complement(1424670..1427306) 1 NC_003423.3 AP-2 adaptor complex subunit Alp3 (predicted) 1427306 apl3 2541162 apl3 Schizosaccharomyces pombe 972h- AP-2 adaptor complex subunit Alp3 (predicted) NP_595595.1 1424670 R 284812 CDS SPBC691.04 19112388 2541136 1428789..1430396 1 NC_003423.3 mitochondrial ATP-dependent RNA helicase Mss116 (predicted) 1430396 2541136 SPBC691.04 Schizosaccharomyces pombe 972h- mitochondrial ATP-dependent RNA helicase Mss116 (predicted) NP_595596.1 1428789 D 284812 CDS SPBC691.05c 162312198 2541167 complement(join(1430755..1432230,1432360..1432890)) 1 NC_003423.3 membrane transporter (predicted) 1432890 2541167 SPBC691.05c Schizosaccharomyces pombe 972h- membrane transporter (predicted) XP_001713130.1 1430755 R 284812 CDS SPBP22H7.02c 19112391 2541303 complement(1433412..1435913) 1 NC_003423.3 RNA-binding protein Mrd1 (predicted) 1435913 2541303 SPBP22H7.02c Schizosaccharomyces pombe 972h- RNA-binding protein Mrd1 (predicted) NP_595599.1 1433412 R 284812 CDS SPBP22H7.03 19112392 2541307 1436278..1436823 1 NC_003423.3 sequence orphan 1436823 2541307 SPBP22H7.03 Schizosaccharomyces pombe 972h- sequence orphan NP_595600.1 1436278 D 284812 CDS SPBP22H7.04 19112393 2541308 1438067..1438834 1 NC_003423.3 sequence orphan 1438834 2541308 SPBP22H7.04 Schizosaccharomyces pombe 972h- sequence orphan NP_595601.1 1438067 D 284812 CDS SPBP22H7.05c 19112394 2541287 complement(1438967..1442572) 1 NC_003423.3 ATPase with bromodomain protein 1442572 2541287 SPBP22H7.05c Schizosaccharomyces pombe 972h- ATPase with bromodomain protein NP_595602.1 1438967 R 284812 CDS SPBP22H7.06 19112395 2541315 join(1444565..1444596,1444651..1444675,1444778..1444846,1445021..1445387,1445474..1445673) 1 NC_003423.3 uridine kinase PRINTS false positive; nicotinamide riboside kinase (predicted) 1445673 2541315 SPBP22H7.06 Schizosaccharomyces pombe 972h- nicotinamide riboside kinase (predicted) NP_595603.1 1444565 D 284812 CDS SPBP22H7.07 19112396 3361260 1446112..1447533 1 NC_003423.3 WD repeat protein Prp5 1447533 prp5 3361260 prp5 Schizosaccharomyces pombe 972h- WD repeat protein Prp5 NP_595604.1 1446112 D 284812 CDS SPBP22H7.08 19112397 3361259 join(1448008..1448083,1448132..1448499) 1 NC_003423.3 40S ribosomal protein S10 1448499 rps1002 3361259 rps1002 Schizosaccharomyces pombe 972h- 40S ribosomal protein S10 NP_595605.1 1448008 D 284812 CDS SPBP22H7.09c 162312200 2541321 complement(join(1448815..1449374,1449428..1449790,1449849..1450155)) 1 NC_003423.3 updated sequence coordinates; db_xref=PMID:15369671; date=20070105; kinetochore protein Mis15 1450155 mis15 2541321 mis15 Schizosaccharomyces pombe 972h- kinetochore protein Mis15 XP_001713131.1 1448815 R 284812 CDS SPBC32H8.01c 19112399 2540089 complement(join(1450371..1450794,1450887..1450936,1451015..1451104)) 1 NC_003423.3 conserved fungal protein 1451104 2540089 SPBC32H8.01c Schizosaccharomyces pombe 972h- conserved fungal protein NP_595607.1 1450371 R 284812 CDS SPBC32H8.02c 19112400 2540263 complement(1452187..1453434) 1 NC_003423.3 NEDD8 protease Nep2 1453434 nep2 2540263 nep2 Schizosaccharomyces pombe 972h- NEDD8 protease Nep2 NP_595608.1 1452187 R 284812 CDS SPBC32H8.03 19112401 2540264 1457664..1458563 1 NC_003423.3 esterase/lipase (predicted) 1458563 bem46 2540264 bem46 Schizosaccharomyces pombe 972h- esterase/lipase (predicted) NP_595609.1 1457664 D 284812 CDS SPBC32H8.04c 19112402 2540218 complement(join(1459352..1459793,1459848..1459984)) 1 NC_003423.3 rRNA processing protein Fcf1 (predicted) 1459984 2540218 SPBC32H8.04c Schizosaccharomyces pombe 972h- rRNA processing protein Fcf1 (predicted) NP_595610.1 1459352 R 284812 CDS SPBC32H8.05 19112403 2540087 join(1460575..1460622,1460762..1461067) 1 NC_003423.3 conserved fungal protein 1461067 2540087 SPBC32H8.05 Schizosaccharomyces pombe 972h- conserved fungal protein NP_595611.1 1460575 D 284812 CDS SPBC32H8.06 19112404 2540224 join(1461719..1461775,1461835..1461944,1462099..1463083) 1 NC_003423.3 TPR repeat protein, meiotically spliced 1463083 mug93 2540224 mug93 Schizosaccharomyces pombe 972h- TPR repeat protein, meiotically spliced NP_595612.1 1461719 D 284812 CDS SPBC32H8.07 19112405 2539974 1464326..1465243 1 NC_003423.3 glucose insensitive transcription; heterotrimeric G protein beta subunit Git5 1465243 git5 2539974 git5 Schizosaccharomyces pombe 972h- heterotrimeric G protein beta subunit Git5 NP_595613.1 1464326 D 284812 CDS SPBC32H8.08c 295442830 2540226 complement(join(1465811..1466035,1466138..1467057,1467311..1467431)) 1 NC_003423.3 mannosyltransferase complex subunit (predicted) 1467431 2540226 SPBC32H8.08c Schizosaccharomyces pombe 972h- mannosyltransferase complex subunit (predicted) NP_595614.2 1465811 R 284812 CDS SPBC32H8.09 19112407 2540228 join(1468525..1468887,1468960..1469035,1469075..1470087) 1 NC_003423.3 WD repeat protein, human WDR8 family 1470087 2540228 SPBC32H8.09 Schizosaccharomyces pombe 972h- WD repeat protein, human WDR8 family NP_595615.1 1468525 D 284812 CDS SPBC32H8.10 19112408 2540239 join(1470680..1470822,1470874..1470955,1471076..1472626) 1 NC_003423.3 P-TEFb-associated cyclin-dependent protein kinase Cdk9 1472626 cdk9 2540239 cdk9 Schizosaccharomyces pombe 972h- P-TEFb-associated cyclin-dependent protein kinase Cdk9 NP_595616.1 1470680 D 284812 CDS SPBC32H8.11 19112409 2540241 1473194..1474747 1 NC_003423.3 meiotic forkhead transcription factor Mei4 1474747 mei4 2540241 mei4 Schizosaccharomyces pombe 972h- meiotic forkhead transcription factor Mei4 NP_595617.1 1473194 D 284812 CDS SPBC32H8.12c 19112410 2540051 complement(1476149..1477276) 1 NC_003423.3 actin Act1 1477276 act1 2540051 act1 Schizosaccharomyces pombe 972h- actin Act1 NP_595618.1 1476149 R 284812 CDS SPBC32H8.13c 19112411 2540243 complement(1478104..1485162) 1 NC_003423.3 alpha-1,3-glucan synthase Mok12 1485162 mok12 2540243 mok12 Schizosaccharomyces pombe 972h- alpha-1,3-glucan synthase Mok12 NP_595619.1 1478104 R 284812 CDS SPBC11B10.01 63054730 2539854 join(1486152..1486236,1486284..1486400,1486472..1486925,1487059..1487938) 1 NC_003423.3 mannosyltransferase complex subunit Alg2 (predicted) 1487938 alg2 2539854 alg2 Schizosaccharomyces pombe 972h- mannosyltransferase complex subunit Alg2 (predicted) NP_595621.2 1486152 D 284812 CDS SPBC11B10.02c 19112414 2539698 complement(join(1488211..1488673,1488733..1489344,1489530..1489541,1489597..1489664)) 1 NC_003423.3 histidinol-phosphate aminotransferase imidazole acetol phosphate transaminase His3 1489664 his3 2539698 his3 Schizosaccharomyces pombe 972h- histidinol-phosphate aminotransferase imidazole acetol phosphate transaminase His3 NP_595622.1 1488211 R 284812 CDS SPBC11B10.03 295442832 2539796 1490611..1491747 1 NC_003423.3 Golgi transport complex subunit Cog8 (predicted) 1491747 cog8 2539796 cog8 Schizosaccharomyces pombe 972h- Golgi transport complex subunit Cog8 (predicted) NP_595623.2 1490611 D 284812 CDS SPBC11B10.04c 19112416 2539962 complement(1491955..1492821) 1 NC_003423.3 mitochondrial ribosomal protein subunit S28 1492821 mrps28 2539962 mrps28 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit S28 NP_595624.1 1491955 R 284812 CDS SPBC11B10.05c 19112417 2539951 complement(1493069..1494553) 1 NC_003423.3 mutant results in random septum positioning (pers. comm. S. Kaplan); random septum position protein Rsp1 1494553 rsp1 2539951 rsp1 Schizosaccharomyces pombe 972h- random septum position protein Rsp1 NP_595625.1 1493069 R 284812 CDS SPBC11B10.06 19112418 2539966 1495152..1495781 1 NC_003423.3 SWIM domain containing-Srs2 interacting protein 1 1495781 sws1 2539966 sws1 Schizosaccharomyces pombe 972h- SWIM domain containing-Srs2 interacting protein 1 NP_595626.1 1495152 D 284812 CDS SPBC11B10.07c 19112419 2539729 complement(join(1496096..1497019,1497242..1497380,1497439..1497491)) 1 NC_003423.3 CDC50 domain protein 1497491 ivn1 2539729 ivn1 Schizosaccharomyces pombe 972h- CDC50 domain protein NP_595627.1 1496096 R 284812 CDS SPBC11B10.08 19112420 2539874 1498801..1499415 1 NC_003423.3 conserved fungal protein 1499415 2539874 SPBC11B10.08 Schizosaccharomyces pombe 972h- conserved fungal protein NP_595628.1 1498801 D 284812 CDS SPBC11B10.09 19112421 2539869 join(1500340..1500376,1500445..1500613,1500686..1500986,1501088..1501393,1501448..1501528) 1 NC_003423.3 cyclin-dependent protein kinase Cdc2 1501528 cdc2 2539869 cdc2 Schizosaccharomyces pombe 972h- cyclin-dependent protein kinase Cdc2 NP_595629.1 1500340 D 284812 CDS SPBC11B10.10c 295442834 2539668 complement(1502642..1503064) 1 NC_003423.3 histone H2A variant Pht1 1503064 pht1 2539668 pht1 Schizosaccharomyces pombe 972h- histone H2A variant Pht1 NP_595630.2 1502642 R 284812 CDS SPBC1215.01 19112423 2540192 join(1505418..1505677,1505761..1506373) 1 NC_003423.3 SURF-family protein Shy1 1506373 shy1 2540192 shy1 Schizosaccharomyces pombe 972h- SURF-family protein Shy1 NP_595631.1 1505418 D 284812 CDS SPBC1215.02c 19112424 2540082 complement(join(1506412..1506519,1506580..1506798,1506870..1507988,1508028..1508289,1508330..1508766,1508806..1508924,1509168..1509306,1509351..1509383)) 1 NC_003423.3 NatB N-acetyltransferase complex non catalytic subunit Arm1 1509383 arm1 2540082 arm1 Schizosaccharomyces pombe 972h- NatB N-acetyltransferase complex non catalytic subunit Arm1 NP_595632.1 1506412 R 284812 CDS SPBC83.01 19112425 2540786 join(1510581..1510730,1510881..1511004,1511050..1513430) 1 NC_003423.3 overlaps at C terminal with opposite strand orf SPBC83.02c; UBA/EH/EF hand domain protein Ucp8 1513430 ucp8 2540786 ucp8 Schizosaccharomyces pombe 972h- UBA/EH/EF hand domain protein Ucp8 NP_595633.1 1510581 D 284812 CDS SPBC83.02c 19112426 2540665 complement(join(1513393..1513520,1513583..1513739)) 1 NC_003423.3 overlaps at C terminal with opposite strand orf SPBC83.01; 60S ribosomal protein L37a 1513739 rpl4302 2540665 rpl4302 Schizosaccharomyces pombe 972h- 60S ribosomal protein L37a NP_595634.1 1513393 R 284812 CDS SPBC83.03c 19112427 2540735 complement(1514479..1516128) 1 NC_003423.3 RITS complex subunit 3 1516128 tas3 2540735 tas3 Schizosaccharomyces pombe 972h- RITS complex subunit 3 NP_595635.1 1514479 R 284812 CDS SPBC83.04 19112428 2540655 join(1516727..1516834,1516902..1517204) 1 NC_003423.3 anaphase-promoting complex subunit Apc15 1517204 apc15 2540655 apc15 Schizosaccharomyces pombe 972h- anaphase-promoting complex subunit Apc15 NP_595636.1 1516727 D 284812 CDS SPBC83.05 19112429 2540741 1517668..1519989 1 NC_003423.3 mitochondrial RNA-binding protein (predicted) 1519989 2540741 SPBC83.05 Schizosaccharomyces pombe 972h- mitochondrial RNA-binding protein (predicted) NP_595637.1 1517668 D 284812 CDS SPBC83.06c 19112430 2540781 complement(1520212..1520391) 1 NC_003423.3 mitochondrial ribosomal protein subunit L36, Rtc6 1520391 2540781 SPBC83.06c Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit L36, Rtc6 NP_595638.1 1520212 R 284812 CDS SPBC83.07 19112431 2540780 join(1521271..1521387,1521444..1523585) 1 NC_003423.3 Lid2 complex subunit Jmj3 1523585 jmj3 2540780 jmj3 Schizosaccharomyces pombe 972h- Lid2 complex subunit Jmj3 NP_595639.1 1521271 D 284812 CDS SPBC83.08 19112432 2541077 join(1524007..1524055,1524157..1525505) 1 NC_003423.3 AAA family ATPase Rvb2 1525505 rvb2 2541077 rvb2 Schizosaccharomyces pombe 972h- AAA family ATPase Rvb2 NP_595640.1 1524007 D 284812 CDS SPBC83.09c 19112433 2541061 complement(join(1525693..1526801,1526848..1526965)) 1 NC_003423.3 GYF domain 1526965 2541061 SPBC83.09c Schizosaccharomyces pombe 972h- GYF domain NP_595641.1 1525693 R 284812 CDS SPBC83.10 19112434 2540754 1527906..1528475 1 NC_003423.3 human c15orf24 ortholog 1528475 2540754 SPBC83.10 Schizosaccharomyces pombe 972h- human c15orf24 ortholog NP_595642.1 1527906 D 284812 CDS SPBC83.11 19112435 2541008 join(1529291..1529340,1529377..1530631) 1 NC_003423.3 triose phosphate transporter 1530631 2541008 SPBC83.11 Schizosaccharomyces pombe 972h- triose phosphate transporter NP_595643.1 1529291 D 284812 CDS SPBC83.12 19112436 2540549 1532018..1532503 1 NC_003423.3 sequence orphan 1532503 2540549 SPBC83.12 Schizosaccharomyces pombe 972h- sequence orphan NP_595644.1 1532018 D 284812 CDS SPBC83.13 19112437 2540216 1533303..1534184 1 NC_003423.3 mitochondrial tricarboxylic acid transporter 1534184 2540216 SPBC83.13 Schizosaccharomyces pombe 972h- mitochondrial tricarboxylic acid transporter NP_595645.1 1533303 D 284812 CDS SPBC83.14c 19112438 2540215 complement(join(1534776..1535464,1535607..1535799,1535861..1536055)) 1 NC_003423.3 DNA replication factor C complex subunit Rfc5 (predicted) 1536055 rfc5 2540215 rfc5 Schizosaccharomyces pombe 972h- DNA replication factor C complex subunit Rfc5 (predicted) NP_595646.1 1534776 R 284812 CDS SPBC83.15 19112439 2541163 join(1536899..1536938,1536988..1537106,1537267..1537806,1537868..1537965,1538088..1538454) 1 NC_003423.3 ribosome biogenesis protein Nsa1 1538454 2541163 SPBC83.15 Schizosaccharomyces pombe 972h- ribosome biogenesis protein Nsa1 NP_595647.1 1536899 D 284812 CDS SPBC83.16c 19112440 2541188 complement(1538801..1540492) 1 NC_003423.3 conserved eukaryotic protein 1540492 2541188 SPBC83.16c Schizosaccharomyces pombe 972h- conserved eukaryotic protein NP_595648.1 1538801 R 284812 CDS SPBC83.19c 19112441 2541196 complement(1541452..1541811) 1 NC_003423.3 previously annotated as dubious, but has localization signal; sequence orphan 1541811 2541196 SPBC83.19c Schizosaccharomyces pombe 972h- sequence orphan NP_595649.1 1541452 R 284812 CDS SPBC83.17 19112442 2541192 1542599..1543045 1 NC_003423.3 transcriptional coactivator, multiprotein bridging factor Mbf1 (predicted) 1543045 2541192 SPBC83.17 Schizosaccharomyces pombe 972h- transcriptional coactivator, multiprotein bridging factor Mbf1 (predicted) NP_595650.1 1542599 D 284812 CDS SPBC83.18c 19112443 2541203 complement(join(1543895..1544665,1544719..1544766)) 1 NC_003423.3 C2 domain protein Fic1 1544766 fic1 2541203 fic1 Schizosaccharomyces pombe 972h- C2 domain protein Fic1 NP_595651.1 1543895 R 284812 CDS SPBC29B5.01 19112444 2540329 1547661..1549361 1 NC_003423.3 target for the Sty1p stress-activated MAP kinase pathway (PMID 882458); transcription factor Atf1 1549361 atf1 2540329 atf1 Schizosaccharomyces pombe 972h- transcription factor Atf1 NP_595652.1 1547661 D 284812 CDS SPBC29B5.02c 19112445 2540364 complement(1550434..1552791) 1 NC_003423.3 OPT oligopeptide transporter family 1552791 isp4 2540364 isp4 Schizosaccharomyces pombe 972h- OPT oligopeptide transporter family NP_595653.1 1550434 R 284812 CDS SPBC29B5.03c 19112446 2540274 complement(1558240..1558620) 1 NC_003423.3 60S ribosomal protein L26 1558620 rpl26 2540274 rpl26 Schizosaccharomyces pombe 972h- 60S ribosomal protein L26 NP_595654.1 1558240 R 284812 CDS SPBC29B5.04c 19112447 2540310 complement(1559305..1561122) 1 NC_003423.3 actin cortical patch protein 1561122 2540310 SPBC29B5.04c Schizosaccharomyces pombe 972h- actin cortical patch protein NP_595655.1 1559305 R 284812 CDS SPBC27.01c 19112448 2540586 complement(1561637..1562035) 1 NC_003423.3 secretory pathway protein Pga2 (predicted) 1562035 2540586 SPBC27.01c Schizosaccharomyces pombe 972h- secretory pathway protein Pga2 (predicted) NP_595656.1 1561637 R 284812 CDS SPBC27.02c 19112449 2540498 complement(join(1562508..1563266,1563345..1563492,1563548..1563564)) 1 NC_003423.3 DASH complex subunit Ask1 1563564 ask1 2540498 ask1 Schizosaccharomyces pombe 972h- DASH complex subunit Ask1 NP_595657.1 1562508 R 284812 CDS SPBC27.03 19112450 2540454 1563902..1565770 1 NC_003423.3 sequence orphan 1565770 meu25 2540454 meu25 Schizosaccharomyces pombe 972h- sequence orphan NP_595658.1 1563902 D 284812 CDS SPBC27.04 19112451 2540497 1566403..1569561 1 NC_003423.3 was annotated in error as ortholog of S. cerevisiae YNL250W, annotation removed 19.1.2005; sequence orphan 1569561 2540497 SPBC27.04 Schizosaccharomyces pombe 972h- sequence orphan NP_595659.1 1566403 D 284812 CDS SPBC27.05 19112452 2540418 1569746..1570072 1 NC_003423.3 has transcript profile on microarray but this is co- transcribed with SPBC27.04 (pers. comm. T. Toda); no localization from ORFeome project (Matsuyama et al); strange TMM prediction spatial context; dubious 1570072 2540418 SPBC27.05 Schizosaccharomyces pombe 972h- dubious NP_595660.1 1569746 D 284812 CDS SPBC27.06c 19112453 2540425 complement(join(1570447..1570775,1570819..1570852)) 1 NC_003423.3 mitochondrial membrane protein Mgr2 (predicted) 1570852 mgr2 2540425 mgr2 Schizosaccharomyces pombe 972h- mitochondrial membrane protein Mgr2 (predicted) NP_595661.1 1570447 R 284812 CDS SPBC27.08c 162312202 2540422 complement(1571485..1572957) 1 NC_003423.3 does not have adenylylsulfate kinase activity; sulfate adenylyltransferase 1572957 sua1 2540422 sua1 Schizosaccharomyces pombe 972h- sulfate adenylyltransferase NP_595662.2 1571485 R 284812 CDS SPBC28F2.02 19112455 2540400 1574527..1575405 1 NC_003423.3 mRNA export protein Mep33 1575405 mep33 2540400 mep33 Schizosaccharomyces pombe 972h- mRNA export protein Mep33 NP_595663.1 1574527 D 284812 CDS SPBC28F2.03 19112456 2540269 1576329..1576817 1 NC_003423.3 cyp2 in PMID 11690648 is SPAC57A10.03 cyp1; cyclophilin family peptidyl-prolyl cis-trans isomerase Cyp2 1576817 ppi1 2540269 ppi1 Schizosaccharomyces pombe 972h- cyclophilin family peptidyl-prolyl cis-trans isomerase Cyp2 NP_595664.1 1576329 D 284812 CDS SPBC28F2.04c 19112457 2540585 complement(join(1577407..1577936,1577976..1578009)) 1 NC_003423.3 splicing factor Cwf7 1578009 cwf7 2540585 cwf7 Schizosaccharomyces pombe 972h- splicing factor Cwf7 NP_595665.1 1577407 R 284812 CDS SPBC28F2.05c 19112458 2540561 complement(1578175..1579005) 1 NC_003423.3 xylose and arabinose reductase (predicted) 1579005 2540561 SPBC28F2.05c Schizosaccharomyces pombe 972h- xylose and arabinose reductase (predicted) NP_595666.1 1578175 R 284812 CDS SPBC28F2.06c 19112459 2540562 complement(1579127..1579948) 1 NC_003423.3 Mdm10/Mdm12/Mmm1 complex subunit Mdm12 1579948 mdm12 2540562 mdm12 Schizosaccharomyces pombe 972h- Mdm10/Mdm12/Mmm1 complex subunit Mdm12 NP_595667.1 1579127 R 284812 CDS SPBC28F2.07 19112460 2540584 1580688..1581587 1 NC_003423.3 Swi five-dependent recombination repair protein Sfr1 1581587 sfr1 2540584 sfr1 Schizosaccharomyces pombe 972h- Swi five-dependent recombination repair protein Sfr1 NP_595668.1 1580688 D 284812 CDS SPBC28F2.08c 19112461 2540568 complement(1582103..1584244) 1 NC_003423.3 WARNING ignore cis trans isomerase ISP4; HRD ubiquitin ligase complex subunit (predicted) 1584244 2540568 SPBC28F2.08c Schizosaccharomyces pombe 972h- HRD ubiquitin ligase complex subunit (predicted) NP_595669.1 1582103 R 284812 CDS SPBC28F2.09 19112462 2540632 join(1585222..1585239,1585285..1585386,1585428..1586417) 1 NC_003423.3 transcription factor TFIIA complex large subunit (predicted) 1586417 2540632 SPBC28F2.09 Schizosaccharomyces pombe 972h- transcription factor TFIIA complex large subunit (predicted) NP_595670.1 1585222 D 284812 CDS SPBC28F2.10c 19112463 2540436 complement(1586687..1588342) 1 NC_003423.3 chromatin remodeling complex subunit Ngg1 1588342 ngg1 2540436 ngg1 Schizosaccharomyces pombe 972h- chromatin remodeling complex subunit Ngg1 NP_595671.1 1586687 R 284812 CDS SPBC28F2.11 19112464 2540337 join(1589359..1589388,1589581..1590483) 1 NC_003423.3 HMG box protein 1590483 2540337 SPBC28F2.11 Schizosaccharomyces pombe 972h- HMG box protein NP_595672.1 1589359 D 284812 CDS SPBC28F2.12 19112465 2540292 join(1591154..1591168,1591204..1591229,1591270..1591342,1591382..1591457,1591503..1591562,1591655..1591761,1591809..1596710) 1 NC_003423.3 RNA polymerase II large subunit Rpb1 1596710 rpb1 2540292 rpb1 Schizosaccharomyces pombe 972h- RNA polymerase II large subunit Rpb1 NP_595673.1 1591154 D 284812 CDS SPBC21B10.13c 19112466 2540309 1648235..1648840 1 NC_003423.3 transcription factor, homeobox type Yox1 (predicted) 1648840 yox1 2540309 yox1 Schizosaccharomyces pombe 972h- transcription factor, homeobox type Yox1 (predicted) NP_595674.1 1648235 D 284812 CDS SPBC21B10.12 19112467 2540588 complement(join(1649038..1649472,1649558..1649671)) 1 NC_003423.3 meiotic recombination protein Rec6 1649671 rec6 2540588 rec6 Schizosaccharomyces pombe 972h- meiotic recombination protein Rec6 NP_595675.1 1649038 R 284812 CDS SPBC21B10.11 19112468 2540708 complement(join(1650289..1650447,1650491..1650550)) 1 NC_003423.3 dolichol-phosphate mannosyltransferase subunit 2 (predicted) 1650550 dpm2 2540708 dpm2 Schizosaccharomyces pombe 972h- dolichol-phosphate mannosyltransferase subunit 2 (predicted) NP_595676.1 1650289 R 284812 CDS SPBC21B10.10 19112469 2540325 complement(1651022..1651810) 1 NC_003423.3 40S ribosomal protein S4 1651810 rps402 2540325 rps402 Schizosaccharomyces pombe 972h- 40S ribosomal protein S4 NP_595677.1 1651022 R 284812 CDS SPBC21B10.09 19112470 2540573 complement(join(1652519..1652836,1652883..1653292,1653337..1653993,1654101..1654275)) 1 NC_003423.3 acetyl-CoA transporter (predicted) 1654275 2540573 SPBC21B10.09 Schizosaccharomyces pombe 972h- acetyl-CoA transporter (predicted) NP_595678.1 1652519 R 284812 CDS SPBC21B10.08c 19112471 2540524 join(1655946..1656014,1656250..1656777) 1 NC_003423.3 sequence orphan 1656777 2540524 SPBC21B10.08c Schizosaccharomyces pombe 972h- sequence orphan NP_595679.1 1655946 D 284812 CDS SPBC21B10.07 19112472 2540333 complement(1657186..1658445) 1 NC_003423.3 glycosyl hydrolase family 16 1658445 2540333 SPBC21B10.07 Schizosaccharomyces pombe 972h- glycosyl hydrolase family 16 NP_595680.1 1657186 R 284812 CDS SPBC21B10.06c 19112473 2540592 join(1660863..1660893,1660954..1661066,1661121..1662389) 1 NC_003423.3 sequence orphan 1662389 2540592 SPBC21B10.06c Schizosaccharomyces pombe 972h- sequence orphan NP_595681.1 1660863 D 284812 CDS SPBC21B10.05c 19112474 2540645 1662947..1663891 1 NC_003423.3 WD repeat protein Pop3 1663891 pop3 2540645 pop3 Schizosaccharomyces pombe 972h- WD repeat protein Pop3 NP_595682.1 1662947 D 284812 CDS SPBC21B10.04c 19112475 2540771 1664582..1664950 1 NC_003423.3 GTPase regulator Nrf1 (predicted) 1664950 nrf1 2540771 nrf1 Schizosaccharomyces pombe 972h- GTPase regulator Nrf1 (predicted) NP_595683.1 1664582 D 284812 CDS SPBC21B10.03c 19112476 2540677 1667059..1669434 1 NC_003423.3 ataxin-2 homolog 1669434 2540677 SPBC21B10.03c Schizosaccharomyces pombe 972h- ataxin-2 homolog NP_595684.1 1667059 D 284812 CDS SPBC21B10.02 295442836 2540722 complement(1669719..1670144) 1 NC_003423.3 sequence orphan 1670144 2540722 SPBC21B10.02 Schizosaccharomyces pombe 972h- sequence orphan NP_595685.2 1669719 R 284812 CDS SPBC19C2.01 162312204 2540707 1670582..1673749 1 NC_003423.3 ATP-dependent RNA helicase Cdc28 1673749 cdc28 2540707 cdc28 Schizosaccharomyces pombe 972h- ATP-dependent RNA helicase Cdc28 NP_595686.2 1670582 D 284812 CDS SPBC19C2.02 19112479 2540766 join(1674066..1674233,1674278..1675102) 1 NC_003423.3 DNA methyltransferase homolog 1675102 pmt1 2540766 pmt1 Schizosaccharomyces pombe 972h- DNA methyltransferase homolog NP_595687.1 1674066 D 284812 CDS SPBC19C2.03 19112480 2540793 join(1675735..1675810,1675864..1675979) 1 NC_003423.3 DNA-directed RNA polymerase I, II and III subunit Rpc10 1675979 rpc10 2540793 rpc10 Schizosaccharomyces pombe 972h- DNA-directed RNA polymerase I, II and III subunit Rpc10 NP_595688.1 1675735 D 284812 CDS SPBC19C2.04c 19112481 2540714 complement(1676524..1677576) 1 NC_003423.3 ubiquitin C-terminal hydrolase Ubp11 1677576 ubp11 2540714 ubp11 Schizosaccharomyces pombe 972h- ubiquitin C-terminal hydrolase Ubp11 NP_595689.1 1676524 R 284812 CDS SPBC19C2.05 19112482 2540580 1682861..1684273 1 NC_003423.3 YDR247C is more divergent; serine/threonine protein kinase Ran1 1684273 ran1 2540580 ran1 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Ran1 NP_595690.1 1682861 D 284812 CDS SPBC19C2.06c 19112483 2540789 complement(1686768..1687205) 1 NC_003423.3 sequence orphan 1687205 mug124 2540789 mug124 Schizosaccharomyces pombe 972h- sequence orphan NP_595691.1 1686768 R 284812 CDS SPBC19C2.07 19112484 2540767 1688367..1689443 1 NC_003423.3 fructose-bisphosphate aldolase Fba1 1689443 fba1 2540767 fba1 Schizosaccharomyces pombe 972h- fructose-bisphosphate aldolase Fba1 NP_595692.1 1688367 D 284812 CDS SPBC19C2.08 19112485 2540453 join(1690148..1690289,1690488..1690978) 1 NC_003423.3 U4/U6 x U5 tri-snRNP complex subunit Prp38 (predicted) 1690978 prp38 2540453 prp38 Schizosaccharomyces pombe 972h- U4/U6 x U5 tri-snRNP complex subunit Prp38 (predicted) NP_595693.1 1690148 D 284812 CDS SPBC19C2.09 19112486 2540730 1691828..1694530 1 NC_003423.3 sterol regulatory element binding protein, transcription factor Sre1 1694530 sre1 2540730 sre1 Schizosaccharomyces pombe 972h- sterol regulatory element binding protein, transcription factor Sre1 NP_595694.1 1691828 D 284812 CDS SPBC19C2.10 19112487 2540758 join(1695221..1695808,1695924..1696841) 1 NC_003423.3 BAR adaptor protein 1696841 2540758 SPBC19C2.10 Schizosaccharomyces pombe 972h- BAR adaptor protein NP_595695.1 1695221 D 284812 CDS SPBC19C2.11c 19112488 2540388 complement(1697735..1699093) 1 NC_003423.3 mitochondrial outer membrane protein (predicted) 1699093 2540388 SPBC19C2.11c Schizosaccharomyces pombe 972h- mitochondrial outer membrane protein (predicted) NP_595696.1 1697735 R 284812 CDS SPBC19C2.12 19112489 2540785 join(1700082..1700147,1700239..1700401,1700498..1700706) 1 NC_003423.3 mitochondrial ribosomal protein subunit L51 1700706 mrpl51 2540785 mrpl51 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit L51 NP_595697.1 1700082 D 284812 CDS SPBC19C2.13c 19112490 2540896 complement(1700873..1701973) 1 NC_003423.3 cytosolic thiouridylase subunit Ctu2 1701973 ctu2 2540896 ctu2 Schizosaccharomyces pombe 972h- cytosolic thiouridylase subunit Ctu2 NP_595698.1 1700873 R 284812 CDS SPBC19C2.14 19112491 2540884 join(1702182..1702218,1702264..1702323,1702379..1702508,1702562..1702628) 1 NC_003423.3 Sm snRNP core protein Smd3 1702628 smd3 2540884 smd3 Schizosaccharomyces pombe 972h- Sm snRNP core protein Smd3 NP_595699.1 1702182 D 284812 CDS SPBC19C2.15c 19112492 2540685 complement(join(1703036..1703112,1703165..1703701,1703752..1703764)) 1 NC_003423.3 phosphoprotein phosphatase (predicted) 1703764 2540685 SPBC19C2.15c Schizosaccharomyces pombe 972h- phosphoprotein phosphatase (predicted) NP_595700.1 1703036 R 284812 CDS SPBC2F12.15c 19112493 2540463 join(1704401..1704628,1704701..1705462) 1 NC_003423.3 palmitoyltransferase (predicted) 1705462 2540463 SPBC2F12.15c Schizosaccharomyces pombe 972h- palmitoyltransferase (predicted) NP_595701.1 1704401 D 284812 CDS SPBC2F12.14c 19112494 2540315 join(1706975..1707431,1707764..1708881) 1 NC_003423.3 IMP dehydrogenase Gua1 (predicted) 1708881 gua1 2540315 gua1 Schizosaccharomyces pombe 972h- IMP dehydrogenase Gua1 (predicted) NP_595702.1 1706975 D 284812 CDS SPBC2F12.13 19112495 2540361 complement(join(1709214..1711834,1711891..1711921)) 1 NC_003423.3 kinesin-like protein Klp5 1711921 klp5 2540361 klp5 Schizosaccharomyces pombe 972h- kinesin-like protein Klp5 NP_595703.1 1709214 R 284812 CDS SPBC2F12.12c 19112496 2540353 join(1713103..1713228,1713275..1713526,1713582..1713674,1713721..1714173,1714257..1714886) 1 NC_003423.3 human c19orf29 ortholog 1714886 2540353 SPBC2F12.12c Schizosaccharomyces pombe 972h- human c19orf29 ortholog NP_595704.1 1713103 D 284812 CDS SPBC2F12.11c 19112497 2540341 1718224..1718883 1 NC_003423.3 transcriptional activator, MBF subunit Rep2 1718883 rep2 2540341 rep2 Schizosaccharomyces pombe 972h- transcriptional activator, MBF subunit Rep2 NP_595705.1 1718224 D 284812 CDS SPBC2F12.10 19112498 2540365 complement(1719551..1720663) 1 NC_003423.3 mitochondrial ribosomal protein subunit L35 1720663 2540365 SPBC2F12.10 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit L35 NP_595706.1 1719551 R 284812 CDS SPBC2F12.09c 19112499 2540363 1723013..1724080 1 NC_003423.3 transcription factor Atf21 1724080 atf21 2540363 atf21 Schizosaccharomyces pombe 972h- transcription factor Atf21 NP_595707.1 1723013 D 284812 CDS SPBC2F12.08c 19112500 2540362 1724847..1726055 1 NC_003423.3 mRNA guanylyltransferase Ceg1 1726055 ceg1 2540362 ceg1 Schizosaccharomyces pombe 972h- mRNA guanylyltransferase Ceg1 NP_595708.1 1724847 D 284812 CDS SPBC2F12.07c 19112501 2540366 1726677..1727438 1 NC_003423.3 60S ribosomal protein L8 1727438 rpl802 2540366 rpl802 Schizosaccharomyces pombe 972h- 60S ribosomal protein L8 NP_595709.1 1726677 D 284812 CDS SPBC2F12.05c 19112502 2540357 join(1728834..1728891,1728957..1728998,1729060..1729232,1729478..1733137) 1 NC_003423.3 sterol binding ankyrin repeat protein 1733137 2540357 SPBC2F12.05c Schizosaccharomyces pombe 972h- sterol binding ankyrin repeat protein NP_595710.1 1728834 D 284812 CDS SPBC2F12.04 19112503 2540358 complement(1733420..1733983) 1 NC_003423.3 60S ribosomal protein L17 1733983 rpl1701 2540358 rpl1701 Schizosaccharomyces pombe 972h- 60S ribosomal protein L17 NP_595711.1 1733420 R 284812 CDS SPBC2F12.03c 19112504 2540346 1734354..1737029 1 NC_003423.3 putative in-frame splice between codons 689 and 760; EST1 family protein 1737029 2540346 SPBC2F12.03c Schizosaccharomyces pombe 972h- EST1 family protein NP_595712.1 1734354 D 284812 CDS SPBC2F12.02c 19112505 2540459 1738978..1739841 1 NC_003423.3 mitochondrial ribosomal protein subunit L7 1739841 mrpl7 2540459 mrpl7 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit L7 NP_595713.1 1738978 D 284812 CDS SPBC1D7.05 162312206 2540612 complement(1740317..1742296) 1 NC_003423.3 MAP kinase kinase kinase Byr2 1742296 byr2 2540612 byr2 Schizosaccharomyces pombe 972h- MAP kinase kinase kinase Byr2 NP_595714.2 1740317 R 284812 CDS SPBC1D7.04 19112507 2540565 complement(1744113..1744712) 1 NC_003423.3 RNA annealing factor Mlo3 1744712 mlo3 2540565 mlo3 Schizosaccharomyces pombe 972h- RNA annealing factor Mlo3 NP_595715.1 1744113 R 284812 CDS SPBC1D7.03 19112508 2540673 complement(1746041..1747426) 1 NC_003423.3 cyclin Clg1 (predicted) 1747426 mug80 2540673 mug80 Schizosaccharomyces pombe 972h- cyclin Clg1 (predicted) NP_595716.1 1746041 R 284812 CDS SPBC1D7.02c 19112509 2540768 1753589..1755286 1 NC_003423.3 transcription factor Scr1 1755286 scr1 2540768 scr1 Schizosaccharomyces pombe 972h- transcription factor Scr1 NP_595717.1 1753589 D 284812 CDS SPBC1D7.01 19112510 2540765 complement(join(1756510..1756672,1756824..1756990,1757088..1757096)) 1 NC_003423.3 prefoldin subunit 1 (predicted) 1757096 2540765 SPBC1D7.01 Schizosaccharomyces pombe 972h- prefoldin subunit 1 (predicted) NP_595718.1 1756510 R 284812 CDS SPBC11G11.01 19112511 2539939 join(1757807..1758188,1758302..1758402) 1 NC_003423.3 mitochondrial fission protein Fis1 (predicted) 1758402 fis1 2539939 fis1 Schizosaccharomyces pombe 972h- mitochondrial fission protein Fis1 (predicted) NP_595719.1 1757807 D 284812 CDS SPBC11G11.02c 19112512 2539902 complement(join(1758958..1759860,1760085..1760161,1760232..1760379)) 1 NC_003423.3 actin cortical patch component End3 (predicted) 1760379 end3 2539902 end3 Schizosaccharomyces pombe 972h- actin cortical patch component End3 (predicted) NP_595720.1 1758958 R 284812 CDS SPBC11G11.03 19112513 2539913 join(1760732..1760848,1761184..1761792) 1 NC_003423.3 ribosome assembly protein (predicted) 1761792 2539913 SPBC11G11.03 Schizosaccharomyces pombe 972h- ribosome assembly protein (predicted) NP_595721.1 1760732 D 284812 CDS SPBC11G11.04 19112514 2539833 join(1762436..1762522,1762570..1762652,1762713..1762774,1762844..1763022) 1 NC_003423.3 TRAPP complex subunit Trs20 (predicted) 1763022 trs20 2539833 trs20 Schizosaccharomyces pombe 972h- TRAPP complex subunit Trs20 (predicted) NP_595722.1 1762436 D 284812 CDS SPBC11G11.05 19112515 2539699 1763752..1764507 1 NC_003423.3 Note: overlaps SPBC11G11.06 by 4bp; DNA-directed RNA polymerase I complex subunit Rpa34 (predicted) 1764507 rpa34 2539699 rpa34 Schizosaccharomyces pombe 972h- DNA-directed RNA polymerase I complex subunit Rpa34 (predicted) NP_595723.1 1763752 D 284812 CDS SPBC11G11.06c 19112516 2539607 complement(join(1764504..1764553,1764783..1764858,1764968..1765057,1765095..1765133)) 1 NC_003423.3 Note: overlaps SPBC11G11.05 by 4bp; Sm snRNP core protein Sme1 1765133 sme1 2539607 sme1 Schizosaccharomyces pombe 972h- Sm snRNP core protein Sme1 NP_595724.1 1764504 R 284812 CDS SPBC11G11.07 63054735 2539916 join(1766151..1766249,1766301..1769069) 1 NC_003423.3 karyopherin 1769069 2539916 SPBC11G11.07 Schizosaccharomyces pombe 972h- karyopherin NP_595725.2 1766151 D 284812 CDS SPBC18H10.02 19112518 2540731 join(1770093..1770111,1770238..1772249) 1 NC_003423.3 long-chain-fatty-acid-CoA ligase Lcf1 1772249 lcf1 2540731 lcf1 Schizosaccharomyces pombe 972h- long-chain-fatty-acid-CoA ligase Lcf1 NP_595726.1 1770093 D 284812 CDS SPBC18H10.03 19112519 2540819 join(1773023..1773033,1773075..1773912) 1 NC_003423.3 translation initiation factor eIF3g 1773912 tif35 2540819 tif35 Schizosaccharomyces pombe 972h- translation initiation factor eIF3g NP_595727.1 1773023 D 284812 CDS SPBC18H10.04c 19112520 2540528 complement(join(1775489..1776549,1776714..1776804,1776846..1776856,1776894..1776897)) 1 NC_003423.3 RNA binding protein 1776897 sce3 2540528 sce3 Schizosaccharomyces pombe 972h- RNA binding protein NP_595728.1 1775489 R 284812 CDS SPBC18H10.05 19112521 2540832 1780014..1781774 1 NC_003423.3 WD repeat protein, human WDR44 family 1781774 2540832 SPBC18H10.05 Schizosaccharomyces pombe 972h- WD repeat protein, human WDR44 family NP_595729.1 1780014 D 284812 CDS SPBC18H10.06c 19112522 2540788 complement(join(1781975..1782607,1782656..1782920,1782981..1783156)) 1 NC_003423.3 S. pombe paralogues are functionally diverged, S. cerevisiae YKL018W is a member of both CPF and SET1 complex (PMID 14617822); Set1C complex subunit Swd2.1 1783156 swd2 2540788 swd2 Schizosaccharomyces pombe 972h- Set1C complex subunit Swd2.1 NP_595730.1 1781975 R 284812 CDS SPBC18H10.07 19112523 2540647 join(1783259..1783312,1783386..1784006) 1 NC_003423.3 WW domain-binding protein 4 (predicted) 1784006 2540647 SPBC18H10.07 Schizosaccharomyces pombe 972h- WW domain-binding protein 4 (predicted) NP_595731.1 1783259 D 284812 CDS SPBC18H10.08c 19112524 2540837 complement(1784219..1785535) 1 NC_003423.3 ubiquitin C-terminal hydrolase Ubp4 1785535 ubp4 2540837 ubp4 Schizosaccharomyces pombe 972h- ubiquitin C-terminal hydrolase Ubp4 NP_595732.1 1784219 R 284812 CDS SPBC18H10.09 19112525 2540839 join(1786596..1787607,1787643..1787917) 1 NC_003423.3 zf-CHY type zinc finger protein 1787917 2540839 SPBC18H10.09 Schizosaccharomyces pombe 972h- zf-CHY type zinc finger protein NP_595733.1 1786596 D 284812 CDS SPBC18H10.10c 19112526 2540801 complement(join(1788047..1788436,1788492..1788740,1788786..1789031)) 1 NC_003423.3 complexed with Cdc5 protein Cwf16 1789031 cwc16 2540801 cwc16 Schizosaccharomyces pombe 972h- complexed with Cdc5 protein Cwf16 NP_595734.1 1788047 R 284812 CDS SPBC18H10.11c 19112527 2540797 complement(1789384..1790682) 1 NC_003423.3 conserved fungal protein 1790682 2540797 SPBC18H10.11c Schizosaccharomyces pombe 972h- conserved fungal protein NP_595735.1 1789384 R 284812 CDS SPBC18H10.12c 19112528 2540841 complement(join(1791019..1791645,1792087..1792215)) 1 NC_003423.3 primary name changed 20051010, rpl702 is SPAC3H5.07; 60S ribosomal protein L7 1792215 rpl701 2540841 rpl701 Schizosaccharomyces pombe 972h- 60S ribosomal protein L7 NP_595736.1 1791019 R 284812 CDS SPBC18H10.13 19112529 5802781 1792384..1792803 1 NC_003423.3 40S ribosomal protein S14 1792803 rps1402 5802781 rps1402 Schizosaccharomyces pombe 972h- 40S ribosomal protein S14 NP_595737.1 1792384 D 284812 CDS SPBC18H10.14 19112530 2540812 join(1793947..1794321,1794493..1794540) 1 NC_003423.3 40S ribosomal protein S16 1794540 rps1601 2540812 rps1601 Schizosaccharomyces pombe 972h- 40S ribosomal protein S16 NP_595738.1 1793947 D 284812 CDS SPBC18H10.15 19112531 2540799 join(1795240..1796094,1796153..1796494) 1 NC_003423.3 serine/threonine protein kinase Ppk23 1796494 ppk23 2540799 ppk23 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Ppk23 NP_595739.1 1795240 D 284812 CDS SPBC18H10.16 19112532 2540830 join(1797014..1798754,1798801..1800212) 1 NC_003423.3 identification of SPBC18H10.16 as can1, pers. comm. Charlie Hoffman; arginine transporter Can1 1800212 can1 2540830 can1 Schizosaccharomyces pombe 972h- arginine transporter Can1 NP_595740.1 1797014 D 284812 CDS SPBC18H10.17c 19112533 2540835 complement(1800731..1801258) 1 NC_003423.3 mitochondrial protein Mhr1 (predicted) 1801258 2540835 SPBC18H10.17c Schizosaccharomyces pombe 972h- mitochondrial protein Mhr1 (predicted) NP_595741.1 1800731 R 284812 CDS SPBC18H10.18c 63054736 2540834 complement(join(1802356..1802693,1802739..1803129)) 1 NC_003423.3 sequence orphan 1803129 2540834 SPBC18H10.18c Schizosaccharomyces pombe 972h- sequence orphan NP_595742.2 1802356 R 284812 CDS SPBC18H10.19 19112535 2540836 1807057..1807980 1 NC_003423.3 this looks like it could have a few N-terminal exons, but can't make a gene structure, perhaps has a sequencing error?; human UVRAG (UV radiation resistance) homolog 1807980 2540836 SPBC18H10.19 Schizosaccharomyces pombe 972h- human UVRAG (UV radiation resistance) homolog NP_595743.1 1807057 D 284812 CDS SPBC18H10.20c 19112536 2540833 complement(1808402..1809487) 1 NC_003423.3 endocytosis regulator (predicted) 1809487 2540833 SPBC18H10.20c Schizosaccharomyces pombe 972h- endocytosis regulator (predicted) NP_595744.1 1808402 R 284812 CDS SPBC9B6.02c 162312209 3361218 complement(1812748..1816749) 1 NC_003423.3 retrotransposable element 1816749 Tf2-9 3361218 Tf2-9 Schizosaccharomyces pombe 972h- retrotransposable element NP_001018800.2 1812748 R 284812 CDS SPBC9B6.03 19112537 2540208 1818277..1819158 1 NC_003423.3 reciprocal best hit of PIB2, but has a much shorter N terminal low complexity region. There is a possibility there is additional N-terminal splicing; zf-FYVE type zinc finger protein 1819158 2540208 SPBC9B6.03 Schizosaccharomyces pombe 972h- zf-FYVE type zinc finger protein NP_595745.1 1818277 D 284812 CDS SPBC9B6.04c 19112538 2540210 complement(join(1820039..1821223,1821275..1821409)) 1 NC_003423.3 mitochondrial translation elongation factor EF-Tu Tuf1 1821409 tuf1 2540210 tuf1 Schizosaccharomyces pombe 972h- mitochondrial translation elongation factor EF-Tu Tuf1 NP_595746.1 1820039 R 284812 CDS SPBC9B6.05c 19112539 2540212 complement(join(1822126..1822163,1822265..1822379,1822434..1822451,1822522..1822614,1822656..1822673)) 1 NC_003423.3 U6 snRNP-associated protein Lsm3 1822673 lsm3 2540212 lsm3 Schizosaccharomyces pombe 972h- U6 snRNP-associated protein Lsm3 NP_595747.1 1822126 R 284812 CDS SPBC9B6.06 19112540 2541290 1823038..1823700 1 NC_003423.3 mitochondrial ribosomal protein subunit L15 1823700 mrpl10 2541290 mrpl10 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit L15 NP_595748.1 1823038 D 284812 CDS SPBC9B6.07 19112541 2541297 join(1824562..1824604,1824649..1824756,1824813..1825101,1825284..1825497) 1 NC_003423.3 nucleolar protein Nop52 family (predicted) 1825497 2541297 SPBC9B6.07 Schizosaccharomyces pombe 972h- nucleolar protein Nop52 family (predicted) NP_595749.1 1824562 D 284812 CDS SPBC9B6.08 19112542 2541305 1827163..1827852 1 NC_003423.3 clathrin light chain 1827852 clc1 2541305 clc1 Schizosaccharomyces pombe 972h- clathrin light chain NP_595750.1 1827163 D 284812 CDS SPBC9B6.09c 19112543 2541285 complement(1828660..1830840) 1 NC_003423.3 mitochondrial peptide-transporting ATPase 1830840 mdl1 2541285 mdl1 Schizosaccharomyces pombe 972h- mitochondrial peptide-transporting ATPase NP_595751.1 1828660 R 284812 CDS SPBC9B6.10 19112544 2541293 join(1831189..1831211,1831272..1831298,1831628..1831638,1831681..1833020) 1 NC_003423.3 Hsp90 co-chaperone Cdc37 1833020 cdc37 2541293 cdc37 Schizosaccharomyces pombe 972h- Hsp90 co-chaperone Cdc37 NP_595752.1 1831189 D 284812 CDS SPBC9B6.11c 19112545 2541286 complement(join(1833167..1834449,1834579..1834804)) 1 NC_003423.3 NOTE the exonucleolytic trimming to generate mature 3'-end of 5.8S rRNA from tricistronic rRNA transcript function performed by the S. cerevisiae ortholog NRG2 is performend by non orthologous eri1 in pombe PMID: 18438419; CCR4/nocturin family endoribonuclease 1834804 2541286 SPBC9B6.11c Schizosaccharomyces pombe 972h- CCR4/nocturin family endoribonuclease NP_595753.1 1833167 R 284812 CDS SPBC28E12.01c 19112546 2540285 complement(1834888..1835295) 1 NC_003423.3 anaphase-promoting complex subunit Apc13 1835295 apc13 2540285 apc13 Schizosaccharomyces pombe 972h- anaphase-promoting complex subunit Apc13 NP_595754.1 1834888 R 284812 CDS SPBC28E12.02 19112547 2540579 1836327..1838318 1 NC_003423.3 RNA-binding protein 1838318 2540579 SPBC28E12.02 Schizosaccharomyces pombe 972h- RNA-binding protein NP_595755.1 1836327 D 284812 CDS SPBC28E12.03 19112548 2540593 join(1839623..1839709,1839847..1839902,1840045..1840394,1840458..1842766) 1 NC_003423.3 Rho-type GTPase activating protein Rga4 1842766 rga4 2540593 rga4 Schizosaccharomyces pombe 972h- Rho-type GTPase activating protein Rga4 NP_595756.1 1839623 D 284812 CDS SPBC28E12.04 19112549 2540491 1843461..1844531 1 NC_003423.3 sequence orphan 1844531 2540491 SPBC28E12.04 Schizosaccharomyces pombe 972h- sequence orphan NP_595757.1 1843461 D 284812 CDS SPBC28E12.05 19112550 2540503 1845162..1846166 1 NC_003423.3 U3 snoRNP-associated protein Esf2 (predicted) 1846166 esf2 2540503 esf2 Schizosaccharomyces pombe 972h- U3 snoRNP-associated protein Esf2 (predicted) NP_595758.1 1845162 D 284812 CDS SPBC28E12.06c 162312211 2540571 complement(1846434..1854263) 1 NC_003423.3 beige protein homolog 1854263 lvs1 2540571 lvs1 Schizosaccharomyces pombe 972h- beige protein homolog NP_595759.2 1846434 R 284812 CDS SPBC3H7.15 19112552 2540718 complement(join(1855589..1855795,1855918..1856808)) 1 NC_003423.3 serine/threonine protein kinase Hhp1 1856808 hhp1 2540718 hhp1 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Hhp1 NP_595760.1 1855589 R 284812 CDS SPBC3H7.14 19112553 2540942 complement(1857763..1858983) 1 NC_003423.3 BRCT domain protein 1858983 mug176 2540942 mug176 Schizosaccharomyces pombe 972h- BRCT domain protein NP_595761.1 1857763 R 284812 CDS SPBC3H7.13 19112554 2541013 complement(1860194..1861099) 1 NC_003423.3 FHA domain protein Far10 (predicted) 1861099 2541013 SPBC3H7.13 Schizosaccharomyces pombe 972h- FHA domain protein Far10 (predicted) NP_595762.1 1860194 R 284812 CDS SPBC3H7.12 19112555 2541012 complement(1862166..1863029) 1 NC_003423.3 RAVE complex subunit Rav2 1863029 rav2 2541012 rav2 Schizosaccharomyces pombe 972h- RAVE complex subunit Rav2 NP_595763.1 1862166 R 284812 CDS SPBC3H7.11 19112556 2541032 complement(join(1863368..1863826,1863899..1864186)) 1 NC_003423.3 actin binding methyltransferase (predicted) 1864186 2541032 SPBC3H7.11 Schizosaccharomyces pombe 972h- actin binding methyltransferase (predicted) NP_595764.1 1863368 R 284812 CDS SPBC3H7.10 19112557 2540979 complement(join(1864777..1865331,1865414..1865608)) 1 NC_003423.3 elongator complex subunit Elp6 1865608 2540979 SPBC3H7.10 Schizosaccharomyces pombe 972h- elongator complex subunit Elp6 NP_595765.1 1864777 R 284812 CDS SPBC3H7.09 19112558 2541058 complement(1866397..1867449) 1 NC_003423.3 palmitoyltransferase (predicted) 1867449 mug142 2541058 mug142 Schizosaccharomyces pombe 972h- palmitoyltransferase (predicted) NP_595766.1 1866397 R 284812 CDS SPBC3H7.08c 19112559 2541007 join(1869252..1869320,1869390..1869441,1869602..1869843) 1 NC_003423.3 conserved fungal protein 1869843 2541007 SPBC3H7.08c Schizosaccharomyces pombe 972h- conserved fungal protein NP_595767.1 1869252 D 284812 CDS SPBC3H7.07c 19112560 2540968 join(1870334..1871131,1871203..1871301) 1 NC_003423.3 phosphoserine phosphatase (predicted) 1871301 2540968 SPBC3H7.07c Schizosaccharomyces pombe 972h- phosphoserine phosphatase (predicted) NP_595768.1 1870334 D 284812 CDS SPBC3H7.06c 19112561 2540997 join(1871847..1872211,1872282..1873320) 1 NC_003423.3 F-box protein Pof9 1873320 pof9 2540997 pof9 Schizosaccharomyces pombe 972h- F-box protein Pof9 NP_595769.1 1871847 D 284812 CDS SPBC3H7.05c 19112562 2541036 1874459..1875532 1 NC_003423.3 sequence orphan 1875532 2541036 SPBC3H7.05c Schizosaccharomyces pombe 972h- sequence orphan NP_595770.1 1874459 D 284812 CDS SPBC3H7.04 19112563 2540925 complement(1875897..1876559) 1 NC_003423.3 mitochondrial ribosomal protein subunit S26 1876559 2540925 SPBC3H7.04 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit S26 NP_595771.1 1875897 R 284812 CDS SPBC3H7.03c 19112564 2540991 1880739..1883768 1 NC_003423.3 2-oxoglutarate dehydrogenase (lipoamide) (e1 component of oxoglutarate dehydrogenase complex) (predicted) 1883768 2540991 SPBC3H7.03c Schizosaccharomyces pombe 972h- 2-oxoglutarate dehydrogenase (lipoamide) (e1 component of oxoglutarate dehydrogenase complex) (predicted) NP_595772.1 1880739 D 284812 CDS SPBC3H7.02 19112565 2540681 complement(1884365..1886998) 1 NC_003423.3 sulfate transporter (predicted) 1886998 2540681 SPBC3H7.02 Schizosaccharomyces pombe 972h- sulfate transporter (predicted) NP_595773.1 1884365 R 284812 CDS SPBC3H7.01 162312213 2540996 complement(join(1890164..1890484,1890541..1890882,1890939..1891223,1891270..1891395,1891543..1891656)) 1 NC_003423.3 GDP/GTP exchange factor, WD repeat protein Spo14 1891656 spo14 2540996 spo14 Schizosaccharomyces pombe 972h- GDP/GTP exchange factor, WD repeat protein Spo14 XP_001713132.1 1890164 R 284812 CDS SPBP16F5.02 19112568 2540555 join(1893156..1893428,1893515..1893588,1893641..1894262) 1 NC_003423.3 TFIIH complex cyclin Mcs2 1894262 mcs2 2540555 mcs2 Schizosaccharomyces pombe 972h- TFIIH complex cyclin Mcs2 NP_595776.1 1893156 D 284812 CDS SPBP16F5.03c 19112569 2541265 complement(1894433..1905532) 1 NC_003423.3 possibly lacks protein kinase activity; SAGA complex phosphatidylinositol kinase-related protein Tra1 1905532 tra1 2541265 tra1 Schizosaccharomyces pombe 972h- SAGA complex phosphatidylinositol kinase-related protein Tra1 NP_595777.1 1894433 R 284812 CDS SPBP16F5.04 19112570 2541252 join(1905799..1905987,1906384..1906441,1906491..1906744) 1 NC_003423.3 ubiquitin conjugating enzyme Ubc7/UbcP3 1906744 ubc7 2541252 ubc7 Schizosaccharomyces pombe 972h- ubiquitin conjugating enzyme Ubc7/UbcP3 NP_595778.1 1905799 D 284812 CDS SPBP16F5.05c 19112571 2541266 complement(1907232..1907672) 1 NC_003423.3 ribosome biogenesis protein Nop8 1907672 2541266 SPBP16F5.05c Schizosaccharomyces pombe 972h- ribosome biogenesis protein Nop8 NP_595779.1 1907232 R 284812 CDS SPBP16F5.06 19112572 2541269 1908132..1909568 1 NC_003423.3 ribosome biogenesis protein Nop6 1909568 2541269 SPBP16F5.06 Schizosaccharomyces pombe 972h- ribosome biogenesis protein Nop6 NP_595780.1 1908132 D 284812 CDS SPBP16F5.07 19112573 2541306 join(1910180..1910241,1910317..1910422,1910493..1911140,1911219..1911683) 1 NC_003423.3 AP-1 adaptor complex subunit Apm1 (predicted) 1911683 apm1 2541306 apm1 Schizosaccharomyces pombe 972h- AP-1 adaptor complex subunit Apm1 (predicted) NP_595781.1 1910180 D 284812 CDS SPBP16F5.08c 19112574 2541228 complement(1912136..1913479) 1 NC_003423.3 flavin dependent monooxygenase (predicted) 1913479 2541228 SPBP16F5.08c Schizosaccharomyces pombe 972h- flavin dependent monooxygenase (predicted) NP_595782.1 1912136 R 284812 CDS SPBC16E9.01c 162312215 2539644 complement(1915850..1916737) 1 NC_003423.3 CCAAT-binding factor complex subunit Php4 1916737 php4 2539644 php4 Schizosaccharomyces pombe 972h- CCAAT-binding factor complex subunit Php4 NP_595783.2 1915850 R 284812 CDS SPBC16E9.02c 19112576 2539809 complement(join(1918161..1919701,1919919..1919988,1920075..1920173)) 1 NC_003423.3 CUE domain protein 1920173 2539809 SPBC16E9.02c Schizosaccharomyces pombe 972h- CUE domain protein NP_595784.1 1918161 R 284812 CDS SPBC16E9.03c 19112577 2539921 complement(1920763..1921512) 1 NC_003423.3 DUF1783 family protein 1921512 2539921 SPBC16E9.03c Schizosaccharomyces pombe 972h- DUF1783 family protein NP_595785.1 1920763 R 284812 CDS SPBC16E9.19 19112578 2539779 1921868..1922173 1 NC_003423.3 previously annotated as dubious, but has localization signal; compositionally biased ORF; sequence orphan 1922173 2539779 SPBC16E9.19 Schizosaccharomyces pombe 972h- sequence orphan NP_595786.1 1921868 D 284812 CDS SPBC16E9.05 19112579 2539602 1923986..1925122 1 NC_003423.3 delta-sterol C-methyltransferase Erg6 (predicted) 1925122 erg6 2539602 erg6 Schizosaccharomyces pombe 972h- delta-sterol C-methyltransferase Erg6 (predicted) NP_595787.1 1923986 D 284812 CDS SPBC16E9.06c 19112580 2539858 complement(1925686..1925994) 1 NC_003423.3 BolA domain UV induced protein Uvi31 1925994 uvi31 2539858 uvi31 Schizosaccharomyces pombe 972h- BolA domain UV induced protein Uvi31 NP_595788.1 1925686 R 284812 CDS SPBC16E9.07 19112581 2540147 1927140..1928081 1 NC_003423.3 sequence orphan 1928081 mug100 2540147 mug100 Schizosaccharomyces pombe 972h- sequence orphan NP_595789.1 1927140 D 284812 CDS SPBC16E9.08 19112582 2540004 1928803..1929870 1 NC_003423.3 prospore membrane protein Mcp4/Mug101 1929870 mcp4 2540004 mcp4 Schizosaccharomyces pombe 972h- prospore membrane protein Mcp4/Mug101 NP_595790.1 1928803 D 284812 CDS SPBC16E9.09c 19112583 2540028 complement(join(1930512..1930540,1930582..1930773,1930835..1931048,1931112..1931324)) 1 NC_003423.3 COPII vesicle coat component Erp5/Erp6 1931324 2540028 SPBC16E9.09c Schizosaccharomyces pombe 972h- COPII vesicle coat component Erp5/Erp6 NP_595791.1 1930512 R 284812 CDS SPBC16E9.10c 19112584 2539968 complement(join(1931899..1933328,1933372..1933800,1933860..1934025,1934087..1934401)) 1 NC_003423.3 AAA family ATPase Rix7 (predicted) 1934401 2539968 SPBC16E9.10c Schizosaccharomyces pombe 972h- AAA family ATPase Rix7 (predicted) NP_595792.1 1931899 R 284812 CDS SPBC16E9.11c 19112585 2539956 complement(join(1935777..1937958,1938301..1938479)) 1 NC_003423.3 HECT-type ubiquitin-protein ligase Pub3 1938479 pub3 2539956 pub3 Schizosaccharomyces pombe 972h- HECT-type ubiquitin-protein ligase Pub3 NP_595793.1 1935777 R 284812 CDS SPBC16E9.12c 19112586 2539733 complement(join(1940094..1940216,1940273..1940360,1940416..1940669,1940721..1940756)) 1 NC_003423.3 PMID:17213188 refers to SPBC16E6.12c in error; poly(A) binding protein Pab2 1940756 pab2 2539733 pab2 Schizosaccharomyces pombe 972h- poly(A) binding protein Pab2 NP_595794.1 1940094 R 284812 CDS SPBC16E9.13 19112587 2539653 1943227..1944651 1 NC_003423.3 serine/threonine protein kinase Ksp1 (predicted) 1944651 ksp1 2539653 ksp1 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Ksp1 (predicted) NP_595795.1 1943227 D 284812 CDS SPBC16E9.14c 19112588 2540150 complement(1945162..1946322) 1 NC_003423.3 cation diffusion family zinc membrane transporter Zrg17 1946322 zrg17 2540150 zrg17 Schizosaccharomyces pombe 972h- cation diffusion family zinc membrane transporter Zrg17 NP_595796.1 1945162 R 284812 CDS SPBC16E9.15 19112589 2540124 join(1946978..1947040,1947098..1947121,1947171..1947213,1947278..1947375) 1 NC_003423.3 heat shock factor binding protein (predicted) 1947375 2540124 SPBC16E9.15 Schizosaccharomyces pombe 972h- heat shock factor binding protein (predicted) NP_595797.1 1946978 D 284812 CDS SPBC16E9.16c 295442838 3361210 complement(join(1947985..1948953,1948955..1950050,1950053..1950255)) 1 NC_003423.3 Lsd90 protein 1950255 lsd90 3361210 lsd90 Schizosaccharomyces pombe 972h- Lsd90 protein XP_001713133.2 1947985 R 284812 CDS SPBC16E9.17c 19112590 2540118 complement(join(1953419..1954165,1954251..1954712)) 1 NC_003423.3 meiosis-specific cyclin Rem1 1954712 rem1 2540118 rem1 Schizosaccharomyces pombe 972h- meiosis-specific cyclin Rem1 NP_595798.1 1953419 R 284812 CDS SPBC16E9.18 162312219 2539756 1955709..1957022 1 NC_003423.3 phosphatidylserine decarboxylase 1957022 2539756 SPBC16E9.18 Schizosaccharomyces pombe 972h- phosphatidylserine decarboxylase NP_595799.2 1955709 D 284812 CDS SPBC1E8.02 19112592 2540657 1958125..1959936 1 NC_003423.3 ubiquitin family protein, unknown 1959936 2540657 SPBC1E8.02 Schizosaccharomyces pombe 972h- ubiquitin family protein, unknown NP_595800.1 1958125 D 284812 CDS SPBC1E8.03c 19112593 2540688 complement(1960384..1961817) 1 NC_003423.3 conserved fungal protein 1961817 2540688 SPBC1E8.03c Schizosaccharomyces pombe 972h- conserved fungal protein NP_595801.1 1960384 R 284812 CDS SPBC1E8.05 19112594 2540552 1970914..1971867 1 NC_003423.3 conserved fungal protein 1971867 2540552 SPBC1E8.05 Schizosaccharomyces pombe 972h- conserved fungal protein NP_595802.1 1970914 D 284812 CDS SPBC1A4.01 19112595 2540307 join(1973367..1973533,1973605..1973931,1973990..1974065) 1 NC_003423.3 anaphase-promoting complex subunit Apc10 1974065 apc10 2540307 apc10 Schizosaccharomyces pombe 972h- anaphase-promoting complex subunit Apc10 NP_595803.1 1973367 D 284812 CDS SPBC1A4.02c 162312221 2540283 complement(1974488..1975603) 1 NC_003423.3 3-isopropylmalate dehydrogenase Leu1 1975603 leu1 2540283 leu1 Schizosaccharomyces pombe 972h- 3-isopropylmalate dehydrogenase Leu1 NP_595804.2 1974488 R 284812 CDS SPBC1A4.03c 19112597 2540541 complement(join(1976253..1980626,1980683..1980766)) 1 NC_003423.3 anomoly: predict additional N-terminal exon which increases homology with TOP2_CANAL/P87078; DNA topoisomerase II 1980766 top2 2540541 top2 Schizosaccharomyces pombe 972h- DNA topoisomerase II NP_595805.1 1976253 R 284812 CDS SPBC1A4.04 19112598 2540278 1983273..1984022 1 NC_003423.3 sequence orphan 1984022 2540278 SPBC1A4.04 Schizosaccharomyces pombe 972h- sequence orphan NP_595806.1 1983273 D 284812 CDS SPBC1A4.05 19112599 2540380 join(1984516..1984562,1984616..1986671) 1 NC_003423.3 sequence orphan 1986671 blt1 2540380 blt1 Schizosaccharomyces pombe 972h- sequence orphan NP_595807.1 1984516 D 284812 CDS SPBC1A4.06c 295442840 2540640 complement(join(1987044..1987102,1987102..1987675,1987737..1988015,1988081..1988353)) 1 NC_003423.3 mitochondrial matrix protein import protein 1988353 2540640 SPBC1A4.06c Schizosaccharomyces pombe 972h- mitochondrial matrix protein import protein NP_595808.2 1987044 R 284812 CDS SPBC1A4.07c 19112601 2540796 complement(join(1988986..1990034,1990091..1990352)) 1 NC_003423.3 U3 snoRNP-associated protein Sof1 1990352 2540796 SPBC1A4.07c Schizosaccharomyces pombe 972h- U3 snoRNP-associated protein Sof1 NP_595809.1 1988986 R 284812 CDS SPBC1A4.08c 19112602 2540567 complement(join(1990769..1992256,1992327..1992400,1992439..1992463)) 1 NC_003423.3 chaperonin-containing T-complex gamma subunit Cct3 1992463 cct3 2540567 cct3 Schizosaccharomyces pombe 972h- chaperonin-containing T-complex gamma subunit Cct3 NP_595810.1 1990769 R 284812 CDS SPBC1A4.11c 19112603 2540658 complement(1993276..1993650) 1 NC_003423.3 sequence orphan 1993650 2540658 SPBC1A4.11c Schizosaccharomyces pombe 972h- sequence orphan NP_595811.1 1993276 R 284812 CDS SPBC1A4.09 19112604 2540668 1993927..1995969 1 NC_003423.3 pseudouridine synthase (predicted) 1995969 2540668 SPBC1A4.09 Schizosaccharomyces pombe 972h- pseudouridine synthase (predicted) NP_595812.1 1993927 D 284812 CDS SPBC1A4.10c 162312223 2540678 complement(1996289..1998928) 1 NC_003423.3 mediator complex subunit Pmc1 1998928 pmc1 2540678 pmc1 Schizosaccharomyces pombe 972h- mediator complex subunit Pmc1 NP_595813.2 1996289 R 284812 CDS SPBP23A10.02 19112606 2541277 join(1999898..2000085,2000166..2000376) 1 NC_003423.3 overlaps CDS SPBP23A10.03c by 64bps and 3' end; V-ATPase assembly factor Pkr1 (predicted) 2000376 pkr1 2541277 pkr1 Schizosaccharomyces pombe 972h- V-ATPase assembly factor Pkr1 (predicted) NP_595814.1 1999898 D 284812 CDS SPBP23A10.03c 19112607 2541309 complement(join(2000312..2000359,2000475..2000774)) 1 NC_003423.3 overlaps CDS SPBP23A10.02 by 64bp at 3' end; ACN9 family mitochondrial protein 2000774 2541309 SPBP23A10.03c Schizosaccharomyces pombe 972h- ACN9 family mitochondrial protein NP_595815.1 2000312 R 284812 CDS SPBP23A10.04 68011924 3361204 join(2001135..2002370,2002415..2003034,2003080..2003269) 1 NC_003423.3 04.02.2003 coordinates updated additional in-frame splice @ 5325,5371 (pers. comm. Hyun-Joo Yoon Vanderbilt.edu); anaphase-promoting complex subunit Apc2 2003269 apc2 3361204 apc2 Schizosaccharomyces pombe 972h- anaphase-promoting complex subunit Apc2 NP_001018806.1 2001135 D 284812 CDS SPBP23A10.05 19112609 2541301 join(2003716..2003874,2003922..2004065,2004215..2005099) 1 NC_003423.3 SWI/SNF and RSC complex subunit Ssr4 2005099 ssr4 2541301 ssr4 Schizosaccharomyces pombe 972h- SWI/SNF and RSC complex subunit Ssr4 NP_595817.1 2003716 D 284812 CDS SPBP23A10.06 19112610 2541312 2005968..2006975 1 NC_003423.3 mitochondrial manganese ion transporter (predicted) 2006975 2541312 SPBP23A10.06 Schizosaccharomyces pombe 972h- mitochondrial manganese ion transporter (predicted) NP_595818.1 2005968 D 284812 CDS SPBP23A10.07 295442842 2541280 2008119..2011643 1 NC_003423.3 DNA-directed RNA polymerase I complex subunit Rpa2 2011643 rpa2 2541280 rpa2 Schizosaccharomyces pombe 972h- DNA-directed RNA polymerase I complex subunit Rpa2 NP_595819.2 2008119 D 284812 CDS SPBP23A10.08 19112612 2541318 2013062..2014363 1 NC_003423.3 actin-like protein Arp4 2014363 alp5 2541318 alp5 Schizosaccharomyces pombe 972h- actin-like protein Arp4 NP_595820.1 2013062 D 284812 CDS SPBP23A10.09 19112613 2541324 2015500..2016108 1 NC_003423.3 GINS complex subunit Psf1 (predicted) 2016108 2541324 SPBP23A10.09 Schizosaccharomyces pombe 972h- GINS complex subunit Psf1 (predicted) NP_595821.1 2015500 D 284812 CDS SPBP23A10.10 19112614 2541327 join(2016395..2016419,2016570..2018794) 1 NC_003423.3 serine/threonine protein kinase Ppk32 (predicted) 2018794 ppk32 2541327 ppk32 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Ppk32 (predicted) NP_595822.1 2016395 D 284812 CDS SPBP23A10.11c 19112615 2541329 complement(2019166..2020689) 1 NC_003423.3 conserved fungal protein 2020689 2541329 SPBP23A10.11c Schizosaccharomyces pombe 972h- conserved fungal protein NP_595823.1 2019166 R 284812 CDS SPBP23A10.12 19112616 2541328 join(2023949..2023986,2024059..2024178,2024239..2024697,2024769..2024889) 1 NC_003423.3 FRG1 family protein 2024889 2541328 SPBP23A10.12 Schizosaccharomyces pombe 972h- FRG1 family protein NP_595824.1 2023949 D 284812 CDS SPBP23A10.13 19112617 2541298 2025543..2028461 1 NC_003423.3 origin recognition complex subunit Orc4 2028461 orc4 2541298 orc4 Schizosaccharomyces pombe 972h- origin recognition complex subunit Orc4 NP_595825.1 2025543 D 284812 CDS SPBP23A10.14c 19112618 2541257 complement(join(2029259..2030486,2030587..2030795,2030871..2031035)) 1 NC_003423.3 RNA polymerase II transcription elongation factor SpELL 2031035 ell1 2541257 ell1 Schizosaccharomyces pombe 972h- RNA polymerase II transcription elongation factor SpELL NP_595826.1 2029259 R 284812 CDS SPBP23A10.15c 19112619 2541300 complement(2033470..2034843) 1 NC_003423.3 mitochondrial processing peptidase complex beta subunit Qcr1 2034843 qcr1 2541300 qcr1 Schizosaccharomyces pombe 972h- mitochondrial processing peptidase complex beta subunit Qcr1 NP_595827.1 2033470 R 284812 CDS SPBP23A10.16 19112620 2541292 2036019..2036579 1 NC_003423.3 This gene could be involved in both the succinate dehydrogenase complex (ubiquinone) (cytochrome b small subunit) and inner membrane translocase component due to similarity to S. cerevisiae YLR164W, YDR178W and YOR297C; TIM22 inner membrane protein import complex anchor subunit Tim18 2036579 sdh4 2541292 sdh4 Schizosaccharomyces pombe 972h- TIM22 inner membrane protein import complex anchor subunit Tim18 NP_595828.1 2036019 D 284812 CDS SPBC29A3.21 162312225 5802786 2037092..2037394 1 NC_003423.3 previously annotated as dubious; sequence orphan 2037394 5802786 SPBC29A3.21 Schizosaccharomyces pombe 972h- sequence orphan XP_001713134.1 2037092 D 284812 CDS SPBC29A3.01 19112621 2540525 2037987..2040701 1 NC_003423.3 copper transporting ATPase Ccc2 2040701 ccc2 2540525 ccc2 Schizosaccharomyces pombe 972h- copper transporting ATPase Ccc2 NP_595829.1 2037987 D 284812 CDS SPBC29A3.02c 19112622 2540290 complement(2040893..2042146) 1 NC_003423.3 this protein does not contain the C terminal histadinol dehydrogenase domain; phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP pyrophosphohydrolase His7 2042146 his7 2540290 his7 Schizosaccharomyces pombe 972h- phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP pyrophosphohydrolase His7 NP_595830.1 2040893 R 284812 CDS SPBC29A3.03c 19112623 2540465 complement(join(2042507..2043060,2043121..2043763)) 1 NC_003423.3 ubiquitin-protein ligase E3 (predicted) 2043763 2540465 SPBC29A3.03c Schizosaccharomyces pombe 972h- ubiquitin-protein ligase E3 (predicted) NP_595831.1 2042507 R 284812 CDS SPBC29A3.04 19112624 2540517 join(2045495..2045497,2045564..2046340) 1 NC_003423.3 named incorrectly, updated 20051010; 60S ribosomal protein L7a (L8) 2046340 rpl8 2540517 rpl8 Schizosaccharomyces pombe 972h- 60S ribosomal protein L7a (L8) NP_595832.1 2045495 D 284812 CDS SPBC29A3.05 19112625 2540512 join(2047112..2047168,2047211..2047316,2047365..2047444,2047490..2047666) 1 NC_003423.3 Swr1 complex subunit Vps71 2047666 vps71 2540512 vps71 Schizosaccharomyces pombe 972h- Swr1 complex subunit Vps71 NP_595833.1 2047112 D 284812 CDS SPBC29A3.06 295442844 2540529 join(2048336..2049892,2049894..2049896) 1 NC_003423.3 frameshifted; PMID:16823372 predict a frameshift at base 1557; CGI-48 family 2049896 2540529 SPBC29A3.06 Schizosaccharomyces pombe 972h- CGI-48 family NP_595834.2 2048336 D 284812 CDS SPBC29A3.07c 295442846 2540462 complement(join(2050258..2050358,2050452..2050695)) 1 NC_003423.3 U2 snRNP-associated protein Sf3b14 homolog (predicted) 2050695 2540462 SPBC29A3.07c Schizosaccharomyces pombe 972h- U2 snRNP-associated protein Sf3b14 homolog (predicted) NP_595835.2 2050258 R 284812 CDS SPBC29A3.08 19112628 2540513 2053033..2053632 1 NC_003423.3 may not be an F-box protein; term=frameshifted; date=20090202; PMID:16823372 predict a frameshift at base 485 which changes C terminal amino acids; elongin-A, F-box protein Pof4 2053632 pof4 2540513 pof4 Schizosaccharomyces pombe 972h- elongin-A, F-box protein Pof4 NP_595836.1 2053033 D 284812 CDS SPBC29A3.09c 19112629 2540597 complement(2054214..2056424) 1 NC_003423.3 AAA family ATPase Gcn20 (predicted) 2056424 2540597 SPBC29A3.09c Schizosaccharomyces pombe 972h- AAA family ATPase Gcn20 (predicted) NP_595837.1 2054214 R 284812 CDS SPBC29A3.10c 19112630 2540599 complement(join(2057098..2057121,2057168..2057358,2057411..2057446,2057495..2057540,2057588..2057602)) 1 NC_003423.3 F1-ATPase subunit H (predicted) 2057602 atp14 2540599 atp14 Schizosaccharomyces pombe 972h- F1-ATPase subunit H (predicted) NP_595838.1 2057098 R 284812 CDS SPBC29A3.11c 19112631 2540397 complement(2058263..2059156) 1 NC_003423.3 mitochondrial carboxylic acid transporter (predicted) 2059156 2540397 SPBC29A3.11c Schizosaccharomyces pombe 972h- mitochondrial carboxylic acid transporter (predicted) NP_595839.1 2058263 R 284812 CDS SPBC29A3.12 19112632 2540367 2059792..2060370 1 NC_003423.3 40S ribosomal protein S9 2060370 rps902 2540367 rps902 Schizosaccharomyces pombe 972h- 40S ribosomal protein S9 NP_595840.1 2059792 D 284812 CDS SPBC29A3.13 19112633 2540354 complement(2061103..2062182) 1 NC_003423.3 PWWP domain protein Pdp1 2062182 pdp1 2540354 pdp1 Schizosaccharomyces pombe 972h- PWWP domain protein Pdp1 NP_595841.1 2061103 R 284812 CDS SPBC29A3.14c 19112634 2540601 complement(join(2062472..2062634,2062677..2062773,2062817..2062983,2063023..2063272,2063310..2063523,2063565..2063713,2063760..2063944,2063986..2064155,2064207..2064323,2064364..2064633,2064673..2064743,2064783..2065175,2065212..2065474,2065526..2065644,2065716..2065796,2065853..2066110)) 1 NC_003423.3 telomerase reverse transcriptase 1 protein Trt1 2066110 trt1 2540601 trt1 Schizosaccharomyces pombe 972h- telomerase reverse transcriptase 1 protein Trt1 NP_595842.1 2062472 R 284812 CDS SPBC29A3.15c 19112635 2540507 complement(2066508..2067938) 1 NC_003423.3 mitochondrial ribosomal protein subunit S23 2067938 rsm23 2540507 rsm23 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit S23 NP_595843.1 2066508 R 284812 CDS SPBC29A3.16 19112636 2540324 2068393..2068893 1 NC_003423.3 ribosome biogenesis protein Rrs1 (predicted) 2068893 rrs1 2540324 rrs1 Schizosaccharomyces pombe 972h- ribosome biogenesis protein Rrs1 (predicted) NP_595844.1 2068393 D 284812 CDS SPBC29A3.17 19112637 2540334 join(2070386..2071291,2071348..2072019) 1 NC_003423.3 RhoGEF Gef3 2072019 gef3 2540334 gef3 Schizosaccharomyces pombe 972h- RhoGEF Gef3 NP_595845.1 2070386 D 284812 CDS SPBC29A3.18 19112638 2540456 join(2073323..2073382,2073467..2074330) 1 NC_003423.3 cytochrome c1 Cyt1 (predicted) 2074330 cyt1 2540456 cyt1 Schizosaccharomyces pombe 972h- cytochrome c1 Cyt1 (predicted) NP_595846.1 2073323 D 284812 CDS SPBC18E5.01 19112639 2540762 2075665..2076693 1 NC_003423.3 cycloisomerase 2 family 2076693 2540762 SPBC18E5.01 Schizosaccharomyces pombe 972h- cycloisomerase 2 family NP_595847.1 2075665 D 284812 CDS SPBC18E5.02c 19112640 2540820 complement(join(2077163..2077354,2077408..2078398,2078455..2078555,2078614..2078859)) 1 NC_003423.3 serine palmitoyltransferase complex subunit (predicted) 2078859 2540820 SPBC18E5.02c Schizosaccharomyces pombe 972h- serine palmitoyltransferase complex subunit (predicted) NP_595848.1 2077163 R 284812 CDS SPBC18E5.03c 19112641 2540804 complement(join(2079489..2079641,2079718..2080398)) 1 NC_003423.3 kinetochore protein Sim4 2080398 sim4 2540804 sim4 Schizosaccharomyces pombe 972h- kinetochore protein Sim4 NP_595849.1 2079489 R 284812 CDS SPBC18E5.04 19112642 2540795 2081514..2082179 1 NC_003423.3 60S ribosomal protein L10 2082179 rpl1001 2540795 rpl1001 Schizosaccharomyces pombe 972h- 60S ribosomal protein L10 NP_595850.1 2081514 D 284812 CDS SPBC18E5.05c 19112643 2540822 complement(join(2082487..2083309,2083364..2083485)) 1 NC_003423.3 elongator complex subunit Iki1 (predicted) 2083485 2540822 SPBC18E5.05c Schizosaccharomyces pombe 972h- elongator complex subunit Iki1 (predicted) NP_595851.1 2082487 R 284812 CDS SPBC18E5.06 19112644 2540806 join(2083868..2083917,2083971..2084184) 1 NC_003423.3 40S ribosomal protein S21 2084184 rps21 2540806 rps21 Schizosaccharomyces pombe 972h- 40S ribosomal protein S21 NP_595852.1 2083868 D 284812 CDS SPBC18E5.07 19112645 2540566 2085622..2087469 1 NC_003423.3 sequence orphan 2087469 2540566 SPBC18E5.07 Schizosaccharomyces pombe 972h- sequence orphan NP_595853.1 2085622 D 284812 CDS SPBC18E5.08 19112646 2540603 2088440..2089000 1 NC_003423.3 N-acetyltransferase (predicted) 2089000 2540603 SPBC18E5.08 Schizosaccharomyces pombe 972h- N-acetyltransferase (predicted) NP_595854.1 2088440 D 284812 CDS SPBC18E5.14c 295442849 2540791 complement(join(2089944..2090330,2090431..2090556,2090620..2090943)) 1 NC_003423.3 splicing is tentative; SPBC18E5.09c & SPBC18E5.14c merged, pers. comm. Charly Chahwan; sequence orphan 2090943 2540791 SPBC18E5.14c Schizosaccharomyces pombe 972h- sequence orphan NP_595855.2 2089944 R 284812 CDS SPBC18E5.10 19112649 2540740 join(2092851..2093057,2093126..2094277) 1 NC_003423.3 previously annotated as respiratory chain NADH dehydrogenase complex, this mapping was removed due to lack of the remaining 40 subunits found in mammals (PMID:1518044); iron sulfur cluster assembly protein (predicted) 2094277 2540740 SPBC18E5.10 Schizosaccharomyces pombe 972h- iron sulfur cluster assembly protein (predicted) NP_595857.1 2092851 D 284812 CDS SPBC18E5.11c 19112650 2540639 complement(join(2094393..2095403,2095495..2095848)) 1 NC_003423.3 enhancer of mRNA decapping Edc3 (predicted) 2095848 edc3 2540639 edc3 Schizosaccharomyces pombe 972h- enhancer of mRNA decapping Edc3 (predicted) NP_595858.1 2094393 R 284812 CDS SPBC18E5.12c 19112651 2540713 complement(2096528..2098012) 1 NC_003423.3 mitochondrial processing peptidase complex alpha subunit Mas2 2098012 mas2 2540713 mas2 Schizosaccharomyces pombe 972h- mitochondrial processing peptidase complex alpha subunit Mas2 NP_595859.1 2096528 R 284812 CDS SPBC18E5.13 162312227 2540805 2098957..2099658 1 NC_003423.3 mitochondrial translation initiation factor (predicted) 2099658 2540805 SPBC18E5.13 Schizosaccharomyces pombe 972h- mitochondrial translation initiation factor (predicted) NP_595860.2 2098957 D 284812 CDS SPBC23G7.16 19112653 2540641 join(2100273..2100317,2100387..2100412,2100520..2100780,2100875..2100896,2100969..2101061) 1 NC_003423.3 vacuolar copper transporter Ctr6 2101061 ctr6 2540641 ctr6 Schizosaccharomyces pombe 972h- vacuolar copper transporter Ctr6 NP_595861.1 2100273 D 284812 CDS SPBC23G7.04c 19112654 2540468 complement(2101446..2103491) 1 NC_003423.3 ortholog data pers. comm. Maria Novatchkova; SEL1 repeat protein Nif1 2103491 nif1 2540468 nif1 Schizosaccharomyces pombe 972h- SEL1 repeat protein Nif1 NP_595862.1 2101446 R 284812 CDS SPBC23G7.05 19112655 2540672 join(2105626..2105656,2105872..2106170) 1 NC_003423.3 translation initiation factor eIF1 2106170 sui1 2540672 sui1 Schizosaccharomyces pombe 972h- translation initiation factor eIF1 NP_595863.1 2105626 D 284812 CDS SPBC23G7.06c 295442851 2540553 complement(join(2106448..2108181,2108181..2108786)) 1 NC_003423.3 conserved eukaryotic protein 2108786 2540553 SPBC23G7.06c Schizosaccharomyces pombe 972h- conserved eukaryotic protein NP_595864.2 2106448 R 284812 CDS SPBC23G7.07c 19112657 2540607 complement(join(2109409..2109584,2109644..2109958,2110015..2110357)) 1 NC_003423.3 replication regulator (predicted) 2110357 2540607 SPBC23G7.07c Schizosaccharomyces pombe 972h- replication regulator (predicted) NP_595865.1 2109409 R 284812 CDS SPBC23G7.08c 19112658 2540635 complement(2110807..2112894) 1 NC_003423.3 Rho-type GTPase activating protein Rga7 2112894 rga7 2540635 rga7 Schizosaccharomyces pombe 972h- Rho-type GTPase activating protein Rga7 NP_595866.1 2110807 R 284812 CDS SPBC23G7.17c 68011978 3361261 complement(2114219..2114347) 1 NC_003423.3 mating-type M-specific polypeptide Mi 2 2114347 matmi_2 3361261 matmi_2 Schizosaccharomyces pombe 972h- mating-type M-specific polypeptide Mi 2 NP_001018808.1 2114219 R 284812 CDS SPBC23G7.09 19112659 2539619 2114482..2115027 1 NC_003423.3 mating-type m-specific polypeptide mc 2 2115027 matmc_2 2539619 matmc_2 Schizosaccharomyces pombe 972h- mating-type m-specific polypeptide mc 2 NP_595867.1 2114482 D 284812 CDS SPBC23G7.10c 19112660 2540490 complement(2118267..2119454) 1 NC_003423.3 NADH-dependent flavin oxidoreductase (predicted) 2119454 2540490 SPBC23G7.10c Schizosaccharomyces pombe 972h- NADH-dependent flavin oxidoreductase (predicted) NP_595868.1 2118267 R 284812 CDS SPBC23G7.11 19112661 2540646 2120286..2120927 1 NC_003423.3 DNA-3-methyladenine glycosidase Mag2 (predicted) 2120927 2540646 SPBC23G7.11 Schizosaccharomyces pombe 972h- DNA-3-methyladenine glycosidase Mag2 (predicted) NP_595869.1 2120286 D 284812 CDS SPBC23G7.12c 19112662 2540487 complement(join(2121530..2122687,2122730..2122783)) 1 NC_003423.3 19S proteasome regulatory subunit Rpt6 (predicted) 2122783 rpt6 2540487 rpt6 Schizosaccharomyces pombe 972h- 19S proteasome regulatory subunit Rpt6 (predicted) NP_595870.1 2121530 R 284812 CDS SPBC23G7.13c 19112663 2540527 complement(2123260..2125254) 1 NC_003423.3 urea transporter (predicted) 2125254 2540527 SPBC23G7.13c Schizosaccharomyces pombe 972h- urea transporter (predicted) NP_595871.1 2123260 R 284812 CDS SPBC23G7.14 19112664 2540536 2126633..2127028 1 NC_003423.3 sequence orphan 2127028 2540536 SPBC23G7.14 Schizosaccharomyces pombe 972h- sequence orphan NP_595872.1 2126633 D 284812 CDS SPBC23G7.15c 19112665 2540587 complement(join(2128032..2128055,2128102..2128410)) 1 NC_003423.3 60S acidic ribosomal protein P2B subunit 2128410 rpp202 2540587 rpp202 Schizosaccharomyces pombe 972h- 60S acidic ribosomal protein P2B subunit NP_595873.1 2128032 R 284812 CDS SPBC1711.01c 19112666 2539637 complement(2132586..2132714) 1 NC_003423.3 mating-type m-specific polypeptide mi 1 2132714 matmi_1 2539637 matmi_1 Schizosaccharomyces pombe 972h- mating-type m-specific polypeptide mi 1 NP_595874.1 2132586 R 284812 CDS SPBC1711.02 19112667 2540048 2132849..2133394 1 NC_003423.3 mating-type m-specific polypeptide mc 1 2133394 matmc_1 2540048 matmc_1 Schizosaccharomyces pombe 972h- mating-type m-specific polypeptide mc 1 NP_595875.1 2132849 D 284812 CDS SPBC1711.03 19112668 2539739 join(2138363..2138387,2138427..2138553,2138602..2138876,2139082..2139243,2139289..2139476) 1 NC_003423.3 conserved eukaryotic protein 2139476 2539739 SPBC1711.03 Schizosaccharomyces pombe 972h- conserved eukaryotic protein NP_595876.1 2138363 D 284812 CDS SPBC1711.04 19112669 2539884 join(2139862..2139901,2140017..2140148,2140201..2140991) 1 NC_003423.3 methylenetetrahydrofolate reductase (predicted) 2140991 2539884 SPBC1711.04 Schizosaccharomyces pombe 972h- methylenetetrahydrofolate reductase (predicted) NP_595877.1 2139862 D 284812 CDS SPBC1711.05 19112670 2539687 2141268..2142623 1 NC_003423.3 central repeat region consensus DSESESSSEDSDSSSSSS ~7 copies?; nucleocytoplasmic transport chaperone Srp40 (predicted) 2142623 2539687 SPBC1711.05 Schizosaccharomyces pombe 972h- nucleocytoplasmic transport chaperone Srp40 (predicted) NP_595878.1 2141268 D 284812 CDS SPBC1711.06 19112671 2539780 2143137..2144228 1 NC_003423.3 60S ribosomal protein L2 2144228 rpl401 2539780 rpl401 Schizosaccharomyces pombe 972h- 60S ribosomal protein L2 NP_595879.1 2143137 D 284812 CDS SPBC1711.07 19112672 2539693 2146256..2147698 1 NC_003423.3 WD repeat protein Rrb1 (predicted) 2147698 2539693 SPBC1711.07 Schizosaccharomyces pombe 972h- WD repeat protein Rrb1 (predicted) NP_595880.1 2146256 D 284812 CDS SPBC1711.08 19112673 2539806 join(2149125..2149156,2149532..2150510) 1 NC_003423.3 chaperone activator Aha1 (predicted) 2150510 2539806 SPBC1711.08 Schizosaccharomyces pombe 972h- chaperone activator Aha1 (predicted) NP_595881.1 2149125 D 284812 CDS SPBC1711.09c 19112674 2539871 complement(join(2150960..2151760,2151827..2151838)) 1 NC_003423.3 SNARE associated Golgi protein (predicted) 2151838 2539871 SPBC1711.09c Schizosaccharomyces pombe 972h- SNARE associated Golgi protein (predicted) NP_595882.1 2150960 R 284812 CDS SPBC1711.10c 19112675 2539821 complement(join(2152591..2154144,2154207..2154287,2154333..2154335)) 1 NC_003423.3 Cdc48-Ufd1-Npl4 complex component Npl4 (predicted) 2154335 npl4 2539821 npl4 Schizosaccharomyces pombe 972h- Cdc48-Ufd1-Npl4 complex component Npl4 (predicted) NP_595883.1 2152591 R 284812 CDS SPBC1711.11 19112676 2539824 2155273..2156445 1 NC_003423.3 autophagy associated protein (predicted) 2156445 2539824 SPBC1711.11 Schizosaccharomyces pombe 972h- autophagy associated protein (predicted) NP_595884.1 2155273 D 284812 CDS SPBC1711.12 19112677 2539662 2157625..2159676 1 NC_003423.3 serine protease (predicted) 2159676 2539662 SPBC1711.12 Schizosaccharomyces pombe 972h- serine protease (predicted) NP_595885.1 2157625 D 284812 CDS SPBC1711.13 19112678 2539650 2159917..2161236 1 NC_003423.3 histidinol dehydrogenase His2 (predicted) 2161236 his2 2539650 his2 Schizosaccharomyces pombe 972h- histidinol dehydrogenase His2 (predicted) NP_595886.1 2159917 D 284812 CDS SPBC1711.14 19112679 2539720 join(2161542..2161746,2161796..2162133) 1 NC_003423.3 meiotic recombination protein Rec15 2162133 rec15 2539720 rec15 Schizosaccharomyces pombe 972h- meiotic recombination protein Rec15 NP_595887.1 2161542 D 284812 CDS SPBC1711.15c 19112680 2539647 complement(2162113..2162211) 1 NC_003423.3 below 100 amino acid size threshold, included because there is a confirmed upstream intron and this is the largest reading frame in region with MET; previously annotated as dubious, but has localization signal; sequence orphan 2162211 2539647 SPBC1711.15c Schizosaccharomyces pombe 972h- sequence orphan NP_595888.1 2162113 R 284812 CDS SPBC1711.16 19112681 2539789 2164278..2165828 1 NC_003423.3 WD repeat protein (predicted) 2165828 2539789 SPBC1711.16 Schizosaccharomyces pombe 972h- WD repeat protein (predicted) NP_595889.1 2164278 D 284812 CDS SPBC1711.17 162312229 2540006 2166259..2169780 1 NC_003423.3 ATP-dependent RNA helicase Prp16 2169780 prp16 2540006 prp16 Schizosaccharomyces pombe 972h- ATP-dependent RNA helicase Prp16 NP_595890.2 2166259 D 284812 CDS SPBC17G9.02c 19112683 2539616 complement(join(2169991..2170499,2170541..2170643,2170694..2170839,2170903..2171260)) 1 NC_003423.3 RNA polymerase II accessory factor, Cdc73 family 2171260 2539616 SPBC17G9.02c Schizosaccharomyces pombe 972h- RNA polymerase II accessory factor, Cdc73 family NP_595891.1 2169991 R 284812 CDS SPBC17G9.03c 19112684 2539746 complement(2171857..2173632) 1 NC_003423.3 cytoplasmic lysine-tRNA ligase Krs1 (predicted) 2173632 krs1 2539746 krs1 Schizosaccharomyces pombe 972h- cytoplasmic lysine-tRNA ligase Krs1 (predicted) NP_595892.1 2171857 R 284812 CDS SPBC17G9.04c 19112685 2539829 complement(2174101..2176128) 1 NC_003423.3 Ba?? S.W et al., submitted; nucleoporin Nup85 2176128 nup85 2539829 nup85 Schizosaccharomyces pombe 972h- nucleoporin Nup85 NP_595893.1 2174101 R 284812 CDS SPBC17G9.05 19112686 2539942 2178034..2179332 1 NC_003423.3 RRM-containing cyclophilin regulating transcription Rct1 2179332 rct1 2539942 rct1 Schizosaccharomyces pombe 972h- RRM-containing cyclophilin regulating transcription Rct1 NP_595894.1 2178034 D 284812 CDS SPBC17G9.06c 19112687 2540177 complement(2179488..2180492) 1 NC_003423.3 siderophore-iron biosynthesis protein (predicted) 2180492 2540177 SPBC17G9.06c Schizosaccharomyces pombe 972h- siderophore-iron biosynthesis protein (predicted) NP_595895.1 2179488 R 284812 CDS SPBC17G9.07 19112688 2539848 join(2180931..2180999,2181081..2181416) 1 NC_003423.3 40S ribosomal protein S24 2181416 rps2402 2539848 rps2402 Schizosaccharomyces pombe 972h- 40S ribosomal protein S24 NP_595896.1 2180931 D 284812 CDS SPBC17G9.08c 19112689 2539865 complement(join(2181745..2182232,2182277..2183903,2183955..2184098,2184223..2184405,2184450..2184583,2184640..2184676)) 1 NC_003423.3 Centaurin 5 2184676 cnt5 2539865 cnt5 Schizosaccharomyces pombe 972h- Centaurin 5 NP_595897.1 2181745 R 284812 CDS SPBC17G9.09 19112690 2539738 2187712..2189052 1 NC_003423.3 translation initiation factor eIF2 gamma subunit 2189052 tif213 2539738 tif213 Schizosaccharomyces pombe 972h- translation initiation factor eIF2 gamma subunit NP_595898.1 2187712 D 284812 CDS SPBC17G9.10 19112691 2539846 2189725..2190249 1 NC_003423.3 60S ribosomal protein L11 2190249 rpl1102 2539846 rpl1102 Schizosaccharomyces pombe 972h- 60S ribosomal protein L11 NP_595899.1 2189725 D 284812 CDS SPBC17G9.11c 19112692 2539661 complement(2190874..2194431) 1 NC_003423.3 pyruvate carboxylase 2194431 pyr1 2539661 pyr1 Schizosaccharomyces pombe 972h- pyruvate carboxylase NP_595900.1 2190874 R 284812 CDS SPBC17G9.12c 19112693 2539837 complement(2195200..2196024) 1 NC_003423.3 conserved fungal protein 2196024 2539837 SPBC17G9.12c Schizosaccharomyces pombe 972h- conserved fungal protein NP_595901.1 2195200 R 284812 CDS SPBC17G9.13c 19112694 2539657 complement(2196584..2197537) 1 NC_003423.3 conserved fungal mitochondrial protein 2197537 2539657 SPBC17G9.13c Schizosaccharomyces pombe 972h- conserved fungal mitochondrial protein NP_595902.1 2196584 R 284812 CDS SPBC1815.01 19112695 2539782 2201237..2202556 1 NC_003423.3 enolase 2202556 eno101 2539782 eno101 Schizosaccharomyces pombe 972h- enolase NP_595903.1 2201237 D 284812 CDS SPBC14C8.01c 162312231 2539641 complement(2203316..2204221) 1 NC_003423.3 securin 2204221 cut2 2539641 cut2 Schizosaccharomyces pombe 972h- securin NP_595904.2 2203316 R 284812 CDS SPBC14C8.02 19112697 2539636 2205554..2206837 1 NC_003423.3 TIM23 translocase complex subunit Tim44 2206837 tim44 2539636 tim44 Schizosaccharomyces pombe 972h- TIM23 translocase complex subunit Tim44 NP_595905.1 2205554 D 284812 CDS SPBC14C8.03 19112698 2539692 2207732..2209012 1 NC_003423.3 methionine aminopeptidase Fma2 (predicted) 2209012 fma2 2539692 fma2 Schizosaccharomyces pombe 972h- methionine aminopeptidase Fma2 (predicted) NP_595906.1 2207732 D 284812 CDS SPBC14C8.04 19112699 2540022 join(2210136..2210162,2210225..2210362,2210812..2211005,2211086..2211596) 1 NC_003423.3 acetolactate synthase regulatory unit 2211596 2540022 SPBC14C8.04 Schizosaccharomyces pombe 972h- acetolactate synthase regulatory unit NP_595907.1 2210136 D 284812 CDS SPBC14C8.05c 19112700 2539682 complement(2212020..2213372) 1 NC_003423.3 glucan-alpha-1,4-glucosidase 2213372 meu17 2539682 meu17 Schizosaccharomyces pombe 972h- glucan-alpha-1,4-glucosidase NP_595908.1 2212020 R 284812 CDS SPBC14C8.06 19112701 2540002 join(2214438..2214510,2214558..2215618) 1 NC_003423.3 ARP2/3 actin-organizing complex subunit Sop2 2215618 arc1 2540002 arc1 Schizosaccharomyces pombe 972h- ARP2/3 actin-organizing complex subunit Sop2 NP_595909.1 2214438 D 284812 CDS SPBC14C8.07c 19112702 2540013 complement(2216140..2217873) 1 NC_003423.3 MCM loader 2217873 cdc18 2540013 cdc18 Schizosaccharomyces pombe 972h- MCM loader NP_595910.1 2216140 R 284812 CDS SPBC14C8.09c 295442853 2539709 complement(join(2219430..2219937,2219937..2220322)) 1 NC_003423.3 IMPACT homolog 2220322 2539709 SPBC14C8.09c Schizosaccharomyces pombe 972h- IMPACT homolog NP_595912.2 2219430 R 284812 CDS SPBC14C8.10 19112705 2539852 2220763..2221293 1 NC_003423.3 mitochondrial ribosomal protein subunit L28 2221293 mrpl24 2539852 mrpl24 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit L28 NP_595913.1 2220763 D 284812 CDS SPBC14C8.11c 19112706 2539813 complement(2222650..2223060) 1 NC_003423.3 sequence orphan 2223060 2539813 SPBC14C8.11c Schizosaccharomyces pombe 972h- sequence orphan NP_595914.1 2222650 R 284812 CDS SPBC14C8.12 19112707 2539794 join(2223772..2223841,2223901..2224102,2224151..2224256) 1 NC_003423.3 DNA-directed RNA polymerase I, II and III subunit Rpb8 2224256 rpb8 2539794 rpb8 Schizosaccharomyces pombe 972h- DNA-directed RNA polymerase I, II and III subunit Rpb8 NP_595915.1 2223772 D 284812 CDS SPBC14C8.13 19112708 2540090 2225388..2226143 1 NC_003423.3 previously annotated as dubious as overlaps SPBC14C8.14c; SRR1 family protein 2226143 2540090 SPBC14C8.13 Schizosaccharomyces pombe 972h- SRR1 family protein NP_595916.1 2225388 D 284812 CDS SPBC14C8.14c 19112709 2539834 complement(join(2226040..2228721,2228791..2228988)) 1 NC_003423.3 DNA polymerase phi 2228988 pol5 2539834 pol5 Schizosaccharomyces pombe 972h- DNA polymerase phi NP_595917.1 2226040 R 284812 CDS SPBC14C8.15 19112710 2539842 join(2230228..2230262,2230317..2230433,2230489..2231542,2231606..2231782) 1 NC_003423.3 triglyceride lipase-cholesterol esterase (predicted) 2231782 2539842 SPBC14C8.15 Schizosaccharomyces pombe 972h- triglyceride lipase-cholesterol esterase (predicted) NP_595918.1 2230228 D 284812 CDS SPBC14C8.16c 19112711 2539986 complement(2232164..2233111) 1 NC_003423.3 mitochondrial ribosomal protein subunit S35 2233111 bot1 2539986 bot1 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit S35 NP_595919.1 2232164 R 284812 CDS SPBC14C8.17c 19112712 2539775 complement(join(2234083..2235608,2235656..2235710)) 1 NC_003423.3 SAGA complex subunit Spt8 2235710 spt8 2539775 spt8 Schizosaccharomyces pombe 972h- SAGA complex subunit Spt8 NP_595920.1 2234083 R 284812 CDS SPBC15C4.01c 63054750 2539872 complement(join(2236526..2236714,2236792..2236990,2237042..2237187,2237251..2237394,2237468..2237638)) 1 NC_003423.3 TPR repeat protein Oca3 2237638 oca3 2539872 oca3 Schizosaccharomyces pombe 972h- TPR repeat protein Oca3 NP_595921.2 2236526 R 284812 CDS SPBC15C4.02 19112714 2539608 join(2238671..2238895,2238940..2239248,2239362..2240344,2240437..2240704) 1 NC_003423.3 first exon may be incorrect, unsupported; ABC1 kinase family protein 2240704 2539608 SPBC15C4.02 Schizosaccharomyces pombe 972h- ABC1 kinase family protein NP_595922.1 2238671 D 284812 CDS SPBC15C4.03 19112715 2539612 join(2240916..2240983,2241033..2242344) 1 NC_003423.3 Rab geranylgeranyltransferase escort protein (predicted) 2242344 2539612 SPBC15C4.03 Schizosaccharomyces pombe 972h- Rab geranylgeranyltransferase escort protein (predicted) NP_595923.1 2240916 D 284812 CDS SPBC15C4.04c 19112716 2539903 complement(2242831..2244459) 1 NC_003423.3 amino acid permease, unknown 10 2244459 2539903 SPBC15C4.04c Schizosaccharomyces pombe 972h- amino acid permease, unknown 10 NP_595924.1 2242831 R 284812 CDS SPBC15C4.05 19112717 2539831 2246723..2251009 1 NC_003423.3 ATP-dependent RNA/DNA helicase (predicted) 2251009 2539831 SPBC15C4.05 Schizosaccharomyces pombe 972h- ATP-dependent RNA/DNA helicase (predicted) NP_595925.1 2246723 D 284812 CDS SPBC15C4.06c 19112718 2539787 complement(2251736..2253406) 1 NC_003423.3 ubiquitin-protein ligase E3 (predicted) 2253406 2539787 SPBC15C4.06c Schizosaccharomyces pombe 972h- ubiquitin-protein ligase E3 (predicted) NP_595926.1 2251736 R 284812 CDS SPBC21H7.02 19112719 2540614 2255202..2255849 1 NC_003423.3 SAGA complex/transcription factor TFIID complex subunit Taf10 (predicted) 2255849 taf10 2540614 taf10 Schizosaccharomyces pombe 972h- SAGA complex/transcription factor TFIID complex subunit Taf10 (predicted) NP_595927.1 2255202 D 284812 CDS SPBC21H7.03c 19112720 2540420 complement(2256644..2258035) 1 NC_003423.3 acid phosphatase (predicted) 2258035 2540420 SPBC21H7.03c Schizosaccharomyces pombe 972h- acid phosphatase (predicted) NP_595928.1 2256644 R 284812 CDS SPBC21H7.04 19112721 2540518 2258814..2260943 1 NC_003423.3 ATP-dependent RNA helicase Dbp7 (predicted) 2260943 dbp7 2540518 dbp7 Schizosaccharomyces pombe 972h- ATP-dependent RNA helicase Dbp7 (predicted) NP_595929.1 2258814 D 284812 CDS SPBC21H7.05 19112722 2540424 join(2262214..2263156,2263199..2263315,2263359..2263562,2263610..2264094) 1 NC_003423.3 transcription factor TFIIIC complex subunit Sfc6 2264094 sfc6 2540424 sfc6 Schizosaccharomyces pombe 972h- transcription factor TFIIIC complex subunit Sfc6 NP_595930.1 2262214 D 284812 CDS SPBC21H7.06c 19112723 2540509 complement(join(2264302..2264873,2265000..2265030)) 1 NC_003423.3 inositol metabolism protein Opi10 (predicted) 2265030 2540509 SPBC21H7.06c Schizosaccharomyces pombe 972h- inositol metabolism protein Opi10 (predicted) NP_595931.1 2264302 R 284812 CDS SPBC21H7.07c 19112724 2540675 complement(2266666..2267316) 1 NC_003423.3 imidazoleglycerol phosphate dehydratase 2267316 his5 2540675 his5 Schizosaccharomyces pombe 972h- imidazoleglycerol phosphate dehydratase NP_595932.1 2266666 R 284812 CDS SPBC16H5.14c 19112725 2539946 join(2268602..2268996,2269048..2269178,2269233..2269567) 1 NC_003423.3 short chain dehydrogenase DHRS family (predicted) 2269567 2539946 SPBC16H5.14c Schizosaccharomyces pombe 972h- short chain dehydrogenase DHRS family (predicted) NP_595933.1 2268602 D 284812 CDS SPBC16H5.13 19112726 2539925 complement(join(2269573..2271274,2271318..2272430,2272511..2272776)) 1 NC_003423.3 WD repeat protein, human WDR7 ortholog 2272776 2539925 SPBC16H5.13 Schizosaccharomyces pombe 972h- WD repeat protein, human WDR7 ortholog NP_595934.1 2269573 R 284812 CDS SPBC16H5.12c 19112727 2540086 join(2274403..2274412,2274610..2274721,2274781..2276707) 1 NC_003423.3 possible alternative N-terminal splicing, but no consensus branch; conserved fungal protein 2276707 2540086 SPBC16H5.12c Schizosaccharomyces pombe 972h- conserved fungal protein NP_595935.1 2274403 D 284812 CDS SPBC16H5.11c 19112728 2540099 join(2277215..2277464,2277514..2279012,2279059..2279247) 1 NC_003423.3 Shk1 kinase-binding protein 1; type II protein arginine N-methyltransferase Skb1 2279247 skb1 2540099 skb1 Schizosaccharomyces pombe 972h- type II protein arginine N-methyltransferase Skb1 NP_595936.1 2277215 D 284812 CDS SPBC16H5.10c 19112729 2540057 2279763..2281970 1 NC_003423.3 ATP-dependent RNA helicase Prp43 2281970 prp43 2540057 prp43 Schizosaccharomyces pombe 972h- ATP-dependent RNA helicase Prp43 NP_595937.1 2279763 D 284812 CDS SPBC16H5.09c 19112730 2539904 join(2282566..2283363,2283410..2283508,2283562..2283715,2283760..2283827) 1 NC_003423.3 alpha-1,2-mannosyltransferase (predicted) 2283827 2539904 SPBC16H5.09c Schizosaccharomyces pombe 972h- alpha-1,2-mannosyltransferase (predicted) NP_595938.1 2282566 D 284812 CDS SPBC16H5.08c 19112731 2540078 join(2284377..2284412,2284525..2286345) 1 NC_003423.3 ribosome biogenesis ATPase, Arb family ABCF2-like (predicted) 2286345 2540078 SPBC16H5.08c Schizosaccharomyces pombe 972h- ribosome biogenesis ATPase, Arb family ABCF2-like (predicted) NP_595939.1 2284377 D 284812 CDS SPBC16H5.07c 19112732 2540072 join(2287017..2287157,2287450..2288277) 1 NC_003423.3 serine/threonine protein phosphatase Ppa2 2288277 ppa2 2540072 ppa2 Schizosaccharomyces pombe 972h- serine/threonine protein phosphatase Ppa2 NP_595940.1 2287017 D 284812 CDS SPBC16H5.06 19112733 2540075 complement(2289372..2290058) 1 NC_003423.3 ubiquinol-cytochrome-c reductase complex subunit 5 2290058 rip1 2540075 rip1 Schizosaccharomyces pombe 972h- ubiquinol-cytochrome-c reductase complex subunit 5 NP_595941.1 2289372 R 284812 CDS SPBC16H5.15 19112734 2539885 complement(2290803..2291303) 1 NC_003423.3 conserved fungal protein 2291303 2539885 SPBC16H5.15 Schizosaccharomyces pombe 972h- conserved fungal protein NP_595942.1 2290803 R 284812 CDS SPBC16H5.05c 19112735 2540067 join(2291578..2291583,2291624..2291652,2291695..2291799,2291890..2293141) 1 NC_003423.3 cyclophilin family peptidyl-prolyl cis-trans isomerase Cyp7 2293141 cyp7 2540067 cyp7 Schizosaccharomyces pombe 972h- cyclophilin family peptidyl-prolyl cis-trans isomerase Cyp7 NP_595943.1 2291578 D 284812 CDS SPBC16H5.04 295442855 2540080 complement(join(2293393..2293775,2293877..2294039,2294087..2294125)) 1 NC_003423.3 pho88 family protein 2294125 2540080 SPBC16H5.04 Schizosaccharomyces pombe 972h- pho88 family protein NP_595944.2 2293393 R 284812 CDS SPBC16H5.03c 19112737 2539967 join(2295031..2295111,2295153..2295233,2295324..2296382,2296424..2297089) 1 NC_003423.3 SUMO E1-like activator enzyme Fub2 2297089 fub2 2539967 fub2 Schizosaccharomyces pombe 972h- SUMO E1-like activator enzyme Fub2 NP_595945.1 2295031 D 284812 CDS SPBC16H5.02 19112738 2539972 complement(2297466..2300294) 1 NC_003423.3 6-phosphofructokinase (predicted) 2300294 pfk1 2539972 pfk1 Schizosaccharomyces pombe 972h- 6-phosphofructokinase (predicted) NP_595946.1 2297466 R 284812 CDS SPBC12D12.01 162312233 2539914 2304182..2305726 1 NC_003423.3 YJL019W (Ned98) is reciprocal best hit (blast), ordered hsps, has conserved residues with other orthologs, both have 1 TMM, functionally similar; spindle pole body protein Sad1 2305726 sad1 2539914 sad1 Schizosaccharomyces pombe 972h- spindle pole body protein Sad1 NP_595947.2 2304182 D 284812 CDS SPBC12D12.02c 19112740 2540008 complement(2305758..2306240) 1 NC_003423.3 DNA polymerase delta subunit Cdm1 2306240 cdm1 2540008 cdm1 Schizosaccharomyces pombe 972h- DNA polymerase delta subunit Cdm1 NP_595948.1 2305758 R 284812 CDS SPBC12D12.03 19112741 2539691 join(2307436..2307466,2307515..2307562,2307601..2307686,2307931..2309436) 1 NC_003423.3 chaperonin-containing T-complex alpha subunit Cct1 2309436 cct1 2539691 cct1 Schizosaccharomyces pombe 972h- chaperonin-containing T-complex alpha subunit Cct1 NP_595949.1 2307436 D 284812 CDS SPBC12D12.04c 19112742 2539649 complement(2309787..2312837) 1 NC_003423.3 protein kinase C (PKC)-like Pck2 2312837 pck2 2539649 pck2 Schizosaccharomyces pombe 972h- protein kinase C (PKC)-like Pck2 NP_595950.1 2309787 R 284812 CDS SPBC12D12.09 162312235 2540106 join(2313544..2313574,2313624..2313650,2313694..2313744,2313785..2313897,2313940..2314055,2314104..2314207,2314277..2314476) 1 NC_003423.3 added new exon to insert KCIDIFGEF, pers. comm. Nicole Kosarek; date=20060801; truncated punultimate exon to remove GIN, pers. comm. Nicole Kosarek; date=20060801; DNA polymerase zeta Rev7 (predicted) 2314476 rev7 2540106 rev7 Schizosaccharomyces pombe 972h- DNA polymerase zeta Rev7 (predicted) XP_001713135.1 2313544 D 284812 CDS SPBC12D12.05c 19112744 2539713 complement(join(2314669..2315787,2315825..2315986)) 1 NC_003423.3 final exon possibly incorrect; overlaps opposite strand prediction; mitochondrial carrier, calcium binding subfamily 2315986 2539713 SPBC12D12.05c Schizosaccharomyces pombe 972h- mitochondrial carrier, calcium binding subfamily NP_595952.1 2314669 R 284812 CDS SPBC12D12.06 19112745 2539651 join(2316168..2316199,2316612..2316691,2316770..2317136,2317201..2317408) 1 NC_003423.3 cyclin CycC, Srb mediator subunit Srb11 2317408 srb11 2539651 srb11 Schizosaccharomyces pombe 972h- cyclin CycC, Srb mediator subunit Srb11 NP_595953.1 2316168 D 284812 CDS SPBC12D12.07c 19112746 2539898 complement(join(2317984..2318251,2318334..2318431)) 1 NC_003423.3 mitochondrial thioredoxin Trx2 2318431 trx2 2539898 trx2 Schizosaccharomyces pombe 972h- mitochondrial thioredoxin Trx2 NP_595954.1 2317984 R 284812 CDS SPBC12D12.08c 19112747 2540129 complement(join(2319851..2319938,2319989..2320101,2320173..2320190,2320239..2320256)) 1 NC_003423.3 ubiquitin-like protein modifier Ned8 2320256 ned8 2540129 ned8 Schizosaccharomyces pombe 972h- ubiquitin-like protein modifier Ned8 NP_595955.1 2319851 R 284812 CDS SPBC24C6.02 19112748 2540598 join(2320383..2320417,2320547..2322332) 1 NC_003423.3 ATP-dependent RNA helicase Spb4 (predicted) 2322332 2540598 SPBC24C6.02 Schizosaccharomyces pombe 972h- ATP-dependent RNA helicase Spb4 (predicted) NP_595956.1 2320383 D 284812 CDS SPBC24C6.03 19112749 2540642 2323024..2324301 1 NC_003423.3 mitochondrial proline-tRNA ligase (predicted) 2324301 2540642 SPBC24C6.03 Schizosaccharomyces pombe 972h- mitochondrial proline-tRNA ligase (predicted) NP_595957.1 2323024 D 284812 CDS SPBC24C6.04 19112750 2540387 2325256..2326902 1 NC_003423.3 delta-1-pyrroline-5-carboxylate dehydrogenase 2326902 2540387 SPBC24C6.04 Schizosaccharomyces pombe 972h- delta-1-pyrroline-5-carboxylate dehydrogenase NP_595958.1 2325256 D 284812 CDS SPBC24C6.05 19112751 2540317 join(2327506..2327536,2327581..2328416) 1 NC_003423.3 coatomer epsilon subunit (predicted) 2328416 sec28 2540317 sec28 Schizosaccharomyces pombe 972h- coatomer epsilon subunit (predicted) NP_595959.1 2327506 D 284812 CDS SPBC24C6.06 19112752 2540414 2330338..2331561 1 NC_003423.3 G-protein alpha subunit 2331561 gpa1 2540414 gpa1 Schizosaccharomyces pombe 972h- G-protein alpha subunit NP_595960.1 2330338 D 284812 CDS SPBC24C6.07 19112753 2540624 2332270..2332992 1 NC_003423.3 SIN component Cdc14 2332992 cdc14 2540624 cdc14 Schizosaccharomyces pombe 972h- SIN component Cdc14 NP_595961.1 2332270 D 284812 CDS SPBC24C6.08c 19112754 2540297 complement(2333174..2334277) 1 NC_003423.3 vesicle coat protein, folliculin (predicted) 2334277 2540297 SPBC24C6.08c Schizosaccharomyces pombe 972h- vesicle coat protein, folliculin (predicted) NP_595962.1 2333174 R 284812 CDS SPBC24C6.09c 19112755 2540545 complement(2335262..2337739) 1 NC_003423.3 phosphoketolase family protein (predicted) 2337739 2540545 SPBC24C6.09c Schizosaccharomyces pombe 972h- phosphoketolase family protein (predicted) NP_595963.1 2335262 R 284812 CDS SPBC24C6.10c 19112756 2540504 complement(join(2341811..2342790,2342911..2343000,2343096..2343150)) 1 NC_003423.3 conserved cytoskeletal protein 2343150 2540504 SPBC24C6.10c Schizosaccharomyces pombe 972h- conserved cytoskeletal protein NP_595964.1 2341811 R 284812 CDS SPBC24C6.11 19112757 2540434 join(2343704..2343735,2343806..2344185,2344230..2344258) 1 NC_003423.3 G10 protein 2344258 cwf14 2540434 cwf14 Schizosaccharomyces pombe 972h- G10 protein NP_595965.1 2343704 D 284812 CDS SPBC19G7.01c 162312237 2540695 complement(join(2344457..2347291,2347386..2347468,2347512..2347542)) 1 NC_003423.3 MutS protein homolog 2 2347542 msh2 2540695 msh2 Schizosaccharomyces pombe 972h- MutS protein homolog 2 XP_001713136.1 2344457 R 284812 CDS SPBC19G7.02 19112760 2540662 join(2348284..2348457,2348505..2348811,2348898..2349112) 1 NC_003423.3 possible N terminal incorrect; 4-amino-4-deoxychorismate lyase (predicted) 2349112 2540662 SPBC19G7.02 Schizosaccharomyces pombe 972h- 4-amino-4-deoxychorismate lyase (predicted) NP_595968.1 2348284 D 284812 CDS SPBC19G7.03c 19112761 2540609 complement(join(2349078..2349095,2349219..2349347,2349397..2349435)) 1 NC_003423.3 40S ribosomal protein S30 2349435 rps3002 2540609 rps3002 Schizosaccharomyces pombe 972h- 40S ribosomal protein S30 NP_595969.1 2349078 R 284812 CDS SPBC19G7.04 19112762 2540683 join(2349593..2349654,2349697..2350344,2350388..2350766) 1 NC_003423.3 HMG box protein 2350766 2540683 SPBC19G7.04 Schizosaccharomyces pombe 972h- HMG box protein NP_595970.1 2349593 D 284812 CDS SPBC19G7.05c 19112763 2540737 complement(2351054..2356243) 1 NC_003423.3 1,3-beta-glucan synthase catalytic subunit Bgs1 2356243 bgs1 2540737 bgs1 Schizosaccharomyces pombe 972h- 1,3-beta-glucan synthase catalytic subunit Bgs1 NP_595971.1 2351054 R 284812 CDS SPBC19G7.06 295442857 2540643 join(2359429..2359479,2359547..2359693,2359845..2359928,2360001..2361092) 1 NC_003423.3 Mads BoX protein 1; gene structure updated 01-12-07, pers. comm. Chris McInerny; MADS-box transcription factor Mbx1 2361092 mbx1 2540643 mbx1 Schizosaccharomyces pombe 972h- MADS-box transcription factor Mbx1 NP_595972.2 2359429 D 284812 CDS SPBC19G7.07c 19112765 2540724 complement(join(2361195..2363003,2363086..2363340)) 1 NC_003423.3 mitochondrial group I intron splicing factor (predicted) 2363340 2540724 SPBC19G7.07c Schizosaccharomyces pombe 972h- mitochondrial group I intron splicing factor (predicted) NP_595973.1 2361195 R 284812 CDS SPBC19G7.08c 19112766 2540742 complement(2364279..2365730) 1 NC_003423.3 arrestin family protein 2365730 2540742 SPBC19G7.08c Schizosaccharomyces pombe 972h- arrestin family protein NP_595974.1 2364279 R 284812 CDS SPBC19G7.09 19112767 2540734 2367117..2368823 1 NC_003423.3 SUMO deconjugating enzyme Ulp1 2368823 ulp1 2540734 ulp1 Schizosaccharomyces pombe 972h- SUMO deconjugating enzyme Ulp1 NP_595975.1 2367117 D 284812 CDS SPBC19G7.10c 295442859 2540778 complement(join(2369064..2369190,2369246..2369416,2369455..2371243,2371351..2371451,2371507..2371583)) 1 NC_003423.3 topoisomerase II-associated deadenylation-dependent mRNA-decapping factor (predicted) 2371583 2540778 SPBC19G7.10c Schizosaccharomyces pombe 972h- topoisomerase II-associated deadenylation-dependent mRNA-decapping factor (predicted) NP_595976.2 2369064 R 284812 CDS SPBC19G7.18c 68012095 3361193 complement(join(2372072..2372611,2372658..2372728,2372777..2372924)) 1 NC_003423.3 overlaps with SPBC19G7.12c, one isn't real; SPBC19G7.12c removed because sequence similarity supports SPBC19G7.18c, 20040914; sequence orphan 2372924 3361193 SPBC19G7.18c Schizosaccharomyces pombe 972h- sequence orphan NP_001018812.1 2372072 R 284812 CDS SPBC19G7.13 19112771 2540732 2374174..2375631 1 NC_003423.3 DNA binding factor Trf1 2375631 tbf1 2540732 tbf1 Schizosaccharomyces pombe 972h- DNA binding factor Trf1 NP_595979.1 2374174 D 284812 CDS SPBC19G7.14c 19112772 2540782 complement(join(2375740..2376447,2376488..2376560,2376610..2377064)) 1 NC_003423.3 Golgi transport complex subunit Cog5 (predicted) 2377064 cog5 2540782 cog5 Schizosaccharomyces pombe 972h- Golgi transport complex subunit Cog5 (predicted) NP_595980.1 2375740 R 284812 CDS SPBC19G7.15 19112773 2540775 join(2378035..2378050,2378095..2379290) 1 NC_003423.3 nucleoporin Nup44 2379290 nup44 2540775 nup44 Schizosaccharomyces pombe 972h- nucleoporin Nup44 NP_595981.1 2378035 D 284812 CDS SPBC19G7.16 19112774 2540721 2380663..2381949 1 NC_003423.3 transcription elongation factor complex subunit Iws1 (predicted) 2381949 iws1 2540721 iws1 Schizosaccharomyces pombe 972h- transcription elongation factor complex subunit Iws1 (predicted) NP_595982.1 2380663 D 284812 CDS SPBC19G7.17 63054754 2540769 join(2382465..2382474,2382526..2382593,2382663..2382775,2382820..2382852,2383028..2383161,2383208..2384277) 1 NC_003423.3 translocon subunit Sec61 homolog (predicted) 2384277 2540769 SPBC19G7.17 Schizosaccharomyces pombe 972h- translocon subunit Sec61 homolog (predicted) NP_595983.2 2382465 D 284812 CDS SPBC36B7.02 19112776 2540943 2385439..2386500 1 NC_003423.3 Svf1 family protein Svf2 2386500 2540943 SPBC36B7.02 Schizosaccharomyces pombe 972h- Svf1 family protein Svf2 NP_595984.1 2385439 D 284812 CDS SPBC36B7.03 19112777 2540961 join(2387093..2387207,2387258..2387348,2387409..2389038) 1 NC_003423.3 ER protein translocation subcomplex subunit Sec63 (predicted) 2389038 sec63 2540961 sec63 Schizosaccharomyces pombe 972h- ER protein translocation subcomplex subunit Sec63 (predicted) NP_595985.1 2387093 D 284812 CDS SPBC36B7.04 19112778 2541048 2389667..2390866 1 NC_003423.3 tRNA dihydrouridine synthase Dus1 (predicted) 2390866 2541048 SPBC36B7.04 Schizosaccharomyces pombe 972h- tRNA dihydrouridine synthase Dus1 (predicted) NP_595986.1 2389667 D 284812 CDS SPBC36B7.05c 19112779 2540987 complement(2391258..2392097) 1 NC_003423.3 ubiquitin-protein ligase E/phosphatidylinositol(3)-phosphate binding protein (predicted) 2392097 2540987 SPBC36B7.05c Schizosaccharomyces pombe 972h- ubiquitin-protein ligase E/phosphatidylinositol(3)-phosphate binding protein (predicted) NP_595987.1 2391258 R 284812 CDS SPBC36B7.06c 19112780 2540990 complement(join(2392551..2392926,2392970..2393103)) 1 NC_003423.3 sequence orphan 2393103 mug20 2540990 mug20 Schizosaccharomyces pombe 972h- sequence orphan NP_595988.1 2392551 R 284812 CDS SPBC36B7.07 19112781 2540973 join(2393674..2393702,2393794..2394442) 1 NC_003423.3 SNARE Tgl1 2394442 tlg1 2540973 tlg1 Schizosaccharomyces pombe 972h- SNARE Tgl1 NP_595989.1 2393674 D 284812 CDS SPBC36B7.08c 19112782 2540967 complement(join(2394575..2394609,2394703..2395218,2395288..2395398,2395489..2395561)) 1 NC_003423.3 nucleosome assembly protein (predicted) 2395561 2540967 SPBC36B7.08c Schizosaccharomyces pombe 972h- nucleosome assembly protein (predicted) NP_595990.1 2394575 R 284812 CDS SPBC36B7.09 63054755 2540500 join(2396675..2396791,2396841..2401454) 1 NC_003423.3 eIF2 alpha kinase Gcn2 2401454 gcn2 2540500 gcn2 Schizosaccharomyces pombe 972h- eIF2 alpha kinase Gcn2 NP_595991.2 2396675 D 284812 CDS SPBP18G5.02 19112784 2541243 join(2401753..2402237,2402275..2403394) 1 NC_003423.3 CDP-diacylglycerol-glycerol-3-phosphate3- phosphat idyltransferase 2403394 2541243 SPBP18G5.02 Schizosaccharomyces pombe 972h- CDP-diacylglycerol-glycerol-3-phosphate3- phosphat idyltransferase NP_595992.1 2401753 D 284812 CDS SPBP18G5.03 19112785 2541310 join(2403581..2403703,2403746..2404915) 1 NC_003423.3 Tor Complex Tor2 interacting protein 1 2404915 toc1 2541310 toc1 Schizosaccharomyces pombe 972h- Tor Complex Tor2 interacting protein 1 NP_595993.1 2403581 D 284812 CDS SPBC1921.01c 162312239 3361295 complement(join(2405504..2405621,2405753..2405961)) 1 NC_003423.3 60S ribosomal protein L35a 2405961 rpl35b 3361295 rpl35b Schizosaccharomyces pombe 972h- 60S ribosomal protein L35a NP_001018813.2 2405504 R 284812 CDS SPBC1921.02 19112787 2540802 join(2406832..2406934,2406985..2408102) 1 NC_003423.3 orthology with Rad60, pers. comm. Charly Chahwan; DNA repair protein Rad60 2408102 rad60 2540802 rad60 Schizosaccharomyces pombe 972h- DNA repair protein Rad60 NP_595995.1 2406832 D 284812 CDS SPBC1921.03c 19112788 2540727 complement(2408304..2410094) 1 NC_003423.3 mRNA export receptor, Tap Mex67 2410094 mex67 2540727 mex67 Schizosaccharomyces pombe 972h- mRNA export receptor, Tap Mex67 NP_595996.1 2408304 R 284812 CDS SPBC1921.04c 19112789 2540844 complement(2411051..2411404) 1 NC_003423.3 previously annotated as dubious, but has localization signal; opposite sno20; sequence orphan 2411404 2540844 SPBC1921.04c Schizosaccharomyces pombe 972h- sequence orphan NP_595997.1 2411051 R 284812 CDS SPBC1921.05 19112790 2540648 2413507..2416155 1 NC_003423.3 aminopeptidase Ape2 2416155 ape2 2540648 ape2 Schizosaccharomyces pombe 972h- aminopeptidase Ape2 NP_595998.1 2413507 D 284812 CDS SPBC1921.06c 19112791 2540827 complement(2417166..2418302) 1 NC_003423.3 beta-1,3-galactosyltransferase 2418302 pvg3 2540827 pvg3 Schizosaccharomyces pombe 972h- beta-1,3-galactosyltransferase NP_595999.1 2417166 R 284812 CDS SPBC1921.07c 63054758 2540787 complement(join(2419146..2419431,2419533..2419981)) 1 NC_003423.3 SAGA complex subunit Sgf29 (predicted) 2419981 sgf29 2540787 sgf29 Schizosaccharomyces pombe 972h- SAGA complex subunit Sgf29 (predicted) NP_596000.2 2419146 R 284812 CDS SPBC21D10.12 19112793 2540633 complement(join(2420790..2420858,2420927..2422258)) 1 NC_003423.3 BAR adaptor protein Hob1 2422258 hob1 2540633 hob1 Schizosaccharomyces pombe 972h- BAR adaptor protein Hob1 NP_596001.1 2420790 R 284812 CDS SPBC21D10.11c 19112794 2540403 2422769..2424265 1 NC_003423.3 iron-sulfur cluster assembly protein Nfs1 2424265 nfs1 2540403 nfs1 Schizosaccharomyces pombe 972h- iron-sulfur cluster assembly protein Nfs1 NP_596002.1 2422769 D 284812 CDS SPBC21D10.10 19112795 2540686 complement(2424574..2425473) 1 NC_003423.3 bromodomain containing protein 1, Bdc1 2425473 bdc1 2540686 bdc1 Schizosaccharomyces pombe 972h- bromodomain containing protein 1, Bdc1 NP_596003.1 2424574 R 284812 CDS SPBC21D10.09c 19112796 2540629 join(2426567..2426595,2426785..2431588) 1 NC_003423.3 NAS from PMID: 17283062, not yet annotated at SGD; ubiquitin-protein ligase E3 (predicted) 2431588 2540629 SPBC21D10.09c Schizosaccharomyces pombe 972h- ubiquitin-protein ligase E3 (predicted) NP_596004.1 2426567 D 284812 CDS SPBC21D10.08c 19112797 2540687 join(2432142..2432227,2432278..2433025) 1 NC_003423.3 sequence orphan 2433025 2540687 SPBC21D10.08c Schizosaccharomyces pombe 972h- sequence orphan NP_596005.1 2432142 D 284812 CDS SPBC21D10.07 19112798 2540486 complement(join(2433110..2433280,2433339..2433482)) 1 NC_003423.3 mitochondrial inner membrane protein involved in cytochrome oxidase biogenesis Cmc1 (predicted) 2433482 cmc1 2540486 cmc1 Schizosaccharomyces pombe 972h- mitochondrial inner membrane protein involved in cytochrome oxidase biogenesis Cmc1 (predicted) NP_596006.1 2433110 R 284812 CDS SPBC21D10.06c 19112799 2540608 2435636..2438482 1 NC_003423.3 map4 designation (pers. comm. Yoshiyuki Imai and Masayuki Yamamoto); WARNING: Map4 in GeneDB contains an array of 5 repeats. In PMID:16857197 9 repeats are reported and this number is the correct number of repeats and will be updated via an insertion into the contig sequence shortly; cell surface agglutination protein Map4 2438482 map4 2540608 map4 Schizosaccharomyces pombe 972h- cell surface agglutination protein Map4 NP_596007.1 2435636 D 284812 CDS SPBC21D10.05c 19112800 2540709 join(2439122..2439236,2439280..2439386,2439456..2439550,2439646..2441134) 1 NC_003423.3 multicopy suppressor of Cdc2 (pers. comm. Nancy Walworth); GTPase activating protein Ucp3 (predicted) 2441134 ucp3 2540709 ucp3 Schizosaccharomyces pombe 972h- GTPase activating protein Ucp3 (predicted) NP_596008.1 2439122 D 284812 CDS SPBC12C2.13c 19112801 2539786 2444329..2445924 1 NC_003423.3 vacuolar membrane amino acid uptake transporter Fnx1 2445924 fnx1 2539786 fnx1 Schizosaccharomyces pombe 972h- vacuolar membrane amino acid uptake transporter Fnx1 NP_596009.1 2444329 D 284812 CDS SPBC12C2.12c 19112802 2539736 2446698..2447606 1 NC_003423.3 glyoxalase I 2447606 glo1 2539736 glo1 Schizosaccharomyces pombe 972h- glyoxalase I NP_596010.1 2446698 D 284812 CDS SPBC12C2.11 19112803 2539622 complement(join(2448491..2450505,2450711..2450781,2450850..2450854)) 1 NC_003423.3 glutamine-fructose-6-phosphate transaminase (predicted) 2450854 2539622 SPBC12C2.11 Schizosaccharomyces pombe 972h- glutamine-fructose-6-phosphate transaminase (predicted) NP_596011.1 2448491 R 284812 CDS SPBC12C2.10c 63054759 2540018 join(2452052..2452181,2452319..2456757) 1 NC_003423.3 Clr6 histone deacetylase complex subunit Pst1 2456757 pst1 2540018 pst1 Schizosaccharomyces pombe 972h- Clr6 histone deacetylase complex subunit Pst1 NP_596012.2 2452052 D 284812 CDS SPBC12C2.09c 19112805 2539931 2457715..2458689 1 NC_003423.3 Haemolysin-III family protein 2458689 2539931 SPBC12C2.09c Schizosaccharomyces pombe 972h- Haemolysin-III family protein NP_596013.1 2457715 D 284812 CDS SPBC12C2.08 19112806 2540159 complement(join(2459019..2461225,2461357..2461495)) 1 NC_003423.3 dynamin Dnm1 2461495 dnm1 2540159 dnm1 Schizosaccharomyces pombe 972h- dynamin Dnm1 NP_596014.1 2459019 R 284812 CDS SPBC12C2.07c 19112807 2539919 2463200..2464096 1 NC_003423.3 spermidine synthase (predicted) 2464096 2539919 SPBC12C2.07c Schizosaccharomyces pombe 972h- spermidine synthase (predicted) NP_596015.1 2463200 D 284812 CDS SPBC12C2.06 19112808 2539975 complement(2464347..2465858) 1 NC_003423.3 ATP-dependent RNA helicase Dbp5 2465858 2539975 SPBC12C2.06 Schizosaccharomyces pombe 972h- ATP-dependent RNA helicase Dbp5 NP_596016.1 2464347 R 284812 CDS SPBC12C2.05c 19112809 2539679 join(2466173..2466211,2466256..2466282,2466337..2466400,2466452..2466572,2466651..2467687,2467734..2468090,2468134..2468398,2468467..2468485) 1 NC_003423.3 diacylglycerol binding protein Bzz1 (predicted) 2468485 2539679 SPBC12C2.05c Schizosaccharomyces pombe 972h- diacylglycerol binding protein Bzz1 (predicted) NP_596017.1 2466173 D 284812 CDS SPBC12C2.04 19112810 2539816 complement(2469061..2470215) 1 NC_003423.3 NAD binding dehydrogenase family protein 2470215 2539816 SPBC12C2.04 Schizosaccharomyces pombe 972h- NAD binding dehydrogenase family protein NP_596018.1 2469061 R 284812 CDS SPBC12C2.14c 19112811 2539897 complement(2471721..2472056) 1 NC_003423.3 dubious 2472056 2539897 SPBC12C2.14c Schizosaccharomyces pombe 972h- dubious NP_596019.1 2471721 R 284812 CDS SPBC12C2.03c 19112812 2540152 2473630..2475345 1 NC_003423.3 FAD binding protein (predicted) 2475345 2540152 SPBC12C2.03c Schizosaccharomyces pombe 972h- FAD binding protein (predicted) NP_596020.1 2473630 D 284812 CDS SPBC12C2.02c 19112813 2539845 2476139..2480068 1 NC_003423.3 appears to contain a PF00618 domain below threshold (which is present in S. cerevisiae), but it isn't certain whether this is a GEF as it doesn't appear to have the usually co-occuring PF00617; date=20061012; Rictor homolog, Ste20 2480068 ste20 2539845 ste20 Schizosaccharomyces pombe 972h- Rictor homolog, Ste20 NP_596021.1 2476139 D 284812 CDS SPBC12C2.01c 162312241 3361298 2480931..2481887 1 NC_003423.3 sequence orphan 2481887 3361298 SPBC12C2.01c Schizosaccharomyces pombe 972h- sequence orphan NP_001018815.2 2480931 D 284812 CDS SPBC17F3.02 19112815 2539963 complement(join(2482246..2483637,2483703..2484189,2484241..2484320)) 1 NC_003423.3 PAK-related kinase Nak1 2484320 nak1 2539963 nak1 Schizosaccharomyces pombe 972h- PAK-related kinase Nak1 NP_596023.1 2482246 R 284812 CDS SPBC17F3.01c 162312243 2539707 2486807..2487892 1 NC_003423.3 Rho-type GTPase activating protein Rga5 2487892 rga5 2539707 rga5 Schizosaccharomyces pombe 972h- Rho-type GTPase activating protein Rga5 NP_596024.2 2486807 D 284812 CDS SPBC557.02c 19112817 2540912 complement(2488325..2488936) 1 NC_003423.3 conserved fungal protein 2488936 2540912 SPBC557.02c Schizosaccharomyces pombe 972h- conserved fungal protein NP_596025.1 2488325 R 284812 CDS SPBC557.03c 19112818 2541059 complement(join(2489034..2490047,2490223..2490828)) 1 NC_003423.3 GDP/GTP exchange factor (RanGEF) 2490828 pim1 2541059 pim1 Schizosaccharomyces pombe 972h- GDP/GTP exchange factor (RanGEF) NP_596026.1 2489034 R 284812 CDS SPBC557.04 19112819 2541080 join(2492048..2492147,2492220..2492353,2492393..2494777) 1 NC_003423.3 Ark1/Prk1 family protein kinase Ppk29 2494777 ppk29 2541080 ppk29 Schizosaccharomyces pombe 972h- Ark1/Prk1 family protein kinase Ppk29 NP_596027.1 2492048 D 284812 CDS SPBC557.05 19112820 2540843 join(2495224..2495738,2495781..2496353,2496397..2496610) 1 NC_003423.3 arrestin 2496610 2540843 SPBC557.05 Schizosaccharomyces pombe 972h- arrestin NP_596028.1 2495224 D 284812 CDS SPBC365.20c 162312245 2540906 complement(2496844..2497506) 1 NC_003423.3 nicotinamidase (predicted) 2497506 2540906 SPBC365.20c Schizosaccharomyces pombe 972h- nicotinamidase (predicted) NP_596029.2 2496844 R 284812 CDS SPBC365.01 19112822 2541046 2499835..2500902 1 NC_003423.3 sec14 cytosolic factor family 2500902 2541046 SPBC365.01 Schizosaccharomyces pombe 972h- sec14 cytosolic factor family NP_596030.1 2499835 D 284812 CDS SPBC365.02c 19112823 2540944 complement(2501402..2502565) 1 NC_003423.3 protoheme IX farnesyltransferase 2502565 cox10 2540944 cox10 Schizosaccharomyces pombe 972h- protoheme IX farnesyltransferase NP_596031.1 2501402 R 284812 CDS SPBC365.03c 19112824 2540950 complement(2503268..2503750) 1 NC_003423.3 60S ribosomal protein L21 2503750 rpl2101 2540950 rpl2101 Schizosaccharomyces pombe 972h- 60S ribosomal protein L21 NP_596032.1 2503268 R 284812 CDS SPBC365.04c 19112825 2540924 complement(2504297..2504998) 1 NC_003423.3 RNA-binding protein, involved in ribosome biogenesis (predicted) 2504998 2540924 SPBC365.04c Schizosaccharomyces pombe 972h- RNA-binding protein, involved in ribosome biogenesis (predicted) NP_596033.1 2504297 R 284812 CDS SPBC365.05c 19112826 2540941 complement(2505307..2506446) 1 NC_003423.3 splicing factor Slu7 2506446 slu7 2540941 slu7 Schizosaccharomyces pombe 972h- splicing factor Slu7 NP_596034.1 2505307 R 284812 CDS SPBC365.06 19112827 2540927 join(2506894..2507022,2507117..2507266,2507316..2507390) 1 NC_003423.3 SUMO 2507390 pmt3 2540927 pmt3 Schizosaccharomyces pombe 972h- SUMO NP_596035.1 2506894 D 284812 CDS SPBC365.07c 19112828 2540931 complement(2507560..2509203) 1 NC_003423.3 TATA element modulatory factor homolog (predicted) 2509203 2540931 SPBC365.07c Schizosaccharomyces pombe 972h- TATA element modulatory factor homolog (predicted) NP_596036.1 2507560 R 284812 CDS SPBC365.08c 19112829 2541072 complement(join(2509659..2510000,2510051..2510145,2510197..2510434)) 1 NC_003423.3 Der1-like (degradation in the ER) family 2510434 2541072 SPBC365.08c Schizosaccharomyces pombe 972h- Der1-like (degradation in the ER) family NP_596037.1 2509659 R 284812 CDS SPBC365.09c 19112830 2540949 complement(2510785..2511699) 1 NC_003423.3 human KIN homolog 2511699 2540949 SPBC365.09c Schizosaccharomyces pombe 972h- human KIN homolog NP_596038.1 2510785 R 284812 CDS SPBC365.10 19112831 2541031 join(2512667..2512760,2512816..2514887) 1 NC_003423.3 actin-like protein Arp5 2514887 arp5 2541031 arp5 Schizosaccharomyces pombe 972h- actin-like protein Arp5 NP_596039.1 2512667 D 284812 CDS SPBC365.11 19112832 2541057 2515260..2516060 1 NC_003423.3 GRIP domain protein 2516060 2541057 SPBC365.11 Schizosaccharomyces pombe 972h- GRIP domain protein NP_596040.1 2515260 D 284812 CDS SPBC365.12c 19112833 2540959 complement(2516249..2518303) 1 NC_003423.3 LEA domain protein 2518303 ish1 2540959 ish1 Schizosaccharomyces pombe 972h- LEA domain protein NP_596041.1 2516249 R 284812 CDS SPBC365.13c 19112834 2540948 complement(2519571..2520770) 1 NC_003423.3 deletion induces nuclear accumulation of Pap1p and Sty1p (PMID:12896976); Ran GTPase binding protein Hba1 2520770 hba1 2540948 hba1 Schizosaccharomyces pombe 972h- Ran GTPase binding protein Hba1 NP_596042.1 2519571 R 284812 CDS SPBC365.14c 19112835 2540938 complement(join(2521623..2522624,2522793..2522855,2522923..2522925)) 1 NC_003423.3 UDP-glucose 4-epimerase (predicted) 2522925 2540938 SPBC365.14c Schizosaccharomyces pombe 972h- UDP-glucose 4-epimerase (predicted) NP_596043.1 2521623 R 284812 CDS SPBC365.15 19112836 2540392 2524061..2526415 1 NC_003423.3 gamma tubulin complex Spc97/GCP2 subunit Alp4 2526415 alp4 2540392 alp4 Schizosaccharomyces pombe 972h- gamma tubulin complex Spc97/GCP2 subunit Alp4 NP_596044.1 2524061 D 284812 CDS SPBC365.16 19112837 2540964 2530988..2531821 1 NC_003423.3 sequence orphan 2531821 2540964 SPBC365.16 Schizosaccharomyces pombe 972h- sequence orphan NP_596045.1 2530988 D 284812 CDS SPBC29A10.01 19112838 2541038 2533463..2535499 1 NC_003423.3 NADPH-cytochrome p450 reductase 2535499 ccr1 2541038 ccr1 Schizosaccharomyces pombe 972h- NADPH-cytochrome p450 reductase NP_596046.1 2533463 D 284812 CDS SPBC29A10.02 19112839 2540637 join(2536221..2536450,2536499..2536842,2536898..2538027) 1 NC_003423.3 NAS from AB248101; meiotic RNA-binding protein 1 2538027 spo5 2540637 spo5 Schizosaccharomyces pombe 972h- meiotic RNA-binding protein 1 NP_596047.1 2536221 D 284812 CDS SPBC29A10.03c 162312247 2540554 complement(2538319..2539953) 1 NC_003423.3 CAF assembly factor (CAF-1) complex large subunit Pcf1 2539953 pcf1 2540554 pcf1 Schizosaccharomyces pombe 972h- CAF assembly factor (CAF-1) complex large subunit Pcf1 NP_596048.2 2538319 R 284812 CDS SPBC29A10.04 19112841 2540557 2540743..2544444 1 NC_003423.3 mitotic cohesin complex subunit Psm1 2544444 psm1 2540557 psm1 Schizosaccharomyces pombe 972h- mitotic cohesin complex subunit Psm1 NP_596049.1 2540743 D 284812 CDS SPBC29A10.05 19112842 2540348 2545549..2547264 1 NC_003423.3 exonuclease I Exo1 2547264 exo1 2540348 exo1 Schizosaccharomyces pombe 972h- exonuclease I Exo1 NP_596050.1 2545549 D 284812 CDS SPBC29A10.06c 19112843 2540543 complement(join(2547516..2547812,2547869..2548072,2548180..2548566)) 1 NC_003423.3 conserved fungal protein 2548566 2540543 SPBC29A10.06c Schizosaccharomyces pombe 972h- conserved fungal protein NP_596051.1 2547516 R 284812 CDS SPBC29A10.07 19112844 2540429 2548695..2552447 1 NC_003423.3 nucleoporin Pom152 2552447 2540429 SPBC29A10.07 Schizosaccharomyces pombe 972h- nucleoporin Pom152 NP_596052.1 2548695 D 284812 CDS SPBC29A10.08 19112845 2540287 2554047..2555426 1 NC_003423.3 1,3-beta-glucanosyltransferase Gas2 (predicted) 2555426 gas2 2540287 gas2 Schizosaccharomyces pombe 972h- 1,3-beta-glucanosyltransferase Gas2 (predicted) NP_596053.1 2554047 D 284812 CDS SPBC29A10.09c 19112846 2540515 complement(2555664..2556947) 1 NC_003423.3 CAF1 family ribonuclease 2556947 2540515 SPBC29A10.09c Schizosaccharomyces pombe 972h- CAF1 family ribonuclease NP_596054.1 2555664 R 284812 CDS SPBC29A10.10c 19112847 2540523 complement(2557293..2563127) 1 NC_003423.3 tRNA-splicing endonuclease positive effector (predicted) 2563127 2540523 SPBC29A10.10c Schizosaccharomyces pombe 972h- tRNA-splicing endonuclease positive effector (predicted) NP_596055.1 2557293 R 284812 CDS SPBC29A10.11c 19112848 2540384 complement(join(2563926..2564748,2564797..2565182)) 1 NC_003423.3 PMID:16823372 predict a frameshift at base 1339; guanyl-nucleotide exchange factor Vps902 (predicted) 2565182 vps902 2540384 vps902 Schizosaccharomyces pombe 972h- guanyl-nucleotide exchange factor Vps902 (predicted) NP_596056.1 2563926 R 284812 CDS SPBC29A10.12 19112849 2540542 join(2566434..2566967,2567076..2567165) 1 NC_003423.3 functional inferences from Clan membership; HMG-box variant 2567165 2540542 SPBC29A10.12 Schizosaccharomyces pombe 972h- HMG-box variant NP_596057.1 2566434 D 284812 CDS SPBC29A10.13 19112850 2540446 2567701..2568228 1 NC_003423.3 F0-ATPase subunit D 2568228 atp7 2540446 atp7 Schizosaccharomyces pombe 972h- F0-ATPase subunit D NP_596058.1 2567701 D 284812 CDS SPBC29A10.14 19112851 2540458 join(2568938..2568993,2569037..2569224,2569277..2569373,2569426..2570675,2570716..2570810) 1 NC_003423.3 meiotic cohesin complex subunit Rec8 2570810 rec8 2540458 rec8 Schizosaccharomyces pombe 972h- meiotic cohesin complex subunit Rec8 NP_596059.1 2568938 D 284812 CDS SPBC29A10.15 19112852 2540470 join(2571162..2572048,2572101..2573337) 1 NC_003423.3 origin recognition complex subunit Orc1 2573337 orc1 2540470 orc1 Schizosaccharomyces pombe 972h- origin recognition complex subunit Orc1 NP_596060.1 2571162 D 284812 CDS SPBC29A10.17 295442861 9407127 join(2574032..2574093,2574137..2574214,2574277..2574487) 1 NC_003423.3 sequence orphan 2574487 9407127 SPBC29A10.17 Schizosaccharomyces pombe 972h- sequence orphan XP_002788941.1 2574032 D 284812 CDS SPBC29A10.16c 19112853 2540533 complement(join(2574822..2574894,2574943..2575096,2575281..2575428)) 1 NC_003423.3 cytochrome b5 (predicted) 2575428 2540533 SPBC29A10.16c Schizosaccharomyces pombe 972h- cytochrome b5 (predicted) NP_596061.1 2574822 R 284812 CDS SPBC2G5.01 19112854 2540360 2576621..2577745 1 NC_003423.3 DUF1682 family protein 2577745 2540360 SPBC2G5.01 Schizosaccharomyces pombe 972h- DUF1682 family protein NP_596062.1 2576621 D 284812 CDS SPBC2G5.02c 19112855 2540306 complement(2578317..2579081) 1 NC_003423.3 CK2 family regulatory subunit (predicted) 2579081 2540306 SPBC2G5.02c Schizosaccharomyces pombe 972h- CK2 family regulatory subunit (predicted) NP_596063.1 2578317 R 284812 CDS SPBC2G5.03 19112856 2540314 2581957..2582964 1 NC_003423.3 cytosolic thiouridylase subunit Ctu1 2582964 ctu1 2540314 ctu1 Schizosaccharomyces pombe 972h- cytosolic thiouridylase subunit Ctu1 NP_596064.1 2581957 D 284812 CDS SPBC2G5.04c 19112857 2540311 complement(2583234..2584235) 1 NC_003423.3 COPII-coated vesicle component Erv41 (predicted) 2584235 2540311 SPBC2G5.04c Schizosaccharomyces pombe 972h- COPII-coated vesicle component Erv41 (predicted) NP_596065.1 2583234 R 284812 CDS SPBC2G5.05 19112858 2540441 2586521..2588578 1 NC_003423.3 transketolase (predicted) 2588578 2540441 SPBC2G5.05 Schizosaccharomyces pombe 972h- transketolase (predicted) NP_596066.1 2586521 D 284812 CDS SPBC2G5.06c 19112859 2540326 complement(2589100..2590479) 1 NC_003423.3 sulfide-quinone oxidoreductase 2590479 hmt2 2540326 hmt2 Schizosaccharomyces pombe 972h- sulfide-quinone oxidoreductase NP_596067.1 2589100 R 284812 CDS SPBC2G5.07c 19112860 2540510 complement(join(2592258..2592305,2592440..2592708,2592760..2592846,2592963..2593170)) 1 NC_003423.3 DNA-directed RNA polymerase III complex subunit Rpc25 2593170 rpc25 2540510 rpc25 Schizosaccharomyces pombe 972h- DNA-directed RNA polymerase III complex subunit Rpc25 NP_596068.1 2592258 R 284812 CDS SPBC25B2.01 162312249 2540430 join(2594464..2594503,2594558..2594611,2594655..2596339) 1 NC_003423.3 elongation factor 1 alpha related protein 2596339 2540430 SPBC25B2.01 Schizosaccharomyces pombe 972h- elongation factor 1 alpha related protein XP_001713137.1 2594464 D 284812 CDS SPBC25B2.02c 162312251 2540405 complement(2596425..2600435) 1 NC_003423.3 SPCC663.03, pmd1 is more closely related to STE6; M-factor transporter Mam1 2600435 mam1 2540405 mam1 Schizosaccharomyces pombe 972h- M-factor transporter Mam1 NP_001018819.2 2596425 R 284812 CDS SPBC25B2.03 19112863 2540435 join(2602284..2602433,2602713..2604227) 1 NC_003423.3 zf-C3HC4 type zinc finger 2604227 2540435 SPBC25B2.03 Schizosaccharomyces pombe 972h- zf-C3HC4 type zinc finger NP_596071.1 2602284 D 284812 CDS SPBC25B2.04c 19112864 2540442 complement(join(2604654..2605021,2605113..2605731)) 1 NC_003423.3 mitochondrial ribosome assembly protein 2605731 2540442 SPBC25B2.04c Schizosaccharomyces pombe 972h- mitochondrial ribosome assembly protein NP_596072.1 2604654 R 284812 CDS SPBC25B2.05 19112865 2540544 2605970..2606953 1 NC_003423.3 rRNA processing protein Mis3 2606953 mis3 2540544 mis3 Schizosaccharomyces pombe 972h- rRNA processing protein Mis3 NP_596073.1 2605970 D 284812 CDS SPBC25B2.06c 19112866 2540546 complement(join(2607314..2608105,2608308..2608370)) 1 NC_003423.3 BTB/POZ domain protein Btb2 2608370 btb2 2540546 btb2 Schizosaccharomyces pombe 972h- BTB/POZ domain protein Btb2 NP_596074.1 2607314 R 284812 CDS SPBC25B2.07c 19112867 2540437 complement(2609038..2610543) 1 NC_003423.3 microtubule-associated protein 2610543 mug164 2540437 mug164 Schizosaccharomyces pombe 972h- microtubule-associated protein NP_596075.1 2609038 R 284812 CDS SPBC25B2.08 19112868 2540628 2612209..2612586 1 NC_003423.3 sequence orphan 2612586 2540628 SPBC25B2.08 Schizosaccharomyces pombe 972h- sequence orphan NP_596076.1 2612209 D 284812 CDS SPBC25B2.09c 19112869 2540548 complement(2613050..2614906) 1 NC_003423.3 given primary name mrs1 because rrs1 is used for SPBC29A3.16; mitochondrial and cytoplasmic arginine-tRNA ligase Rrs1/Mrs1 (predicted) 2614906 mrs1 2540548 mrs1 Schizosaccharomyces pombe 972h- mitochondrial and cytoplasmic arginine-tRNA ligase Rrs1/Mrs1 (predicted) NP_596077.1 2613050 R 284812 CDS SPBC25B2.10 19112870 2540631 2616521..2617444 1 NC_003423.3 Usp (universal stress protein) family protein 2617444 2540631 SPBC25B2.10 Schizosaccharomyces pombe 972h- Usp (universal stress protein) family protein NP_596078.1 2616521 D 284812 CDS SPBC25B2.11 19112871 2540355 join(2617862..2619052,2619089..2619228,2619276..2619336) 1 NC_003423.3 F-box protein Pof2 2619336 pof2 2540355 pof2 Schizosaccharomyces pombe 972h- F-box protein Pof2 NP_596079.1 2617862 D 284812 CDS SPBC1826.01c 162312253 2539633 complement(2619704..2625565) 1 NC_003423.3 overlaps and extends SPBC25B2.12.c & SPBC6B1.01c; TATA-binding protein associated factor Mot1 2625565 mot1 2539633 mot1 Schizosaccharomyces pombe 972h- TATA-binding protein associated factor Mot1 NP_596080.2 2619704 R 284812 CDS SPBC6B1.02 19112873 2541109 2627594..2630455 1 NC_003423.3 Ark1/Prk1 family protein kinase Ppk30 2630455 ppk30 2541109 ppk30 Schizosaccharomyces pombe 972h- Ark1/Prk1 family protein kinase Ppk30 NP_596081.1 2627594 D 284812 CDS SPBC6B1.03c 19112874 2541104 complement(join(2631042..2631394,2631436..2631805,2631872..2631967)) 1 NC_003423.3 WARNING: not sure whether this is a false positive for family/homology/ needs checking; Pal1 family protein 2631967 2541104 SPBC6B1.03c Schizosaccharomyces pombe 972h- Pal1 family protein NP_596082.1 2631042 R 284812 CDS SPBC6B1.04 19112875 2541155 2633025..2634290 1 NC_003423.3 monopolin-like complex subunit Mde4 2634290 mde4 2541155 mde4 Schizosaccharomyces pombe 972h- monopolin-like complex subunit Mde4 NP_596083.1 2633025 D 284812 CDS SPBC6B1.05c 19112876 2540790 complement(join(2634389..2634692,2634734..2635158,2635197..2635352,2635413..2635847,2635883..2636215,2636257..2636362,2636404..2636594)) 1 NC_003423.3 ubiquitin-like conjugating enzyme 2636594 2540790 SPBC6B1.05c Schizosaccharomyces pombe 972h- ubiquitin-like conjugating enzyme NP_596084.1 2634389 R 284812 CDS SPBC6B1.06c 19112877 2541157 complement(join(2637613..2639844,2639914..2640009)) 1 NC_003423.3 ubiquitin C-terminal hydrolase Ubp14 2640009 ubp14 2541157 ubp14 Schizosaccharomyces pombe 972h- ubiquitin C-terminal hydrolase Ubp14 NP_596085.1 2637613 R 284812 CDS SPBC6B1.07 19112878 2541185 2641990..2644710 1 NC_003423.3 U4/U6 x U5 tri-snRNP complex subunit Prp1 2644710 prp1 2541185 prp1 Schizosaccharomyces pombe 972h- U4/U6 x U5 tri-snRNP complex subunit Prp1 NP_596086.1 2641990 D 284812 CDS SPBC6B1.08c 19112879 2541179 complement(2645046..2646593) 1 NC_003423.3 2-oxoglutarate and Fe(II) dioxygenase domain containing protein 1 2646593 ofd1 2541179 ofd1 Schizosaccharomyces pombe 972h- 2-oxoglutarate and Fe(II) dioxygenase domain containing protein 1 NP_596087.1 2645046 R 284812 CDS SPBC6B1.12c 68012222 3361305 complement(join(2648070..2648316,2648385..2648464)) 1 NC_003423.3 SAGA complex subunit Sus1 (predicted) 2648464 sus1 3361305 sus1 Schizosaccharomyces pombe 972h- SAGA complex subunit Sus1 (predicted) NP_001018822.1 2648070 R 284812 CDS SPBC6B1.09c 68012224 3361306 complement(join(2648745..2649008,2649055..2650223,2650266..2650345,2650385..2650533,2650638..2650726,2650765..2650818,2650878..2650914)) 1 NC_003423.3 02.04.2002 prediction extended (V.W) by 4 N-terminal exons, this identified FHA domain; 07.03.2003 additional intron 25664..25705, and exon extension 25974..25988 (pers. comm. C. Chahwan); slr10 is an FHA domain mutant PMID:18378696; Mre11 complex subunit Nbs1 2650914 nbs1 3361306 nbs1 Schizosaccharomyces pombe 972h- Mre11 complex subunit Nbs1 NP_001018823.1 2648745 R 284812 CDS SPBC6B1.10 19112881 2541168 join(2651646..2651756,2651798..2652562,2652602..2653217,2653261..2653308,2653348..2653484) 1 NC_003423.3 splicing factor Prp17 2653484 prp17 2541168 prp17 Schizosaccharomyces pombe 972h- splicing factor Prp17 NP_596089.1 2651646 D 284812 CDS SPBC3E7.01 162312255 2541154 complement(2653545..2659343) 1 NC_003423.3 conjugation defect due to inefficient secretion of pheromone peptides; 1-phosphatidylinositol-3-phosphate 5-kinase Fab1 2659343 fab1 2541154 fab1 Schizosaccharomyces pombe 972h- 1-phosphatidylinositol-3-phosphate 5-kinase Fab1 NP_596090.2 2653545 R 284812 CDS SPBC3E7.02c 19112883 2540977 complement(2660490..2660921) 1 NC_003423.3 heat shock protein Hsp16 2660921 hsp16 2540977 hsp16 Schizosaccharomyces pombe 972h- heat shock protein Hsp16 NP_596091.1 2660490 R 284812 CDS SPBC3E7.05c 19112884 2541035 complement(join(2665666..2665722,2665761..2667293,2667333..2667395)) 1 NC_003423.3 human mitofilin (IMMT) ortholog 2667395 2541035 SPBC3E7.05c Schizosaccharomyces pombe 972h- human mitofilin (IMMT) ortholog NP_596092.1 2665666 R 284812 CDS SPBC3E7.06c 19112885 2541016 complement(2668207..2669940) 1 NC_003423.3 vacuolar membrane amino acid uptake transporter Fnx2 2669940 fnx2 2541016 fnx2 Schizosaccharomyces pombe 972h- vacuolar membrane amino acid uptake transporter Fnx2 NP_596093.1 2668207 R 284812 CDS SPBC3E7.07c 19112886 2541002 complement(join(2671959..2672035,2672174..2672397,2672453..2672507,2672551..2672578,2672640..2672651,2672697..2672744)) 1 NC_003423.3 DUF757 family protein 2672744 2541002 SPBC3E7.07c Schizosaccharomyces pombe 972h- DUF757 family protein NP_596094.1 2671959 R 284812 CDS SPBC3E7.08c 19112887 2541051 complement(2673019..2676357) 1 NC_003423.3 DNA repair nuclease Rad13 2676357 rad13 2541051 rad13 Schizosaccharomyces pombe 972h- DNA repair nuclease Rad13 NP_596095.1 2673019 R 284812 CDS SPBC3E7.09 19112888 2540275 2676617..2678596 1 NC_003423.3 Sad1-UNC-like C-terminal 2678596 2540275 SPBC3E7.09 Schizosaccharomyces pombe 972h- Sad1-UNC-like C-terminal NP_596096.1 2676617 D 284812 CDS SPBC3E7.10 19112889 2540928 join(2678873..2678989,2679042..2679062,2679112..2679157,2679218..2680173) 1 NC_003423.3 methionine aminopeptidase Fma1 (predicted) 2680173 fma1 2540928 fma1 Schizosaccharomyces pombe 972h- methionine aminopeptidase Fma1 (predicted) NP_596097.1 2678873 D 284812 CDS SPBC3E7.11c 19112890 2540676 complement(join(2680433..2681338,2681467..2681539,2681581..2681669)) 1 NC_003423.3 DNAJ protein Caj1/Djp1-type 2681669 2540676 SPBC3E7.11c Schizosaccharomyces pombe 972h- DNAJ protein Caj1/Djp1-type NP_596098.1 2680433 R 284812 CDS SPBC3E7.12c 19112891 2540265 complement(2682390..2683760) 1 NC_003423.3 chitin synthase regulatory factor Chr1 (predicted) 2683760 chr1 2540265 chr1 Schizosaccharomyces pombe 972h- chitin synthase regulatory factor Chr1 (predicted) NP_596099.1 2682390 R 284812 CDS SPBC3E7.13c 19112892 2540611 complement(join(2684012..2684635,2684685..2684750)) 1 NC_003423.3 splicing factor, SYF2 family 2684750 2540611 SPBC3E7.13c Schizosaccharomyces pombe 972h- splicing factor, SYF2 family NP_596100.1 2684012 R 284812 CDS SPBC3E7.14 19112893 2540330 join(2685690..2685886,2686006..2686045) 1 NC_003423.3 Sm snRNP core protein Smf1 2686045 smf1 2540330 smf1 Schizosaccharomyces pombe 972h- Sm snRNP core protein Smf1 NP_596101.1 2685690 D 284812 CDS SPBC3E7.15c 19112894 2540466 complement(join(2686630..2687736,2687918..2687965)) 1 NC_003423.3 sphingosine N-acyltransferase Lac1 2687965 lac1 2540466 lac1 Schizosaccharomyces pombe 972h- sphingosine N-acyltransferase Lac1 NP_596102.1 2686630 R 284812 CDS SPBC3E7.16c 162312257 2541003 complement(2688592..2690346) 1 NC_003423.3 2-isopropylmalate synthase (predicted) 2690346 leu3 2541003 leu3 Schizosaccharomyces pombe 972h- 2-isopropylmalate synthase (predicted) NP_596103.2 2688592 R 284812 CDS SPBC4F6.04 19112896 2540851 join(2690831..2690928,2691197..2691524) 1 NC_003423.3 60S ribosomal protein L25 2691524 rpl2502 2540851 rpl2502 Schizosaccharomyces pombe 972h- 60S ribosomal protein L25 NP_596104.1 2690831 D 284812 CDS SPBC4F6.05c 19112897 2540877 complement(2692018..2693172) 1 NC_003423.3 NAS GO:0030134 inferred from GO:0030138 and GO:0006888; lectin (predicted) 2693172 2540877 SPBC4F6.05c Schizosaccharomyces pombe 972h- lectin (predicted) NP_596105.1 2692018 R 284812 CDS SPBC4F6.06 19112898 2540792 2695168..2697843 1 NC_003423.3 microtubule affinity-regulating kinase Kin1 2697843 kin1 2540792 kin1 Schizosaccharomyces pombe 972h- microtubule affinity-regulating kinase Kin1 NP_596106.1 2695168 D 284812 CDS SPBC4F6.07c 19112899 2540874 complement(join(2698289..2698934,2698972..2699260,2699312..2700167,2700204..2700359)) 1 NC_003423.3 ATP-dependent RNA helicase Mak5 (predicted) 2700359 2540874 SPBC4F6.07c Schizosaccharomyces pombe 972h- ATP-dependent RNA helicase Mak5 (predicted) NP_596107.1 2698289 R 284812 CDS SPBC4F6.08c 19112900 2540882 complement(join(2700973..2701015,2701074..2701175,2701227..2701249)) 1 NC_003423.3 mitochondrial ribosomal protein subunit L39 2701249 mrpl39 2540882 mrpl39 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit L39 NP_596108.1 2700973 R 284812 CDS SPBC4F6.09 19112901 2540217 2705523..2707361 1 NC_003423.3 siderophore-iron transporter Str1 2707361 str1 2540217 str1 Schizosaccharomyces pombe 972h- siderophore-iron transporter Str1 NP_596109.1 2705523 D 284812 CDS SPBC4F6.10 19112902 2540886 2708076..2709689 1 NC_003423.3 guanyl-nucleotide exchange factor Vps901 (predicted) 2709689 vps901 2540886 vps901 Schizosaccharomyces pombe 972h- guanyl-nucleotide exchange factor Vps901 (predicted) NP_596110.1 2708076 D 284812 CDS SPBC4F6.11c 19112903 2540867 complement(2709848..2711494) 1 NC_003423.3 asparagine synthase (predicted) 2711494 2540867 SPBC4F6.11c Schizosaccharomyces pombe 972h- asparagine synthase (predicted) NP_596111.1 2709848 R 284812 CDS SPBC4F6.12 19112904 2540856 join(2712512..2712540,2712597..2713884) 1 NC_003423.3 paxillin-like protein Pxl1 2713884 pxl1 2540856 pxl1 Schizosaccharomyces pombe 972h- paxillin-like protein Pxl1 NP_596112.1 2712512 D 284812 CDS SPBC4F6.13c 19112905 2540888 complement(2714424..2716634) 1 NC_003423.3 WD repeat/BOP1NT protein 2716634 2540888 SPBC4F6.13c Schizosaccharomyces pombe 972h- WD repeat/BOP1NT protein NP_596113.1 2714424 R 284812 CDS SPBC4F6.14 19112906 2540871 2716865..2718889 1 NC_003423.3 RNA-binding protein 2718889 2540871 SPBC4F6.14 Schizosaccharomyces pombe 972h- RNA-binding protein NP_596114.1 2716865 D 284812 CDS SPBC4F6.15c 19112907 2540887 complement(join(2719150..2719657,2719718..2719803,2719847..2719864,2719992..2720138)) 1 NC_003423.3 DNA repair endonuclease Swi10 2720138 swi10 2540887 swi10 Schizosaccharomyces pombe 972h- DNA repair endonuclease Swi10 NP_596115.1 2719150 R 284812 CDS SPBC4F6.16c 19112908 2540901 complement(2720994..2722397) 1 NC_003423.3 ER oxidoreductin Ero1a 2722397 ero11 2540901 ero11 Schizosaccharomyces pombe 972h- ER oxidoreductin Ero1a NP_596116.1 2720994 R 284812 CDS SPBC4F6.17c 19112909 2540898 complement(2723235..2725646) 1 NC_003423.3 mitochondrial heatshock protein Hsp78 (predicted) 2725646 2540898 SPBC4F6.17c Schizosaccharomyces pombe 972h- mitochondrial heatshock protein Hsp78 (predicted) NP_596117.1 2723235 R 284812 CDS SPBC4F6.18c 19112910 2540899 complement(join(2727303..2727794,2727863..2727913)) 1 NC_003423.3 ADP-ribosylation factor, Arf family Arf1 2727913 arf1 2540899 arf1 Schizosaccharomyces pombe 972h- ADP-ribosylation factor, Arf family Arf1 NP_596118.1 2727303 R 284812 CDS SPBC18A7.01 162312259 2540809 2729258..2730613 1 NC_003423.3 X-Pro dipeptidase (predicted) 2730613 2540809 SPBC18A7.01 Schizosaccharomyces pombe 972h- X-Pro dipeptidase (predicted) NP_596119.2 2729258 D 284812 CDS SPBC18A7.02c 19112912 2540850 complement(join(2730736..2731961,2732013..2732091,2732145..2732213)) 1 NC_003423.3 seven transmembrane receptor-like protein 2732213 2540850 SPBC18A7.02c Schizosaccharomyces pombe 972h- seven transmembrane receptor-like protein NP_596120.1 2730736 R 284812 CDS SPBC336.01 162312261 2540244 join(2733296..2735105,2735146..2735972) 1 NC_003423.3 no S. cerevisiae protein with this domain combination; stimulated by single-stranded DNA-binding protein at low ATP concentration (PMID 9228070); ?Fbh1 inhibits Rhp51 in the absence of Rad22 PMID:16135800?; DNA helicase I 2735972 fbh1 2540244 fbh1 Schizosaccharomyces pombe 972h- DNA helicase I NP_596121.3 2733296 D 284812 CDS SPBC336.02 19112914 2540247 join(2736963..2737097,2737156..2737944) 1 NC_003423.3 CARE ambiguous gene name; 18S rRNA dimethylase 2737944 2540247 SPBC336.02 Schizosaccharomyces pombe 972h- 18S rRNA dimethylase NP_596122.1 2736963 D 284812 CDS SPBC336.03 19112915 2540248 2740202..2743165 1 NC_003423.3 exchange factor Cdc25p-like 2743165 efc25 2540248 efc25 Schizosaccharomyces pombe 972h- exchange factor Cdc25p-like NP_596123.1 2740202 D 284812 CDS SPBC336.04 19112916 2540255 join(2743843..2744071,2744124..2747155) 1 NC_003423.3 DNA polymerase delta catalytic subunit Cdc6 2747155 cdc6 2540255 cdc6 Schizosaccharomyces pombe 972h- DNA polymerase delta catalytic subunit Cdc6 NP_596124.1 2743843 D 284812 CDS SPBC336.05c 19112917 2540251 complement(2747191..2748327) 1 NC_003423.3 S-adenosylmethionine-dependent methyltransferase 2748327 2540251 SPBC336.05c Schizosaccharomyces pombe 972h- S-adenosylmethionine-dependent methyltransferase NP_596125.1 2747191 R 284812 CDS SPBC336.06c 19112918 2540252 complement(join(2748791..2749517,2749702..2749769)) 1 NC_003423.3 ribonuclease H Rnh1 2749769 rnh1 2540252 rnh1 Schizosaccharomyces pombe 972h- ribonuclease H Rnh1 NP_596126.1 2748791 R 284812 CDS SPBC336.07 19112919 2540246 2750915..2754934 1 NC_003423.3 transcription factor TFIIIC complex subunit Sfc3 2754934 sfc3 2540246 sfc3 Schizosaccharomyces pombe 972h- transcription factor TFIIIC complex subunit Sfc3 NP_596127.1 2750915 D 284812 CDS SPBC336.08 19112920 2540238 join(2755505..2755658,2755706..2756041,2756172..2756278) 1 NC_003423.3 spindle pole body protein Spc24 2756278 spc24 2540238 spc24 Schizosaccharomyces pombe 972h- spindle pole body protein Spc24 NP_596128.1 2755505 D 284812 CDS SPBC336.09c 19112921 2540236 complement(join(2756305..2757807,2757872..2757982)) 1 NC_003423.3 RNA polymerase I upstream activation factor complex subunit Rrn7 2757982 rrn7 2540236 rrn7 Schizosaccharomyces pombe 972h- RNA polymerase I upstream activation factor complex subunit Rrn7 NP_596129.1 2756305 R 284812 CDS SPBC336.10c 19112922 2540232 complement(2758761..2759234) 1 NC_003423.3 previously thought to function in initiation; translation elongation factor eIF5A 2759234 tif512 2540232 tif512 Schizosaccharomyces pombe 972h- translation elongation factor eIF5A NP_596130.1 2758761 R 284812 CDS SPBC336.11 19112923 2540233 2759639..2761165 1 NC_003423.3 GARP complex subunit Vps52 (predicted) 2761165 2540233 SPBC336.11 Schizosaccharomyces pombe 972h- GARP complex subunit Vps52 (predicted) NP_596131.1 2759639 D 284812 CDS SPBC336.12c 19112924 2540234 complement(2761287..2763590) 1 NC_003423.3 MBF transcription factor complex subunit Cdc10 2763590 cdc10 2540234 cdc10 Schizosaccharomyces pombe 972h- MBF transcription factor complex subunit Cdc10 NP_596132.1 2761287 R 284812 CDS SPBC336.13c 19112925 2540235 complement(join(2764315..2764465,2764533..2764682,2764755..2764996)) 1 NC_003423.3 mitochondrial inner membrane peptidase complex catalytic subunit 2 2764996 2540235 SPBC336.13c Schizosaccharomyces pombe 972h- mitochondrial inner membrane peptidase complex catalytic subunit 2 NP_596133.1 2764315 R 284812 CDS SPBC336.14c 19112926 2540231 complement(join(2765320..2765367,2765474..2765551,2765599..2766130,2766211..2766436,2766474..2766584,2766630..2766779,2766822..2766966,2767006..2767101,2767155..2767311,2767357..2767397,2767457..2767551,2767600..2767690)) 1 NC_003423.3 Warning, this has a Pfam protein kinase dominan, but none of its orthologs do. It needs looking into further but it could be a false positive; serine/threonine protein kinase Ppk26 2767690 ppk26 2540231 ppk26 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Ppk26 NP_596134.1 2765320 R 284812 CDS SPBC336.15 63054773 2540250 join(2769271..2769428,2769472..2772370) 1 NC_003423.3 N term exon may be incorrect; INCENP, Pic1 2772370 pic1 2540250 pic1 Schizosaccharomyces pombe 972h- INCENP, Pic1 NP_596135.2 2769271 D 284812 CDS SPBC685.02 19112928 2541105 join(2772884..2773046,2773102..2773166,2773317..2774093,2774223..2774447) 1 NC_003423.3 conserved eukaryotic protein 2774447 2541105 SPBC685.02 Schizosaccharomyces pombe 972h- conserved eukaryotic protein NP_596136.1 2772884 D 284812 CDS SPBC685.03 19112929 2541090 2774697..2776055 1 NC_003423.3 sequence orphan 2776055 2541090 SPBC685.03 Schizosaccharomyces pombe 972h- sequence orphan NP_596137.1 2774697 D 284812 CDS SPBC685.04c 19112930 2541086 complement(2776485..2776916) 1 NC_003423.3 AP-2 adaptor complex subunit Aps2 (predicted) 2776916 aps2 2541086 aps2 Schizosaccharomyces pombe 972h- AP-2 adaptor complex subunit Aps2 (predicted) NP_596138.1 2776485 R 284812 CDS SPBC685.05 19112931 2540532 join(2777842..2778049,2778226..2778500) 1 NC_003423.3 pig-H (predicted) 2778500 gpi15 2540532 gpi15 Schizosaccharomyces pombe 972h- pig-H (predicted) NP_596139.1 2777842 D 284812 CDS SPBC685.06 19112932 2541144 join(2778923..2778961,2779017..2779856) 1 NC_003423.3 40S ribosomal protein S0A (p40) 2779856 rps001 2541144 rps001 Schizosaccharomyces pombe 972h- 40S ribosomal protein S0A (p40) NP_596140.1 2778923 D 284812 CDS SPBC685.07c 19112933 2541156 complement(join(2780199..2780582,2780627..2780653)) 1 NC_003423.3 60S ribosomal protein L27 2780653 rpl2701 2541156 rpl2701 Schizosaccharomyces pombe 972h- 60S ribosomal protein L27 NP_596141.1 2780199 R 284812 CDS SPBC685.08 19112934 2541091 join(2781316..2781318,2781365..2781655) 1 NC_003423.3 sequence orphan 2781655 2541091 SPBC685.08 Schizosaccharomyces pombe 972h- sequence orphan NP_596142.1 2781316 D 284812 CDS SPBC685.09 19112935 2541159 2781958..2783565 1 NC_003423.3 origin recognition complex subunit Orc2 2783565 orc2 2541159 orc2 Schizosaccharomyces pombe 972h- origin recognition complex subunit Orc2 NP_596143.1 2781958 D 284812 CDS SPBC32F12.01c 162312263 2541113 complement(2784277..2785551) 1 NC_003423.3 inositol phosphosphingolipid phospholipase C (predicted) 2785551 2541113 SPBC32F12.01c Schizosaccharomyces pombe 972h- inositol phosphosphingolipid phospholipase C (predicted) NP_596144.2 2784277 R 284812 CDS SPBC32F12.02 19112937 2540221 join(2786978..2787266,2787320..2787939) 1 NC_003423.3 Ski complex subunit Rec14 2787939 rec14 2540221 rec14 Schizosaccharomyces pombe 972h- Ski complex subunit Rec14 NP_596145.1 2786978 D 284812 CDS SPBC32F12.03c 19112938 2540222 complement(2789071..2789547) 1 NC_003423.3 glutathione peroxidase Gpx1 2789547 gpx1 2540222 gpx1 Schizosaccharomyces pombe 972h- glutathione peroxidase Gpx1 NP_596146.1 2789071 R 284812 CDS SPBC32F12.04 19112939 2540223 join(2791470..2791518,2791581..2791693,2791743..2791796,2791866..2792342,2792387..2792851,2792902..2793017,2793076..2793142) 1 NC_003423.3 gamma-tubulin 2793142 tug1 2540223 tug1 Schizosaccharomyces pombe 972h- gamma-tubulin NP_596147.1 2791470 D 284812 CDS SPBC32F12.05c 19112940 2540230 complement(join(2793222..2793727,2793819..2793951,2794013..2794027)) 1 NC_003423.3 complexed with Cdc5 protein Cwf12 2794027 cwf12 2540230 cwf12 Schizosaccharomyces pombe 972h- complexed with Cdc5 protein Cwf12 NP_596148.1 2793222 R 284812 CDS SPBC32F12.06 19112941 2540237 join(2794966..2795144,2795202..2795746,2795790..2796094) 1 NC_003423.3 cyclin Pch1 2796094 pch1 2540237 pch1 Schizosaccharomyces pombe 972h- cyclin Pch1 NP_596149.1 2794966 D 284812 CDS SPBC32F12.07c 19112942 2540242 complement(2796316..2797338) 1 NC_003423.3 ubiquitin-protein ligase E3 (predicted) 2797338 2540242 SPBC32F12.07c Schizosaccharomyces pombe 972h- ubiquitin-protein ligase E3 (predicted) NP_596150.1 2796316 R 284812 CDS SPBC32F12.08c 19112943 2540249 complement(2798007..2798507) 1 NC_003423.3 DASH complex subunit Duo1 2798507 duo1 2540249 duo1 Schizosaccharomyces pombe 972h- DASH complex subunit Duo1 NP_596151.1 2798007 R 284812 CDS SPBC32F12.09 19112944 2539640 2800589..2801281 1 NC_003423.3 2 transcripts; CDK inhibitor Rum1 2801281 rum1 2539640 rum1 Schizosaccharomyces pombe 972h- CDK inhibitor Rum1 NP_596152.1 2800589 D 284812 CDS SPBC32F12.10 19112945 2540254 2802517..2804181 1 NC_003423.3 phosphoglucomutase (predicted) 2804181 2540254 SPBC32F12.10 Schizosaccharomyces pombe 972h- phosphoglucomutase (predicted) NP_596153.1 2802517 D 284812 CDS SPBC32F12.11 19112946 2540547 2807637..2808647 1 NC_003423.3 made tdh1 primary name as we have another gpd1; NAS from Rend. Lincei Sci. Fis. Nat. 7:315-322 (1996); glyceraldehyde-3-phosphate dehydrogenase Tdh1 2808647 tdh1 2540547 tdh1 Schizosaccharomyces pombe 972h- glyceraldehyde-3-phosphate dehydrogenase Tdh1 NP_596154.1 2807637 D 284812 CDS SPBC32F12.15 19112947 2540257 2809874..2810080 1 NC_003423.3 was annotated as misc_RNA originally, before we identified SPBC32F12.15 from the Blandin paper; transcription factor TFIIH complex subunit Tfb5 (predicted) 2810080 tfb5 2540257 tfb5 Schizosaccharomyces pombe 972h- transcription factor TFIIH complex subunit Tfb5 (predicted) NP_596155.1 2809874 D 284812 CDS SPBC32F12.12c 19112948 2540256 complement(join(2810749..2810949,2811072..2811256,2811569..2811606,2811657..2811727)) 1 NC_003423.3 Golgi membrane protein involved in vesicle-medated transport (predicted) 2811727 2540256 SPBC32F12.12c Schizosaccharomyces pombe 972h- Golgi membrane protein involved in vesicle-medated transport (predicted) NP_596156.1 2810749 R 284812 CDS SPBC19C7.01 19112949 2540798 complement(join(2812516..2813080,2813129..2813154)) 1 NC_003423.3 N-terminal splicing uncertain; 1st exon possibly at 441..466; Mago binding protein homolog 2813154 2540798 SPBC19C7.01 Schizosaccharomyces pombe 972h- Mago binding protein homolog NP_596157.1 2812516 R 284812 CDS SPBC19C7.02 162312265 2540764 2813349..2819225 1 NC_003423.3 N-end-recognizing protein Ubr1 2819225 ubr1 2540764 ubr1 Schizosaccharomyces pombe 972h- N-end-recognizing protein Ubr1 NP_596158.2 2813349 D 284812 CDS SPBC19C7.03 19112951 2540810 2820008..2825086 1 NC_003423.3 glucose insensitive transcription; adenylate cyclase 2825086 cyr1 2540810 cyr1 Schizosaccharomyces pombe 972h- adenylate cyclase NP_596159.1 2820008 D 284812 CDS SPBC19C7.04c 19112952 2540581 complement(2825692..2826066) 1 NC_003423.3 conserved fungal protein 2826066 2540581 SPBC19C7.04c Schizosaccharomyces pombe 972h- conserved fungal protein NP_596160.1 2825692 R 284812 CDS SPBC19C7.05 19112953 2540811 2830189..2830641 1 NC_003423.3 possible RNA binding; cell wall organization protein (predicted) 2830641 2540811 SPBC19C7.05 Schizosaccharomyces pombe 972h- cell wall organization protein (predicted) NP_596161.1 2830189 D 284812 CDS SPBC19C7.06 19112954 2540431 2831823..2833973 1 NC_003423.3 cytoplasmic proline-tRNA ligase Prs1 (predicted) 2833973 prs1 2540431 prs1 Schizosaccharomyces pombe 972h- cytoplasmic proline-tRNA ligase Prs1 (predicted) NP_596162.1 2831823 D 284812 CDS SPBC19C7.07c 19112955 2540591 complement(2834178..2835032) 1 NC_003423.3 tRNA-splicing endonuclease catalytic subunit Sen34 2835032 sen34 2540591 sen34 Schizosaccharomyces pombe 972h- tRNA-splicing endonuclease catalytic subunit Sen34 NP_596163.1 2834178 R 284812 CDS SPBC19C7.08c 19112956 2540701 complement(2835338..2837383) 1 NC_003423.3 leucine carboxyl methyltransferase 2837383 2540701 SPBC19C7.08c Schizosaccharomyces pombe 972h- leucine carboxyl methyltransferase NP_596164.1 2835338 R 284812 CDS SPBC19C7.09c 19112957 2540345 complement(2837786..2839585) 1 NC_003423.3 endonuclease Uve1 2839585 uve1 2540345 uve1 Schizosaccharomyces pombe 972h- endonuclease Uve1 NP_596165.1 2837786 R 284812 CDS SPBC19C7.10 19112958 2540694 join(2840857..2840897,2840935..2840966,2841006..2841105,2841168..2841221,2841268..2842314,2842387..2842411) 1 NC_003423.3 transcription factor (predicted) 2842411 2540694 SPBC19C7.10 Schizosaccharomyces pombe 972h- transcription factor (predicted) NP_596166.1 2840857 D 284812 CDS SPBC19C7.11 19112959 2540750 2843141..2845579 1 NC_003423.3 ClC chloride channel (predicted) 2845579 2540750 SPBC19C7.11 Schizosaccharomyces pombe 972h- ClC chloride channel (predicted) NP_596167.1 2843141 D 284812 CDS SPBC19C7.12c 19112960 2540706 complement(2845923..2847095) 1 NC_003423.3 alpha-1,2-mannosyltransferase (predicted) 2847095 2540706 SPBC19C7.12c Schizosaccharomyces pombe 972h- alpha-1,2-mannosyltransferase (predicted) NP_596168.1 2845923 R 284812 CDS SPBP19A11.01 19112961 2541294 2848523..2849032 1 NC_003423.3 glycine decarboxylase complex subunit H 2849032 2541294 SPBP19A11.01 Schizosaccharomyces pombe 972h- glycine decarboxylase complex subunit H NP_596169.1 2848523 D 284812 CDS SPBP19A11.02c 19112962 2541316 complement(2849580..2850314) 1 NC_003423.3 sequence orphan 2850314 2541316 SPBP19A11.02c Schizosaccharomyces pombe 972h- sequence orphan NP_596170.1 2849580 R 284812 CDS SPBP19A11.03c 19112963 2541268 complement(join(2851330..2853867,2853915..2854052)) 1 NC_003423.3 19S proteasome regulatory subunit Mts4 2854052 mts4 2541268 mts4 Schizosaccharomyces pombe 972h- 19S proteasome regulatory subunit Mts4 NP_596171.1 2851330 R 284812 CDS SPBP19A11.04c 19112964 2541317 complement(2854650..2861240) 1 NC_003423.3 morphogenesis protein Mor2 2861240 mor2 2541317 mor2 Schizosaccharomyces pombe 972h- morphogenesis protein Mor2 NP_596172.1 2854650 R 284812 CDS SPAP19A11.05c 19112965 2540102 complement(2862163..2862624) 1 NC_003423.3 WARNING: Not sure why but this chromosome 2 gene has got a chromosome 1 systematic ID. I added the SPBP19A11.05c as a synonym for searching, but don't want to change the systamtic ID as it will probably be more confusing; mitochondrial ribosomal protein subunit L27 2862624 mrp7 2540102 mrp7 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit L27 NP_596173.1 2862163 R 284812 CDS SPBP19A11.06 19112966 2541299 2863815..2868356 1 NC_003423.3 Lid2 complex subunit, with PHD finger and jmjC domain, Lid2 2868356 lid2 2541299 lid2 Schizosaccharomyces pombe 972h- Lid2 complex subunit, with PHD finger and jmjC domain, Lid2 NP_596174.1 2863815 D 284812 CDS SPBP19A11.07c 162312267 2540010 complement(join(2868453..2868779,2868820..2868986,2869031..2869250,2869322..2869888,2869941..2870029,2870072..2870193,2870244..2870695,2870733..2870799,2870852..2870871)) 1 NC_003423.3 human down-regulated in multiple cancers-1 homolog 2 2870871 2540010 SPBP19A11.07c Schizosaccharomyces pombe 972h- human down-regulated in multiple cancers-1 homolog 2 XP_001713138.1 2868453 R 284812 CDS SPBP4H10.03 19112969 2539811 2871898..2873127 1 NC_003423.3 mitochondrial inner membrane translocase Oxa102 2873127 oxa102 2539811 oxa102 Schizosaccharomyces pombe 972h- mitochondrial inner membrane translocase Oxa102 NP_596177.1 2871898 D 284812 CDS SPBP4H10.04 19112970 2540024 join(2873997..2874135,2874180..2874386,2874541..2875859) 1 NC_003423.3 serine/threonine protein phosphatase, calcineurin catalytic subunit Ppb1 2875859 ppb1 2540024 ppb1 Schizosaccharomyces pombe 972h- serine/threonine protein phosphatase, calcineurin catalytic subunit Ppb1 NP_596178.1 2873997 D 284812 CDS SPBP4H10.05c 19112971 2541338 complement(2876233..2877369) 1 NC_003423.3 S-adenosylmethionine decarboxylase proenzyme Spe2 2877369 spe2 2541338 spe2 Schizosaccharomyces pombe 972h- S-adenosylmethionine decarboxylase proenzyme Spe2 NP_596179.1 2876233 R 284812 CDS SPBP4H10.06c 19112972 2541319 complement(2877850..2881368) 1 NC_003423.3 condensin subunit Cut14 2881368 cut14 2541319 cut14 Schizosaccharomyces pombe 972h- condensin subunit Cut14 NP_596180.1 2877850 R 284812 CDS SPBP4H10.07 19112973 2541304 2881805..2883556 1 NC_003423.3 ubiquitin-protein ligase E3 (predicted) 2883556 2541304 SPBP4H10.07 Schizosaccharomyces pombe 972h- ubiquitin-protein ligase E3 (predicted) NP_596181.1 2881805 D 284812 CDS SPBP4H10.08 19112974 2541331 join(2884360..2884371,2884414..2884484,2884537..2884580,2884631..2884680,2884725..2884787) 1 NC_003423.3 Reiske ISP-associated protein, ubiquinol-cytochrome-c reductase complex subunit Qcr10 2884787 qcr10 2541331 qcr10 Schizosaccharomyces pombe 972h- Reiske ISP-associated protein, ubiquinol-cytochrome-c reductase complex subunit Qcr10 NP_596182.1 2884360 D 284812 CDS SPBP4H10.09 19112975 2541322 2888450..2889736 1 NC_003423.3 transcription factor Rsv1 2889736 rsv1 2541322 rsv1 Schizosaccharomyces pombe 972h- transcription factor Rsv1 NP_596183.1 2888450 D 284812 CDS SPBP4H10.10 19112976 2541325 2890645..2891823 1 NC_003423.3 rhomboid family protease 2891823 2541325 SPBP4H10.10 Schizosaccharomyces pombe 972h- rhomboid family protease NP_596184.1 2890645 D 284812 CDS SPBP4H10.11c 19112977 2541350 complement(2892339..2894408) 1 NC_003423.3 long-chain-fatty-acid-CoA ligase 2894408 lcf2 2541350 lcf2 Schizosaccharomyces pombe 972h- long-chain-fatty-acid-CoA ligase NP_596185.1 2892339 R 284812 CDS SPBP4H10.12 295442863 2541366 join(2895855..2895863,2896001..2896459,2896516..2896587) 1 NC_003423.3 conserved protein (fungal and bacterial) 2896587 2541366 SPBP4H10.12 Schizosaccharomyces pombe 972h- conserved protein (fungal and bacterial) NP_596186.2 2895855 D 284812 CDS SPBP4H10.13 19112979 2541369 2897100..2897531 1 NC_003423.3 40S ribosomal protein S23 2897531 rps2302 2541369 rps2302 Schizosaccharomyces pombe 972h- 40S ribosomal protein S23 NP_596187.1 2897100 D 284812 CDS SPBP4H10.14c 19112980 2541351 complement(2898280..2899206) 1 NC_003423.3 sequence orphan 2899206 2541351 SPBP4H10.14c Schizosaccharomyces pombe 972h- sequence orphan NP_596188.1 2898280 R 284812 CDS SPBP4H10.15 295442865 2541348 join(2903103..2905816,2905857..2905881) 1 NC_003423.3 aconitate hydratase/mitochondrial ribosomal protein subunit L49, fusion protein 2905881 2541348 SPBP4H10.15 Schizosaccharomyces pombe 972h- aconitate hydratase/mitochondrial ribosomal protein subunit L49, fusion protein NP_596189.2 2903103 D 284812 CDS SPBP4H10.16c 19112982 2541358 complement(2906237..2907124) 1 NC_003423.3 phosphatase activator (predicted) 2907124 2541358 SPBP4H10.16c Schizosaccharomyces pombe 972h- phosphatase activator (predicted) NP_596190.1 2906237 R 284812 CDS SPBP4H10.17c 19112983 2541371 complement(2907373..2908398) 1 NC_003423.3 was originally thought to be a ribosomal protein (ISS); carboxyl methyl esterase 2908398 2541371 SPBP4H10.17c Schizosaccharomyces pombe 972h- carboxyl methyl esterase NP_596191.1 2907373 R 284812 CDS SPBP4H10.18c 19112984 2541334 complement(2908887..2909831) 1 NC_003423.3 sequence orphan 2909831 2541334 SPBP4H10.18c Schizosaccharomyces pombe 972h- sequence orphan NP_596192.1 2908887 R 284812 CDS SPBP4H10.19c 19112985 2541360 complement(join(2910242..2911312,2911391..2911465)) 1 NC_003423.3 calreticulin/calnexin homolog 2911465 2541360 SPBP4H10.19c Schizosaccharomyces pombe 972h- calreticulin/calnexin homolog NP_596193.1 2910242 R 284812 CDS SPBP4H10.20 19112986 2541340 join(2912228..2912539,2912582..2912787,2912929..2913116,2913163..2913371) 1 NC_003423.3 m7G(5')pppN diphosphatase (predicted) 2913371 nhm1 2541340 nhm1 Schizosaccharomyces pombe 972h- m7G(5')pppN diphosphatase (predicted) NP_596194.1 2912228 D 284812 CDS SPBP4H10.21c 19112987 2541368 complement(2913576..2914220) 1 NC_003423.3 GINS complex subunit Sld5 2914220 sld5 2541368 sld5 Schizosaccharomyces pombe 972h- GINS complex subunit Sld5 NP_596195.1 2913576 R 284812 CDS SPBC1703.01c 162312269 2539947 complement(join(2914870..2915018,2915091..2915595)) 1 NC_003423.3 RNase P and RNase MRP subunit (predicted) 2915595 2539947 SPBC1703.01c Schizosaccharomyces pombe 972h- RNase P and RNase MRP subunit (predicted) XP_001713139.1 2914870 R 284812 CDS SPBC1703.02 19112989 2539948 join(2916272..2916384,2916438..2918667) 1 NC_003423.3 YML127W is similar at the C-terminus but has no ARID domain; RSC complex subunit Rsc9 2918667 rsc9 2539948 rsc9 Schizosaccharomyces pombe 972h- RSC complex subunit Rsc9 NP_596197.1 2916272 D 284812 CDS SPBC1703.03c 19112990 2539718 complement(join(2918968..2920833,2920919..2921047)) 1 NC_003423.3 armadillo repeat protein, unknown biological role 2921047 2539718 SPBC1703.03c Schizosaccharomyces pombe 972h- armadillo repeat protein, unknown biological role NP_596198.1 2918968 R 284812 CDS SPBC1703.04 19112991 2539949 join(2921241..2921312,2921441..2921578,2921644..2921816,2921864..2923535) 1 NC_003423.3 non-consensus branch site in second intron; MutL family protein Mlh1 (predicted) 2923535 mlh1 2539949 mlh1 Schizosaccharomyces pombe 972h- MutL family protein Mlh1 (predicted) NP_596199.1 2921241 D 284812 CDS SPBC1703.05 19112992 2539957 join(2924037..2924078,2924233..2925201) 1 NC_003423.3 protein kinase, RIO family 2925201 2539957 SPBC1703.05 Schizosaccharomyces pombe 972h- protein kinase, RIO family NP_596200.1 2924037 D 284812 CDS SPBC1703.06 19112993 2539767 join(2925512..2925620,2925675..2927554) 1 NC_003423.3 F-box protein Pof10 2927554 pof10 2539767 pof10 Schizosaccharomyces pombe 972h- F-box protein Pof10 NP_596201.1 2925512 D 284812 CDS SPBC1703.07 19112994 2539879 join(2928014..2928173,2928221..2928294,2928559..2930172) 1 NC_003423.3 Direction of reaction forming acetyl-CoA and oxaloacetate (PMID:10794176); ATP citrate synthase subunit 1 (predicted) 2930172 2539879 SPBC1703.07 Schizosaccharomyces pombe 972h- ATP citrate synthase subunit 1 (predicted) NP_596202.1 2928014 D 284812 CDS SPBC1703.08c 19112995 2539626 complement(join(2930386..2930498,2930550..2930711,2930760..2930888,2930934..2931062,2931108..2931189)) 1 NC_003423.3 5-formyltetrahydrofolate cyclo-ligase 2931189 2539626 SPBC1703.08c Schizosaccharomyces pombe 972h- 5-formyltetrahydrofolate cyclo-ligase NP_596203.1 2930386 R 284812 CDS SPBC1703.09 19112996 2539768 join(2931763..2932227,2932276..2932419) 1 NC_003423.3 sequence orphan 2932419 2539768 SPBC1703.09 Schizosaccharomyces pombe 972h- sequence orphan NP_596204.1 2931763 D 284812 CDS SPBC1703.10 19112997 2539784 join(2932989..2932999,2933168..2933291,2933343..2933390,2933454..2933550,2933710..2934041) 1 NC_003423.3 GTPase Ypt1 2934041 ypt1 2539784 ypt1 Schizosaccharomyces pombe 972h- GTPase Ypt1 NP_596205.1 2932989 D 284812 CDS SPBC1703.11 19112998 2539959 join(2934982..2935089,2935155..2935312,2935431..2935821) 1 NC_003423.3 optic atrophy 3 family protein 2935821 2539959 SPBC1703.11 Schizosaccharomyces pombe 972h- optic atrophy 3 family protein NP_596206.1 2934982 D 284812 CDS SPBC1703.12 19112999 2540120 join(2936211..2936237,2936282..2936389,2936439..2936452,2936510..2938118) 1 NC_003423.3 ubiquitin C-terminal hydrolase Ubp9 2938118 ubp9 2540120 ubp9 Schizosaccharomyces pombe 972h- ubiquitin C-terminal hydrolase Ubp9 NP_596207.1 2936211 D 284812 CDS SPBC1703.13c 19113000 2539652 complement(2940031..2940966) 1 NC_003423.3 mitochondrial inorganic phosphate transporter (predicted) 2940966 2539652 SPBC1703.13c Schizosaccharomyces pombe 972h- mitochondrial inorganic phosphate transporter (predicted) NP_596208.1 2940031 R 284812 CDS SPBC1703.14c 19113001 2540032 complement(join(2942037..2944367,2944414..2944514,2944568..2944580)) 1 NC_003423.3 DNA topoisomerase I 2944580 top1 2540032 top1 Schizosaccharomyces pombe 972h- DNA topoisomerase I NP_596209.1 2942037 R 284812 CDS SPBC1703.15c 19113002 2539880 complement(join(2945166..2945935,2945987..2946259,2946300..2946978,2947024..2947080)) 1 NC_003423.3 vacuolar sorting protein Vps33 2947080 vps33 2539880 vps33 Schizosaccharomyces pombe 972h- vacuolar sorting protein Vps33 NP_596210.1 2945166 R 284812 CDS SPBC2A9.02 19113003 2540401 2948648..2949535 1 NC_003423.3 NAD dependent epimerase/dehydratase family protein 2949535 2540401 SPBC2A9.02 Schizosaccharomyces pombe 972h- NAD dependent epimerase/dehydratase family protein NP_596211.1 2948648 D 284812 CDS SPBC2A9.03 19113004 2540276 join(2951160..2951196,2951254..2952497) 1 NC_003423.3 WD40/YVTN repeat-like 2952497 2540276 SPBC2A9.03 Schizosaccharomyces pombe 972h- WD40/YVTN repeat-like NP_596212.1 2951160 D 284812 CDS SPBC2A9.04c 19113005 2540480 complement(2952816..2955041) 1 NC_003423.3 sir antagonist ortholog (predicted) 2955041 2540480 SPBC2A9.04c Schizosaccharomyces pombe 972h- sir antagonist ortholog (predicted) NP_596213.1 2952816 R 284812 CDS SPBC2A9.05c 19113006 2540332 complement(join(2956469..2956904,2956966..2957189)) 1 NC_003423.3 DUF846 family protein 2957189 2540332 SPBC2A9.05c Schizosaccharomyces pombe 972h- DUF846 family protein NP_596214.1 2956469 R 284812 CDS SPBC2A9.06c 19113007 2540399 complement(join(2957587..2958053,2958121..2958430)) 1 NC_003423.3 di-trans,poly-cis-decaprenylcistransferase 2958430 2540399 SPBC2A9.06c Schizosaccharomyces pombe 972h- di-trans,poly-cis-decaprenylcistransferase NP_596215.1 2957587 R 284812 CDS SPBC2A9.07c 295442868 2540460 complement(join(2959078..2959129,2959172..2959902)) 1 NC_003423.3 zf-PARP type zinc finger protein 2959902 2540460 SPBC2A9.07c Schizosaccharomyces pombe 972h- zf-PARP type zinc finger protein NP_596216.2 2959078 R 284812 CDS SPBC2A9.13 19113009 2540427 join(2960489..2960525,2960620..2960729) 1 NC_003423.3 identified by confirmed intron; sequence orphan 2960729 2540427 SPBC2A9.13 Schizosaccharomyces pombe 972h- sequence orphan NP_596217.1 2960489 D 284812 CDS SPBC2A9.08c 19113010 2540308 complement(join(2961668..2961972,2962036..2962199,2962265..2962409,2962517..2962532)) 1 NC_003423.3 SNARE Sec22 2962532 sec22 2540308 sec22 Schizosaccharomyces pombe 972h- SNARE Sec22 NP_596218.1 2961668 R 284812 CDS SPBC2A9.09 19113011 2540484 join(2962867..2962892,2962937..2963263,2963327..2963675) 1 NC_003423.3 phosducin family protein 2963675 2540484 SPBC2A9.09 Schizosaccharomyces pombe 972h- phosducin family protein NP_596219.1 2962867 D 284812 CDS SPBC2A9.10 19113012 2540331 join(2964227..2964835,2964878..2965075) 1 NC_003423.3 Bin3 family 2965075 2540331 SPBC2A9.10 Schizosaccharomyces pombe 972h- Bin3 family NP_596220.1 2964227 D 284812 CDS SPBC2A9.11c 19113013 2540452 complement(join(2965217..2965626,2965695..2965824,2965875..2966522)) 1 NC_003423.3 nuclear export factor 2966522 2540452 SPBC2A9.11c Schizosaccharomyces pombe 972h- nuclear export factor NP_596221.1 2965217 R 284812 CDS SPBC2A9.12 19113014 2540438 join(2967355..2967536,2967595..2968207) 1 NC_003423.3 origin recognition complex subunit Orc6 2968207 orc6 2540438 orc6 Schizosaccharomyces pombe 972h- origin recognition complex subunit Orc6 NP_596222.1 2967355 D 284812 CDS SPBC2D10.03c 162312271 3361316 complement(2968322..2968795) 1 NC_003423.3 DUF866 domain protein 2968795 3361316 SPBC2D10.03c Schizosaccharomyces pombe 972h- DUF866 domain protein NP_001018829.2 2968322 R 284812 CDS SPBC2D10.04 19113015 2540410 2972196..2974172 1 NC_003423.3 arrestin Aly1 related 2974172 2540410 SPBC2D10.04 Schizosaccharomyces pombe 972h- arrestin Aly1 related NP_596223.1 2972196 D 284812 CDS SPBC2D10.05 19113016 2540296 join(2974828..2975515,2975566..2976272) 1 NC_003423.3 glucan 1,3-beta-glucosidase Exg3 2976272 exg3 2540296 exg3 Schizosaccharomyces pombe 972h- glucan 1,3-beta-glucosidase Exg3 NP_596224.1 2974828 D 284812 CDS SPBC2D10.06 19113017 2540433 2977166..2978584 1 NC_003423.3 MBF transcription factor complex subunit Rep1 2978584 rep1 2540433 rep1 Schizosaccharomyces pombe 972h- MBF transcription factor complex subunit Rep1 NP_596225.1 2977166 D 284812 CDS SPBC2D10.07c 19113018 2540493 complement(join(2978906..2979124,2979172..2979298,2979342..2979469)) 1 NC_003423.3 mitochondrial inner membrane peptidase complex catalytic subunit 2979469 2540493 SPBC2D10.07c Schizosaccharomyces pombe 972h- mitochondrial inner membrane peptidase complex catalytic subunit NP_596226.1 2978906 R 284812 CDS SPBC2D10.08c 19113019 2540449 complement(2979661..2980446) 1 NC_003423.3 mitochondrial ribosomal protein subunit Yml6 2980446 2540449 SPBC2D10.08c Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit Yml6 NP_596227.1 2979661 R 284812 CDS SPBC2D10.09 19113020 2540394 2981062..2982351 1 NC_003423.3 3-hydroxyisobutyryl-CoA hydrolase 2982351 2540394 SPBC2D10.09 Schizosaccharomyces pombe 972h- 3-hydroxyisobutyryl-CoA hydrolase NP_596228.1 2981062 D 284812 CDS SPBC2D10.10c 19113021 2540479 complement(2982764..2983681) 1 NC_003423.3 fibrillarin 2983681 fib1 2540479 fib1 Schizosaccharomyces pombe 972h- fibrillarin NP_596229.1 2982764 R 284812 CDS SPBC2D10.11c 19113022 2540409 complement(2984709..2985848) 1 NC_003423.3 nucleosome assembly protein Nap2 (predicted) 2985848 nap2 2540409 nap2 Schizosaccharomyces pombe 972h- nucleosome assembly protein Nap2 (predicted) NP_596230.1 2984709 R 284812 CDS SPBC2D10.12 19113023 2540481 join(2986964..2987032,2987073..2987145,2987187..2988028,2988076..2988144,2988197..2988250) 1 NC_003423.3 Rad23 homolog Rhp23 2988250 rhp23 2540481 rhp23 Schizosaccharomyces pombe 972h- Rad23 homolog Rhp23 NP_596231.1 2986964 D 284812 CDS SPBC2D10.13 19113024 2540492 join(2988674..2988925,2988967..2990187) 1 NC_003423.3 GO:0000184, NAS from PMID: 17984081; telomerase regulator Est1 2990187 est1 2540492 est1 Schizosaccharomyces pombe 972h- telomerase regulator Est1 NP_596232.1 2988674 D 284812 CDS SPBC2D10.14c 19113025 2540560 complement(join(2990305..2990770,2990810..2994730,2994786..2994814)) 1 NC_003423.3 myosin type V 2994814 myo51 2540560 myo51 Schizosaccharomyces pombe 972h- myosin type V NP_596233.1 2990305 R 284812 CDS SPBC2D10.15c 295442870 2540340 complement(join(2995324..2995497,2995534..2995579,2995619..2995923,2995971..2996066)) 1 NC_003423.3 peptidyl-tRNA hydrolase Pth1 (predicted) 2996066 2540340 SPBC2D10.15c Schizosaccharomyces pombe 972h- peptidyl-tRNA hydrolase Pth1 (predicted) NP_596234.2 2995324 R 284812 CDS SPBC2D10.16 295442872 2540443 join(2996452..2996463,2996509..2996687,2996738..2996879) 1 NC_003423.3 gene structure uopdated 007-01-08, which identified homology; CENP-S homolog 2996879 2540443 SPBC2D10.16 Schizosaccharomyces pombe 972h- CENP-S homolog NP_596235.2 2996452 D 284812 CDS SPBC2D10.17 19113028 2540558 2997238..3000954 1 NC_003423.3 cryptic loci regulator Clr1 3000954 clr1 2540558 clr1 Schizosaccharomyces pombe 972h- cryptic loci regulator Clr1 NP_596236.1 2997238 D 284812 CDS SPBC2D10.18 19113029 2540411 3001361..3003193 1 NC_003423.3 ABC1 kinase family ubiquinone biosynthesis protein Abc1/Coq8 3003193 abc1 2540411 abc1 Schizosaccharomyces pombe 972h- ABC1 kinase family ubiquinone biosynthesis protein Abc1/Coq8 NP_596237.1 3001361 D 284812 CDS SPBC2D10.19c 19113030 2540421 complement(join(3003386..3003537,3003618..3003669,3003724..3003837)) 1 NC_003423.3 confirmed by est; pre-60S shuttlingfactor (predicted) 3003837 2540421 SPBC2D10.19c Schizosaccharomyces pombe 972h- pre-60S shuttlingfactor (predicted) NP_596238.1 3003386 R 284812 CDS SPBC2D10.20 19113031 2540277 join(3004435..3004477,3004524..3004580,3004625..3004672,3004783..3004814,3004878..3004881,3004921..3005390) 1 NC_003423.3 ubiquitin conjugating enzyme Ubc1 3005390 ubc1 2540277 ubc1 Schizosaccharomyces pombe 972h- ubiquitin conjugating enzyme Ubc1 NP_596239.1 3004435 D 284812 CDS SPBC15D4.01c 162312273 2539778 complement(join(3005679..3007187,3007316..3007699,3007745..3007753)) 1 NC_003423.3 kinesin-like protein 3007753 2539778 SPBC15D4.01c Schizosaccharomyces pombe 972h- kinesin-like protein XP_001713140.1 3005679 R 284812 CDS SPBC15D4.02 63054779 2539828 3013318..3014577 1 NC_003423.3 trimmed N terminal 28.10.03; looked overextended as large low complexity region in front in zinc finger which is usually N-term; alignment looks better; transcription factor, zf-fungal binuclear cluster type (predicted) 3014577 2539828 SPBC15D4.02 Schizosaccharomyces pombe 972h- transcription factor, zf-fungal binuclear cluster type (predicted) NP_596242.2 3013318 D 284812 CDS SPBC15D4.03 19113035 2540128 3015538..3017961 1 NC_003423.3 hira protein Slm9 3017961 slm9 2540128 slm9 Schizosaccharomyces pombe 972h- hira protein Slm9 NP_596243.1 3015538 D 284812 CDS SPBC15D4.04 19113036 2539795 3018244..3019584 1 NC_003423.3 UDP-N-acetylglucosamine--dolichyl-phosphateN- acet ylglucosaminephosphotransferase 3019584 gpt2 2539795 gpt2 Schizosaccharomyces pombe 972h- UDP-N-acetylglucosamine--dolichyl-phosphateN- acet ylglucosaminephosphotransferase NP_596244.1 3018244 D 284812 CDS SPBC15D4.05 19113037 2539606 3020853..3022088 1 NC_003423.3 conserved CobW/HypB/UreG nucleotide binding domain protein (predicted) 3022088 2539606 SPBC15D4.05 Schizosaccharomyces pombe 972h- conserved CobW/HypB/UreG nucleotide binding domain protein (predicted) NP_596245.1 3020853 D 284812 CDS SPBC15D4.06 19113038 2539835 join(3022433..3022548,3022637..3022973) 1 NC_003423.3 NatC N-acetyltransferase complex catalytic subunit (predicted) 3022973 2539835 SPBC15D4.06 Schizosaccharomyces pombe 972h- NatC N-acetyltransferase complex catalytic subunit (predicted) NP_596246.1 3022433 D 284812 CDS SPBC15D4.07c 19113039 2539850 complement(3023513..3025621) 1 NC_003423.3 autophagy associated protein Atg9 (predicted) 3025621 atg9 2539850 atg9 Schizosaccharomyces pombe 972h- autophagy associated protein Atg9 (predicted) NP_596247.1 3023513 R 284812 CDS SPBC15D4.08c 19113040 2539717 complement(3025659..3026075) 1 NC_003423.3 dubious 3026075 2539717 SPBC15D4.08c Schizosaccharomyces pombe 972h- dubious NP_596248.1 3025659 R 284812 CDS SPBC15D4.09c 19113041 2539747 complement(3026441..3028273) 1 NC_003423.3 candidate for met3, but not proven experimentally; pers. comm. Juerg Kohli; cystathionine gamma-synthase (predicted) 3028273 2539747 SPBC15D4.09c Schizosaccharomyces pombe 972h- cystathionine gamma-synthase (predicted) NP_596249.1 3026441 R 284812 CDS SPBC15D4.10c 19113042 2539911 complement(join(3028705..3028877,3028938..3030192)) 1 NC_003423.3 Aberrent Microtubules when Overexpressed; nuclear rim protein Amo1 3030192 amo1 2539911 amo1 Schizosaccharomyces pombe 972h- nuclear rim protein Amo1 NP_596250.1 3028705 R 284812 CDS SPBC15D4.11c 19113043 2540143 complement(join(3030371..3030721,3030760..3030913,3031055..3031341)) 1 NC_003423.3 sequence orphan 3031341 2540143 SPBC15D4.11c Schizosaccharomyces pombe 972h- sequence orphan NP_596251.1 3030371 R 284812 CDS SPBC15D4.12c 19113044 2539618 complement(join(3031750..3032057,3032096..3032129)) 1 NC_003423.3 possibly merged to SPBC15D4.13c but can't identify correct splicing; sequence orphan 3032129 mug98 2539618 mug98 Schizosaccharomyces pombe 972h- sequence orphan NP_596252.1 3031750 R 284812 CDS SPBC15D4.13c 295442874 2539646 complement(join(3032492..3032710,3032761..3032822,3032889..3033222)) 1 NC_003423.3 human ASCC1 ortholog (predicted) 3033222 2539646 SPBC15D4.13c Schizosaccharomyces pombe 972h- human ASCC1 ortholog (predicted) XP_001713141.2 3032492 R 284812 CDS SPBC15D4.14 19113046 2539882 join(3033881..3035353,3035410..3035865) 1 NC_003423.3 transcription factor TFIID complex subunit Taf5-like 3035865 taf73 2539882 taf73 Schizosaccharomyces pombe 972h- transcription factor TFIID complex subunit Taf5-like NP_596254.1 3033881 D 284812 CDS SPBC15D4.15 19113047 2539960 join(3036128..3036206,3036254..3036322,3036362..3037110) 1 NC_003423.3 4-nitrophenylphosphatase 3037110 pho2 2539960 pho2 Schizosaccharomyces pombe 972h- 4-nitrophenylphosphatase NP_596255.1 3036128 D 284812 CDS SPBC13E7.01 295442876 2539941 join(3037988..3040331,3040331..3040650) 1 NC_003423.3 splicing factor Cwf22 3040650 cwf22 2539941 cwf22 Schizosaccharomyces pombe 972h- splicing factor Cwf22 NP_596256.3 3037988 D 284812 CDS SPBC13E7.02 19113049 2540186 3041802..3043403 1 NC_003423.3 domain combination does not usually co-occur, check sequence; zf-C3HC4 type (RING finger)/GCN5-related N acetyltransferase fusion protein 3043403 cwf24 2540186 cwf24 Schizosaccharomyces pombe 972h- zf-C3HC4 type (RING finger)/GCN5-related N acetyltransferase fusion protein NP_596257.1 3041802 D 284812 CDS SPBC13E7.03c 19113050 2540161 complement(3043625..3045766) 1 NC_003423.3 RNA hairpin binding protein (predicted) 3045766 2540161 SPBC13E7.03c Schizosaccharomyces pombe 972h- RNA hairpin binding protein (predicted) NP_596258.1 3043625 R 284812 CDS SPBC13E7.04 19113051 2540185 3046873..3047355 1 NC_003423.3 F1-ATPase delta subunit (predicted) 3047355 atp16 2540185 atp16 Schizosaccharomyces pombe 972h- F1-ATPase delta subunit (predicted) NP_596259.1 3046873 D 284812 CDS SPBC13E7.05 19113052 2540126 join(3047980..3050193,3050244..3050477) 1 NC_003423.3 large N-terminal extension; pig-M 3050477 gpi14 2540126 gpi14 Schizosaccharomyces pombe 972h- pig-M NP_596260.1 3047980 D 284812 CDS SPBC13E7.06 19113053 2539908 3050580..3051575 1 NC_003423.3 mitotic-spindle disanchored Msd1 3051575 msd1 2539908 msd1 Schizosaccharomyces pombe 972h- mitotic-spindle disanchored Msd1 NP_596261.1 3050580 D 284812 CDS SPBC13E7.07 19113054 2539932 3052511..3053332 1 NC_003423.3 sequence orphan 3053332 2539932 SPBC13E7.07 Schizosaccharomyces pombe 972h- sequence orphan NP_596262.1 3052511 D 284812 CDS SPBC13E7.08c 19113055 2539726 complement(join(3053605..3054703,3054894..3055084)) 1 NC_003423.3 RNA polymerase II associated Paf1 complex (predicted) 3055084 2539726 SPBC13E7.08c Schizosaccharomyces pombe 972h- RNA polymerase II associated Paf1 complex (predicted) NP_596263.1 3053605 R 284812 CDS SPBC13E7.09 19113056 2540100 join(3055475..3056273,3056326..3056456) 1 NC_003423.3 verprolin 3056456 vrp1 2540100 vrp1 Schizosaccharomyces pombe 972h- verprolin NP_596264.1 3055475 D 284812 CDS SPBC13E7.10c 19113057 2540071 complement(join(3056760..3058060,3058218..3058330,3058392..3058474,3058584..3058589)) 1 NC_003423.3 transcription factor TFIIIB complex subunit Brf1 3058589 brf1 2540071 brf1 Schizosaccharomyces pombe 972h- transcription factor TFIIIB complex subunit Brf1 NP_596265.1 3056760 R 284812 CDS SPBC13E7.11 162312279 2540108 3059132..3060028 1 NC_003423.3 mitochondrial rhomboid protease 3060028 2540108 SPBC13E7.11 Schizosaccharomyces pombe 972h- mitochondrial rhomboid protease NP_596266.2 3059132 D 284812 CDS SPBC30D10.18c 19113059 2540378 join(3060570..3060957,3061219..3061481) 1 NC_003423.3 60S ribosomal protein L10a 3061481 rpl102 2540378 rpl102 Schizosaccharomyces pombe 972h- 60S ribosomal protein L10a NP_596267.1 3060570 D 284812 CDS SPBC30D10.17c 19113060 2540339 3062313..3063827 1 NC_003423.3 not glucan synthase EC 2.4.1.34 as reported in SW:GS1_NEUCR; cell wall biosynthesis/ cell cycle regulator (predicted) 3063827 smi1 2540339 smi1 Schizosaccharomyces pombe 972h- cell wall biosynthesis/ cell cycle regulator (predicted) NP_596268.1 3062313 D 284812 CDS SPBC30D10.16 19113061 2540319 complement(join(3064223..3065032,3065178..3065231)) 1 NC_003423.3 splicing possibly incorrectly predicted; phrenate dehydratase 3065231 pha2 2540319 pha2 Schizosaccharomyces pombe 972h- phrenate dehydratase NP_596269.1 3064223 R 284812 CDS SPBC30D10.15 19113062 2540349 complement(3065947..3067497) 1 NC_003423.3 snoRNP assembly factor Naf1 (predicted) 3067497 2540349 SPBC30D10.15 Schizosaccharomyces pombe 972h- snoRNP assembly factor Naf1 (predicted) NP_596270.1 3065947 R 284812 CDS SPBC30D10.14 19113063 2540359 complement(3067996..3068745) 1 NC_003423.3 dienelactone hydrolase family 3068745 2540359 SPBC30D10.14 Schizosaccharomyces pombe 972h- dienelactone hydrolase family NP_596271.1 3067996 R 284812 CDS SPBC30D10.13c 19113064 2540273 3070543..3071643 1 NC_003423.3 pyruvate dehydrogenase e1 component beta subunit Pdb1 3071643 pdb1 2540273 pdb1 Schizosaccharomyces pombe 972h- pyruvate dehydrogenase e1 component beta subunit Pdb1 NP_596272.1 3070543 D 284812 CDS SPBC30D10.12c 19113065 2540477 join(3072394..3072629,3072695..3072732,3072786..3072793) 1 NC_003423.3 mitochondrial ribosomal protein subunit S27 3072793 rsm27 2540477 rsm27 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit S27 NP_596273.1 3072394 D 284812 CDS SPBC30D10.11 19113066 2540323 complement(3072988..3074949) 1 NC_003423.3 pig-Q 3074949 gpi1 2540323 gpi1 Schizosaccharomyces pombe 972h- pig-Q NP_596274.1 3072988 R 284812 CDS SPBC30D10.10c 19113067 2540473 3075961..3082968 1 NC_003423.3 phosphatidylinositol kinase Tor1 3082968 tor1 2540473 tor1 Schizosaccharomyces pombe 972h- phosphatidylinositol kinase Tor1 NP_596275.1 3075961 D 284812 CDS SPBC30D10.09c 19113068 2540280 join(3083317..3083483,3083527..3083648,3083742..3084106) 1 NC_003423.3 HVA22/TB2/DP1 family protein 3084106 2540280 SPBC30D10.09c Schizosaccharomyces pombe 972h- HVA22/TB2/DP1 family protein NP_596276.1 3083317 D 284812 CDS SPBC30D10.08 19113069 2540271 complement(3084534..3085337) 1 NC_003423.3 mitochondrial DNA repair protein 3085337 mgm101 2540271 mgm101 Schizosaccharomyces pombe 972h- mitochondrial DNA repair protein NP_596277.1 3084534 R 284812 CDS SPBC30D10.07c 19113070 2540476 3086128..3088023 1 NC_003423.3 biotin-protein ligase (predicted) 3088023 2540476 SPBC30D10.07c Schizosaccharomyces pombe 972h- biotin-protein ligase (predicted) NP_596278.1 3086128 D 284812 CDS SPBC30D10.06 19113071 2540475 complement(join(3088425..3088595,3088661..3088852,3088891..3088893)) 1 NC_003423.3 U6 snRNP-associated protein Lsm4 3088893 lsm4 2540475 lsm4 Schizosaccharomyces pombe 972h- U6 snRNP-associated protein Lsm4 NP_596279.1 3088425 R 284812 CDS SPBC30D10.05c 19113072 2540402 3089997..3090740 1 NC_003423.3 hypothetical protein 3090740 2540402 SPBC30D10.05c Schizosaccharomyces pombe 972h- hypothetical protein NP_596280.1 3089997 D 284812 CDS SPBC30D10.04 68012432 3361323 complement(join(3090924..3091302,3091361..3091527)) 1 NC_003423.3 replication fork protection complex subunit Swi3 3091527 swi3 3361323 swi3 Schizosaccharomyces pombe 972h- replication fork protection complex subunit Swi3 NP_001018832.1 3090924 R 284812 CDS SPBC30D10.03c 19113074 2540344 join(3092083..3092290,3092340..3093262,3093313..3093399) 1 NC_003423.3 IMP 5'-nucleotidase (predicted) 3093399 2540344 SPBC30D10.03c Schizosaccharomyces pombe 972h- IMP 5'-nucleotidase (predicted) NP_596282.1 3092083 D 284812 CDS SPBC30D10.02 19113075 2540406 complement(join(3093811..3094253,3094293..3094335)) 1 NC_003423.3 transcription corepressor (predicted) 3094335 2540406 SPBC30D10.02 Schizosaccharomyces pombe 972h- transcription corepressor (predicted) NP_596283.1 3093811 R 284812 CDS SPBC1778.01c 162312281 2539801 complement(3094994..3096322) 1 NC_003423.3 zuotin (predicted) 3096322 zuo1 2539801 zuo1 Schizosaccharomyces pombe 972h- zuotin (predicted) NP_596284.2 3094994 R 284812 CDS SPBC1778.02 19113077 2540115 join(3098366..3098461,3098508..3098879,3098963..3100576) 1 NC_003423.3 sequence updated: 22.05.01. N-terminal exon added Yasushi Hiraoka, pers comm; telomere binding protein Rap1 3100576 rap1 2540115 rap1 Schizosaccharomyces pombe 972h- telomere binding protein Rap1 NP_596285.1 3098366 D 284812 CDS SPBC1778.03c 19113078 2540122 complement(join(3100855..3101953,3102134..3102165)) 1 NC_003423.3 NADH pyrophosphatase (predicted) 3102165 2540122 SPBC1778.03c Schizosaccharomyces pombe 972h- NADH pyrophosphatase (predicted) NP_596286.1 3100855 R 284812 CDS SPBC1778.04 19113079 2540044 join(3103284..3103748,3103800..3103932,3103979..3104700,3104747..3104851) 1 NC_003423.3 Spo4-Spo6 kinase complex regulatory subunit Spo6 3104851 spo6 2540044 spo6 Schizosaccharomyces pombe 972h- Spo4-Spo6 kinase complex regulatory subunit Spo6 NP_596287.1 3103284 D 284812 CDS SPBC1778.05c 19113080 2540131 complement(3105116..3105412) 1 NC_003423.3 has transcript profile on microarray; sequence orphan 3105412 2540131 SPBC1778.05c Schizosaccharomyces pombe 972h- sequence orphan NP_596288.1 3105116 R 284812 CDS SPBC1778.06c 19113081 2539765 complement(join(3106767..3106888,3106943..3108431,3108508..3108741)) 1 NC_003423.3 fimbrin 3108741 fim1 2539765 fim1 Schizosaccharomyces pombe 972h- fimbrin NP_596289.1 3106767 R 284812 CDS SPBC1778.07 19113082 2540132 join(3109961..3110462,3110580..3111199) 1 NC_003423.3 methyltransferase N2227 family 3111199 2540132 SPBC1778.07 Schizosaccharomyces pombe 972h- methyltransferase N2227 family NP_596290.1 3109961 D 284812 CDS SPBC1778.08c 19113083 2540144 complement(join(3111458..3111600,3111697..3111972,3112053..3112152,3112199..3112204)) 1 NC_003423.3 ARP2/3 actin-organizing complex subunit Arc21 3112204 arc3 2540144 arc3 Schizosaccharomyces pombe 972h- ARP2/3 actin-organizing complex subunit Arc21 NP_596291.1 3111458 R 284812 CDS SPBC1778.09 19113084 2539715 3112724..3113968 1 NC_003423.3 GTPase activating protein (predicted) 3113968 2539715 SPBC1778.09 Schizosaccharomyces pombe 972h- GTPase activating protein (predicted) NP_596292.1 3112724 D 284812 CDS SPBC1778.10c 162312283 2539807 complement(join(3114461..3115394,3115445..3115615,3115679..3115788,3115843..3116079,3116183..3116383)) 1 NC_003423.3 serine/threonine protein kinase Ppk21 3116383 ppk21 2539807 ppk21 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Ppk21 XP_001713142.1 3114461 R 284812 CDS SPBC4C3.10c 19113087 2540878 join(3117669..3117724,3117768..3117850,3117903..3118035,3118219..3118627) 1 NC_003423.3 20S proteasome component beta 1 Pre3 (predicted) 3118627 pre3 2540878 pre3 Schizosaccharomyces pombe 972h- 20S proteasome component beta 1 Pre3 (predicted) NP_596295.1 3117669 D 284812 CDS SPBC4C3.09 19113088 2540859 complement(3119227..3120357) 1 NC_003423.3 acetylglucosaminyltransferase (predicted) 3120357 2540859 SPBC4C3.09 Schizosaccharomyces pombe 972h- acetylglucosaminyltransferase (predicted) NP_596296.1 3119227 R 284812 CDS SPBC4C3.08 19113089 2541006 complement(3121286..3122404) 1 NC_003423.3 acetylglucosaminyltransferase (predicted) 3122404 mug136 2541006 mug136 Schizosaccharomyces pombe 972h- acetylglucosaminyltransferase (predicted) NP_596297.1 3121286 R 284812 CDS SPBC4C3.07 19113090 2540868 complement(3122898..3123806) 1 NC_003423.3 was incorrectly annotated as COP9/signalosome complex, updated 8 Sept 2000, (PMID 15904532); translation initiation factor eIF3f 3123806 2540868 SPBC4C3.07 Schizosaccharomyces pombe 972h- translation initiation factor eIF3f NP_596298.1 3122898 R 284812 CDS SPBC4C3.06 19113091 2540862 complement(join(3124204..3126618,3126660..3126701)) 1 NC_003423.3 NAS GO annotation inferred from S. cerevisiae orthologs genetic interactions with profilin; actin cytoskeletal protein Syp1 3126701 2540862 SPBC4C3.06 Schizosaccharomyces pombe 972h- actin cytoskeletal protein Syp1 NP_596299.1 3124204 R 284812 CDS SPBC4C3.05c 19113092 2540873 3127899..3132968 1 NC_003423.3 DNA-directed RNA polymerase I complex large subunit Nuc1 3132968 nuc1 2540873 nuc1 Schizosaccharomyces pombe 972h- DNA-directed RNA polymerase I complex large subunit Nuc1 NP_596300.1 3127899 D 284812 CDS SPBC4C3.12 19113093 2540866 complement(3133495..3135486) 1 NC_003423.3 fork head transcription factor Sep1 3135486 sep1 2540866 sep1 Schizosaccharomyces pombe 972h- fork head transcription factor Sep1 NP_596301.1 3133495 R 284812 CDS SPBC4C3.04c 19113094 2540823 3137606..3137908 1 NC_003423.3 guanyl-nucleotide exchange factor (predicted) 3137908 2540823 SPBC4C3.04c Schizosaccharomyces pombe 972h- guanyl-nucleotide exchange factor (predicted) NP_596302.1 3137606 D 284812 CDS SPBC4C3.03 19113095 2540857 complement(3138551..3139567) 1 NC_003423.3 homoserine kinase (predicted) 3139567 2540857 SPBC4C3.03 Schizosaccharomyces pombe 972h- homoserine kinase (predicted) NP_596303.1 3138551 R 284812 CDS SPBC405.01 19113096 2541034 3140722..3143088 1 NC_003423.3 phosphoribosylamine-glycine ligase 3143088 ade1 2541034 ade1 Schizosaccharomyces pombe 972h- phosphoribosylamine-glycine ligase NP_596304.1 3140722 D 284812 CDS SPBC405.02c 162312285 2541023 complement(3143466..3144809) 1 NC_003423.3 sequence orphan 3144809 2541023 SPBC405.02c Schizosaccharomyces pombe 972h- sequence orphan NP_596305.2 3143466 R 284812 CDS SPBC405.03c 19113098 2540974 complement(3145630..3146655) 1 NC_003423.3 membrane transporter (predicted) 3146655 2540974 SPBC405.03c Schizosaccharomyces pombe 972h- membrane transporter (predicted) NP_596306.1 3145630 R 284812 CDS SPBC405.04c 19113099 2540763 complement(join(3147478..3147690,3147753..3148076,3148150..3148230)) 1 NC_003423.3 GTPase Ypt7 3148230 ypt7 2540763 ypt7 Schizosaccharomyces pombe 972h- GTPase Ypt7 NP_596307.1 3147478 R 284812 CDS SPBC405.05 19113100 2540530 3148752..3149183 1 NC_003423.3 sequence orphan 3149183 2540530 SPBC405.05 Schizosaccharomyces pombe 972h- sequence orphan NP_596308.1 3148752 D 284812 CDS SPBC405.06 19113101 2540773 3150758..3151999 1 NC_003423.3 DNAJ protein Xdj1 (predicted) 3151999 2540773 SPBC405.06 Schizosaccharomyces pombe 972h- DNAJ protein Xdj1 (predicted) NP_596309.1 3150758 D 284812 CDS SPBC405.07 19113102 2540644 join(3153502..3153723,3153799..3153876) 1 NC_003423.3 60S ribosomal protein L36 3153876 rpl3602 2540644 rpl3602 Schizosaccharomyces pombe 972h- 60S ribosomal protein L36 NP_596310.1 3153502 D 284812 CDS SPBC609.01 19113103 2540838 join(3157597..3157717,3157860..3161212) 1 NC_003423.3 ribonuclease II (RNB) family 3161212 2540838 SPBC609.01 Schizosaccharomyces pombe 972h- ribonuclease II (RNB) family NP_596311.1 3157597 D 284812 CDS SPBC609.02 19113104 2541101 3161823..3162869 1 NC_003423.3 phosphatidylinositol-3,4, 5-trisphosphate3-phospha tase 3162869 ptn1 2541101 ptn1 Schizosaccharomyces pombe 972h- phosphatidylinositol-3,4, 5-trisphosphate3-phospha tase NP_596312.1 3161823 D 284812 CDS SPBC609.03 19113105 2541121 join(3163172..3163232,3163278..3163371,3163418..3164102,3164144..3165642,3165694..3165784) 1 NC_003423.3 WD repeat protein, human IQWD1 family 3165784 2541121 SPBC609.03 Schizosaccharomyces pombe 972h- WD repeat protein, human IQWD1 family NP_596313.1 3163172 D 284812 CDS SPBC609.04 19113106 2541116 3166680..3168275 1 NC_003423.3 spermine family transmembrane transporter Caf5 3168275 caf5 2541116 caf5 Schizosaccharomyces pombe 972h- spermine family transmembrane transporter Caf5 NP_596314.1 3166680 D 284812 CDS SPBC609.05 19113107 2541088 join(3169409..3169645,3169705..3171006) 1 NC_003423.3 FACT complex component Pob3 3171006 pob3 2541088 pob3 Schizosaccharomyces pombe 972h- FACT complex component Pob3 NP_596315.1 3169409 D 284812 CDS SPBC776.01 19113108 2541172 join(3172323..3172349,3172403..3172561) 1 NC_003423.3 60S ribosomal protein L29 3172561 rpl29 2541172 rpl29 Schizosaccharomyces pombe 972h- 60S ribosomal protein L29 NP_596316.1 3172323 D 284812 CDS SPBC776.02c 19113109 2541193 complement(join(3173719..3174650,3175047..3175098)) 1 NC_003423.3 double mutant dis2delta/sds21delta lethal; phosphorylation site: T316 cdc2 kinase in vitro (PMID: 795709); serine/threonine protein phosphatase PP1 3175098 dis2 2541193 dis2 Schizosaccharomyces pombe 972h- serine/threonine protein phosphatase PP1 NP_596317.1 3173719 R 284812 CDS SPBC776.03 19113110 2541148 join(3176694..3176733,3176803..3177893) 1 NC_003423.3 homoserine dehydrogenase (predicted) 3177893 2541148 SPBC776.03 Schizosaccharomyces pombe 972h- homoserine dehydrogenase (predicted) NP_596318.1 3176694 D 284812 CDS SPBC776.04 19113111 2541164 join(3178613..3178643,3178693..3178864,3178914..3178945,3179107..3181169) 1 NC_003423.3 GTPase activating protein Sec23b (predicted) 3181169 sec2302 2541164 sec2302 Schizosaccharomyces pombe 972h- GTPase activating protein Sec23b (predicted) NP_596319.1 3178613 D 284812 CDS SPBC776.05 19113112 2541180 join(3182005..3182184,3182236..3182507,3182584..3182653,3182692..3182816,3182860..3183120,3183166..3183368,3183418..3183521) 1 NC_003423.3 membrane transporter (predicted) 3183521 2541180 SPBC776.05 Schizosaccharomyces pombe 972h- membrane transporter (predicted) NP_596320.1 3182005 D 284812 CDS SPBC776.06c 19113113 2541190 complement(3183803..3185599) 1 NC_003423.3 cytoskeletal protein 3185599 2541190 SPBC776.06c Schizosaccharomyces pombe 972h- cytoskeletal protein NP_596321.1 3183803 R 284812 CDS SPBC776.07 19113114 2541189 join(3186434..3186756,3186876..3187362) 1 NC_003423.3 mitochondrial Mam33 family protein 3187362 2541189 SPBC776.07 Schizosaccharomyces pombe 972h- mitochondrial Mam33 family protein NP_596322.1 3186434 D 284812 CDS SPBC776.08c 19113115 2541176 complement(join(3187742..3190984,3191036..3191086)) 1 NC_003423.3 Nrap 3191086 2541176 SPBC776.08c Schizosaccharomyces pombe 972h- Nrap NP_596323.1 3187742 R 284812 CDS SPBC776.09 19113116 2541216 join(3191548..3191655,3191702..3191751,3191803..3193102) 1 NC_003423.3 ATP-dependent RNA helicase Ste13 3193102 ste13 2541216 ste13 Schizosaccharomyces pombe 972h- ATP-dependent RNA helicase Ste13 NP_596324.1 3191548 D 284812 CDS SPBC776.10c 19113117 2541207 complement(join(3193434..3194238,3194295..3195256,3195309..3195569)) 1 NC_003423.3 Golgi transport complex peripheral subunit Cog6 (predicted) 3195569 cog6 2541207 cog6 Schizosaccharomyces pombe 972h- Golgi transport complex peripheral subunit Cog6 (predicted) NP_596325.1 3193434 R 284812 CDS SPBC776.11 19113118 2541130 3196491..3196937 1 NC_003423.3 60S ribosomal protein L27/L28 3196937 rpl2801 2541130 rpl2801 Schizosaccharomyces pombe 972h- 60S ribosomal protein L27/L28 NP_596326.1 3196491 D 284812 CDS SPBC776.12c 19113119 2541165 complement(join(3197331..3197779,3197843..3198688,3198747..3198975)) 1 NC_003423.3 Dbf4(Dfp1)-dependent protein kinase Hsk1 3198975 hsk1 2541165 hsk1 Schizosaccharomyces pombe 972h- Dbf4(Dfp1)-dependent protein kinase Hsk1 NP_596328.1 3197331 R 284812 CDS SPBC776.13 19113121 2541201 join(3200138..3200252,3200323..3200401,3200493..3203775) 1 NC_003423.3 condensin, non-SMC subunit Cnd1 3203775 cnd1 2541201 cnd1 Schizosaccharomyces pombe 972h- condensin, non-SMC subunit Cnd1 NP_596329.1 3200138 D 284812 CDS SPBC776.14 19113122 2541187 join(3204448..3205431,3205477..3205568,3205673..3205700,3205749..3205811,3205872..3206111,3206153..3206299,3206345..3206551,3206601..3206668,3206717..3206759) 1 NC_003423.3 Pombe LRO 1 Homolog 1; phospholipid-diacylglycerol acyltransferase Plh1 3206759 plh1 2541187 plh1 Schizosaccharomyces pombe 972h- phospholipid-diacylglycerol acyltransferase Plh1 NP_596330.1 3204448 D 284812 CDS SPBC776.15c 19113123 2541170 complement(join(3206869..3208034,3208095..3208166,3208459..3208579)) 1 NC_003423.3 dihydrolipoamide S-succinyltransferase, e2 component of oxoglutarate dehydrogenase complex (predicted) 3208579 2541170 SPBC776.15c Schizosaccharomyces pombe 972h- dihydrolipoamide S-succinyltransferase, e2 component of oxoglutarate dehydrogenase complex (predicted) NP_596331.1 3206869 R 284812 CDS SPBC776.16 19113124 2541134 3210022..3210783 1 NC_003423.3 sequence orphan 3210783 2541134 SPBC776.16 Schizosaccharomyces pombe 972h- sequence orphan NP_596332.1 3210022 D 284812 CDS SPBC776.17 19113125 2541174 3211353..3212117 1 NC_003423.3 rRNA processing protein Rrp7 (predicted) 3212117 2541174 SPBC776.17 Schizosaccharomyces pombe 972h- rRNA processing protein Rrp7 (predicted) NP_596333.1 3211353 D 284812 CDS SPBC776.18c 19113126 2540684 complement(join(3212331..3212472,3212528..3212996,3213042..3213115,3213166..3213305,3213367..3213470,3213523..3213550)) 1 NC_003423.3 mitotic catastrophe suppressor (pers. comm. R Fisher); transcription factor TFIIH complex subunit Pmh1 3213550 pmh1 2540684 pmh1 Schizosaccharomyces pombe 972h- transcription factor TFIIH complex subunit Pmh1 NP_596334.1 3212331 R 284812 CDS SPBC21.01 68012489 3361327 join(3214271..3214329,3214370..3215429,3215479..3215685) 1 NC_003423.3 kinetochore protein Mis17 3215685 mis17 3361327 mis17 Schizosaccharomyces pombe 972h- kinetochore protein Mis17 NP_001018835.1 3214271 D 284812 CDS SPBC21.02 19113128 2540756 join(3216269..3216389,3216442..3216502,3216560..3217913) 1 NC_003423.3 TLDc domain protein 2 3217913 2540756 SPBC21.02 Schizosaccharomyces pombe 972h- TLDc domain protein 2 NP_596336.1 3216269 D 284812 CDS SPBC21.03c 295442878 2540783 complement(join(3217985..3218424,3218462..3218491,3218580..3218651,3218704..3218947)) 1 NC_003423.3 NOTE this is s-adenosyl l-homocysteinhydrolase in bacteria; splicing may be incorrect; DUF55 family protein 3218947 2540783 SPBC21.03c Schizosaccharomyces pombe 972h- DUF55 family protein NP_596337.2 3217985 R 284812 CDS SPBC21.04 19113130 2540761 join(3219604..3219731,3219869..3220343) 1 NC_003423.3 mediator complex subunit Med8 3220343 med8 2540761 med8 Schizosaccharomyces pombe 972h- mediator complex subunit Med8 NP_596338.1 3219604 D 284812 CDS SPBC21.05c 19113131 2540760 complement(3220346..3222181) 1 NC_003423.3 Ras1-Scd pathway protein Ral2 3222181 ral2 2540760 ral2 Schizosaccharomyces pombe 972h- Ras1-Scd pathway protein Ral2 NP_596339.1 3220346 R 284812 CDS SPBC21.06c 19113132 2540660 complement(join(3222781..3224202,3224239..3224373,3224415..3224767,3224805..3224868,3224937..3225178,3225219..3225680,3225731..3225984,3226032..3226096,3226146..3226175,3226217..3226351,3226404..3226430)) 1 NC_003423.3 serine/threonine protein kinase Cdc7 3226430 cdc7 2540660 cdc7 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Cdc7 NP_596340.1 3222781 R 284812 CDS SPBC21.07c 19113133 2540596 complement(join(3226820..3227271,3227354..3228287)) 1 NC_003423.3 N-terminal prediction possibly incorrect; serine/threonine protein kinase Ppk24 3228287 ppk24 2540596 ppk24 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Ppk24 NP_596341.1 3226820 R 284812 CDS SPBC19F8.01c 162312287 2540413 complement(join(3228880..3229160,3229203..3229315,3229355..3229866,3230018..3230111,3230162..3230243,3230288..3230492)) 1 NC_003423.3 septin Spn7 3230492 spn7 2540413 spn7 Schizosaccharomyces pombe 972h- septin Spn7 XP_001713143.1 3228880 R 284812 CDS SPBC19F8.02 19113136 2540736 3231521..3232021 1 NC_003423.3 nuclear distribution protein NUDC homolog 3232021 2540736 SPBC19F8.02 Schizosaccharomyces pombe 972h- nuclear distribution protein NUDC homolog NP_596344.1 3231521 D 284812 CDS SPBC19F8.03c 19113137 2540702 complement(join(3232304..3234207,3234254..3234299)) 1 NC_003423.3 ENTH/VHS domain protein 3234299 2540702 SPBC19F8.03c Schizosaccharomyces pombe 972h- ENTH/VHS domain protein NP_596345.1 3232304 R 284812 CDS SPBC19F8.04c 19113138 2540556 complement(3234821..3235513) 1 NC_003423.3 nuclease 3235513 2540556 SPBC19F8.04c Schizosaccharomyces pombe 972h- nuclease NP_596346.1 3234821 R 284812 CDS SPBC19F8.05 19113139 2540748 3238363..3239019 1 NC_003423.3 sequence orphan 3239019 2540748 SPBC19F8.05 Schizosaccharomyces pombe 972h- sequence orphan NP_596347.1 3238363 D 284812 CDS SPBC19F8.06c 19113140 2540779 complement(3239223..3240947) 1 NC_003423.3 amino acid permease, unknown 11 3240947 meu22 2540779 meu22 Schizosaccharomyces pombe 972h- amino acid permease, unknown 11 NP_596348.1 3239223 R 284812 CDS SPBC19F8.07 19113141 2540471 3243429..3244436 1 NC_003423.3 cyclin-dependent protein kinase/CDK-activating kinase Mcs6 3244436 mcs6 2540471 mcs6 Schizosaccharomyces pombe 972h- cyclin-dependent protein kinase/CDK-activating kinase Mcs6 NP_596349.1 3243429 D 284812 CDS SPBC19F8.08 19113142 2540649 3245143..3245931 1 NC_003423.3 40S ribosomal protein S4 3245931 rps401 2540649 rps401 Schizosaccharomyces pombe 972h- 40S ribosomal protein S4 NP_596350.1 3245143 D 284812 CDS SPBC25H2.16c 19113143 2540570 join(3246584..3246620,3246658..3246745,3246799..3246874,3247125..3247362,3247419..3248389,3248433..3248624) 1 NC_003423.3 adaptin (predicted) 3248624 2540570 SPBC25H2.16c Schizosaccharomyces pombe 972h- adaptin (predicted) NP_596351.1 3246584 D 284812 CDS SPBC25H2.15 19113144 2540619 complement(3248812..3250002) 1 NC_003423.3 programmed cell death protein homolog 3250002 2540619 SPBC25H2.15 Schizosaccharomyces pombe 972h- programmed cell death protein homolog NP_596352.1 3248812 R 284812 CDS SPBC25H2.14 19113145 2540482 complement(join(3250199..3250332,3250426..3250505,3250567..3250927,3250994..3250997,3251069..3251146,3251197..3251247)) 1 NC_003423.3 UNC-50 family protein 3251247 mug16 2540482 mug16 Schizosaccharomyces pombe 972h- UNC-50 family protein NP_596353.1 3250199 R 284812 CDS SPBC25H2.13c 19113146 2540627 3253889..3260488 1 NC_003423.3 DNA polymerase epsilon catalytic subunit a Pol2 3260488 cdc20 2540627 cdc20 Schizosaccharomyces pombe 972h- DNA polymerase epsilon catalytic subunit a Pol2 NP_596354.1 3253889 D 284812 CDS SPBC25H2.12c 19113147 2540572 join(3260919..3260952,3260995..3261418,3261586..3262804) 1 NC_003423.3 chaperonin-containing T-complex eta subunit Cct7 3262804 cct7 2540572 cct7 Schizosaccharomyces pombe 972h- chaperonin-containing T-complex eta subunit Cct7 NP_596355.1 3260919 D 284812 CDS SPBC25H2.11c 19113148 2540408 join(3263377..3263950,3263992..3264191,3264337..3264438,3264481..3264619,3264667..3265910,3265950..3266093,3266137..3266351,3266397..3266718) 1 NC_003423.3 SAGA complex bromodomain subunit Spt7 3266718 spt7 2540408 spt7 Schizosaccharomyces pombe 972h- SAGA complex bromodomain subunit Spt7 NP_596356.1 3263377 D 284812 CDS SPBC25H2.10c 68012511 3361329 join(3267015..3267086,3267194..3267304,3267355..3267511,3267597..3267802,3267852..3267995,3268048..3268221) 1 NC_003423.3 new gene prediction (changed N terminal exon to give different donor, and canged acceptor for 2nd exon) removed stop codon from translation, status changed from pseudo to coding (V.W 15.03.2004); tRNA acetyltransferase (predicted) 3268221 3361329 SPBC25H2.10c Schizosaccharomyces pombe 972h- tRNA acetyltransferase (predicted) NP_001018836.1 3267015 D 284812 CDS SPBC25H2.09 19113149 2540563 complement(3268891..3269379) 1 NC_003423.3 PSORT 87.0 %: nuclear, 8.7 %: mitochondrial, 4.3 %: cytoplasmic; DUF1690 family protein 3269379 2540563 SPBC25H2.09 Schizosaccharomyces pombe 972h- DUF1690 family protein NP_596357.1 3268891 R 284812 CDS SPBC25H2.08c 19113150 2540385 3270232..3271500 1 NC_003423.3 magnesium ion transporter Mrs2 3271500 mrs2 2540385 mrs2 Schizosaccharomyces pombe 972h- magnesium ion transporter Mrs2 NP_596358.1 3270232 D 284812 CDS SPBC25H2.07 19113151 2540521 complement(3272287..3272703) 1 NC_003423.3 translation initiation factor eIF1A 3272703 tif11 2540521 tif11 Schizosaccharomyces pombe 972h- translation initiation factor eIF1A NP_596359.1 3272287 R 284812 CDS SPBC25H2.06c 19113152 2540356 3272930..3273811 1 NC_003423.3 COPII-coated vesicle component Hrf1 (predicted) 3273811 hrf1 2540356 hrf1 Schizosaccharomyces pombe 972h- COPII-coated vesicle component Hrf1 (predicted) NP_596360.1 3272930 D 284812 CDS SPBC25H2.05 19113153 2540432 complement(3274957..3275478) 1 NC_003423.3 nascent polypeptide-associated complex alpha subunit Egd2 3275478 egd2 2540432 egd2 Schizosaccharomyces pombe 972h- nascent polypeptide-associated complex alpha subunit Egd2 NP_596361.1 3274957 R 284812 CDS SPBC25H2.04c 19113154 2540483 3275859..3276386 1 NC_003423.3 TIM22 inner membrane protein import complex subunit Tim22 3276386 tim22 2540483 tim22 Schizosaccharomyces pombe 972h- TIM22 inner membrane protein import complex subunit Tim22 NP_596362.1 3275859 D 284812 CDS SPBC25H2.03 19113155 2540489 complement(join(3276687..3277132,3277179..3277258,3277307..3277422,3277471..3277575,3277613..3279067,3279151..3279307,3279388..3279460,3279506..3279509)) 1 NC_003423.3 vacuolar protein involved in phosphoinositide metabolism 3279509 2540489 SPBC25H2.03 Schizosaccharomyces pombe 972h- vacuolar protein involved in phosphoinositide metabolism NP_596363.1 3276687 R 284812 CDS SPBC25H2.02 19113156 2540550 complement(3279950..3282061) 1 NC_003423.3 Has been mapped to YIL078W rather than YKL194C due to same domain combinations; cytoplasmic threonine-tRNA ligase Trs1 (predicted) 3282061 trs1 2540550 trs1 Schizosaccharomyces pombe 972h- cytoplasmic threonine-tRNA ligase Trs1 (predicted) NP_596364.1 3279950 R 284812 CDS SPBC20F10.01 19113157 2540705 join(3283373..3283466,3283537..3283637,3283694..3284083) 1 NC_003423.3 snoRNP pseudouridylase complex protein Gar1 3284083 gar1 2540705 gar1 Schizosaccharomyces pombe 972h- snoRNP pseudouridylase complex protein Gar1 NP_596365.1 3283373 D 284812 CDS SPBC20F10.02c 19113158 2540697 complement(3284618..3286420) 1 NC_003423.3 DUF1741 family protein 3286420 2540697 SPBC20F10.02c Schizosaccharomyces pombe 972h- DUF1741 family protein NP_596366.1 3284618 R 284812 CDS SPBC20F10.03 19113159 2540757 3287750..3289090 1 NC_003423.3 conserved eukaryotic protein 3289090 2540757 SPBC20F10.03 Schizosaccharomyces pombe 972h- conserved eukaryotic protein NP_596367.1 3287750 D 284812 CDS SPBC20F10.04c 68012524 3361330 complement(join(3289466..3289558,3289606..3289697,3289743..3289962,3290001..3290094,3290138..3290396,3290441..3290521,3290565..3290628)) 1 NC_003423.3 2 N-terminal exons replaced with better exons, C-terminal exon truncated and two extra C-terminal exons added according to EMBL entry AB158548; Hypomorphic allele causes DNA segregation defects and sensitivity to DNA damaging agents (pers comm M. Boddy); Smc5-6 complex non-SMC subunit Nse4 3290628 nse4 3361330 nse4 Schizosaccharomyces pombe 972h- Smc5-6 complex non-SMC subunit Nse4 NP_001018837.1 3289466 R 284812 CDS SPBC20F10.05 19113161 2540691 join(3291032..3292872,3292911..3293821,3293866..3294032) 1 NC_003423.3 DuF1740 family protein 3294032 2540691 SPBC20F10.05 Schizosaccharomyces pombe 972h- DuF1740 family protein NP_596369.1 3291032 D 284812 CDS SPBC20F10.06 19113162 2540589 join(3294275..3294344,3294386..3294532,3294579..3294973) 1 NC_003423.3 spindle checkpoint protein Mad2 3294973 mad2 2540589 mad2 Schizosaccharomyces pombe 972h- spindle checkpoint protein Mad2 NP_596370.1 3294275 D 284812 CDS SPBC20F10.07 19113163 2540703 3295995..3298289 1 NC_003423.3 GRAM domain protein 3298289 2540703 SPBC20F10.07 Schizosaccharomyces pombe 972h- GRAM domain protein NP_596371.1 3295995 D 284812 CDS SPBC20F10.08c 19113164 2540770 complement(3298583..3300826) 1 NC_003423.3 conserved eukaryotic protein 3300826 2540770 SPBC20F10.08c Schizosaccharomyces pombe 972h- conserved eukaryotic protein NP_596372.1 3298583 R 284812 CDS SPBC20F10.09 19113165 2540723 join(3301304..3301328,3301430..3301553,3301600..3301666,3301715..3301741) 1 NC_003423.3 U6 snRNP-associated protein Lsm5 3301741 lsm5 2540723 lsm5 Schizosaccharomyces pombe 972h- U6 snRNP-associated protein Lsm5 NP_596373.1 3301304 D 284812 CDS SPBC20F10.10 19113166 2540751 3303306..3304037 1 NC_003423.3 cyclin pho85 family 3304037 2540751 SPBC20F10.10 Schizosaccharomyces pombe 972h- cyclin pho85 family NP_596374.1 3303306 D 284812 CDS SPBC17D11.01 63054790 2539808 join(3304837..3304864,3304945..3304999,3305074..3306253) 1 NC_003423.3 NEDD8 protease Nep1 3306253 nep1 2539808 nep1 Schizosaccharomyces pombe 972h- NEDD8 protease Nep1 NP_596375.2 3304837 D 284812 CDS SPBC17D11.02c 19113168 2539900 complement(join(3306554..3308563,3308607..3308630)) 1 NC_003423.3 ubiquitin-protein ligase Hrd1 (predicted) 3308630 hrd1 2539900 hrd1 Schizosaccharomyces pombe 972h- ubiquitin-protein ligase Hrd1 (predicted) NP_596376.1 3306554 R 284812 CDS SPBC17D11.03c 19113169 2539635 complement(join(3309377..3309627,3309708..3309888,3309985..3310194)) 1 NC_003423.3 conserved fungal protein 3310194 2539635 SPBC17D11.03c Schizosaccharomyces pombe 972h- conserved fungal protein NP_596377.1 3309377 R 284812 CDS SPBC17D11.04c 19113170 2540077 complement(3310577..3312880) 1 NC_003423.3 histone acetyltransferase complex subunit Nto1 (predicted) 3312880 2540077 SPBC17D11.04c Schizosaccharomyces pombe 972h- histone acetyltransferase complex subunit Nto1 (predicted) NP_596378.1 3310577 R 284812 CDS SPBC17D11.05 19113171 2539938 join(3314338..3314376,3314422..3317181) 1 NC_003423.3 translation initiation factor eIF3a 3317181 tif32 2539938 tif32 Schizosaccharomyces pombe 972h- translation initiation factor eIF3a NP_596379.1 3314338 D 284812 CDS SPBC17D11.06 19113172 2539933 join(3317783..3317948,3318007..3318202,3318402..3318993,3319037..3319462) 1 NC_003423.3 DNA primase large subunit Spp2 3319462 spp2 2539933 spp2 Schizosaccharomyces pombe 972h- DNA primase large subunit Spp2 NP_596380.1 3317783 D 284812 CDS SPBC17D11.07c 19113173 2540191 complement(join(3319883..3322734,3322796..3322841)) 1 NC_003423.3 19S proteasome regulatory subunit Rpn2 (predicted) 3322841 rpn2 2540191 rpn2 Schizosaccharomyces pombe 972h- 19S proteasome regulatory subunit Rpn2 (predicted) NP_596381.1 3319883 R 284812 CDS SPBC17D11.08 19113174 2539614 join(3324029..3324271,3324387..3324620,3324661..3324902,3324967..3325524,3325569..3325599) 1 NC_003423.3 WD repeat protein, human WDR68 family 3325599 2539614 SPBC17D11.08 Schizosaccharomyces pombe 972h- WD repeat protein, human WDR68 family NP_596382.1 3324029 D 284812 CDS SPBC17D1.01 162312289 2539725 join(3326992..3327046,3327094..3327476,3327597..3328913) 1 NC_003423.3 transcriptional regulatory protein Spp41 3328913 2539725 SPBC17D1.01 Schizosaccharomyces pombe 972h- transcriptional regulatory protein Spp41 XP_001713144.1 3326992 D 284812 CDS SPBC17D1.02 19113176 2539788 join(3329819..3329977,3330050..3330240,3330289..3330967,3331014..3331496) 1 NC_003423.3 diphthamide biosynthesis protein (predicted) 3331496 2539788 SPBC17D1.02 Schizosaccharomyces pombe 972h- diphthamide biosynthesis protein (predicted) NP_596384.1 3329819 D 284812 CDS SPBC17D1.03c 19113177 2540189 complement(join(3331753..3332185,3332292..3332627,3332726..3332769)) 1 NC_003423.3 exosome subunit Rrp43 (predicted) 3332769 2540189 SPBC17D1.03c Schizosaccharomyces pombe 972h- exosome subunit Rrp43 (predicted) NP_596385.1 3331753 R 284812 CDS SPBC17D1.04 19113178 2539830 3333603..3334355 1 NC_003423.3 Accumulation of Condensin at RDNA (name_derivation); upstream activation factor complex subunit Acr1 3334355 acr1 2539830 acr1 Schizosaccharomyces pombe 972h- upstream activation factor complex subunit Acr1 NP_596386.1 3333603 D 284812 CDS SPBC17D1.05 19113179 2539841 3335110..3336216 1 NC_003423.3 sequence orphan 3336216 2539841 SPBC17D1.05 Schizosaccharomyces pombe 972h- sequence orphan NP_596387.1 3335110 D 284812 CDS SPBC17D1.06 19113180 2540213 3338604..3340340 1 NC_003423.3 N-terminal may need truncating; used to have code SPCC17D1.06 (typo); ATP-dependent RNA helicase Dbp3 (predicted) 3340340 dbp3 2540213 dbp3 Schizosaccharomyces pombe 972h- ATP-dependent RNA helicase Dbp3 (predicted) NP_596388.1 3338604 D 284812 CDS SPBC17D1.07c 19113181 2540178 complement(join(3340725..3340899,3340986..3341441,3341488..3341950,3341992..3342226,3342272..3343408,3343452..3343659,3343704..3343918)) 1 NC_003423.3 GTPase regulator (predicted) 3343918 2540178 SPBC17D1.07c Schizosaccharomyces pombe 972h- GTPase regulator (predicted) NP_596389.1 3340725 R 284812 CDS SPBC11C11.01 19113182 2539748 join(3344613..3344676,3344730..3344788,3344833..3345531,3345579..3345757,3345808..3346288) 1 NC_003423.3 first two predicted exons are tentative - may use internall Met at base position. 18530; RNA-binding protein 3346288 2539748 SPBC11C11.01 Schizosaccharomyces pombe 972h- RNA-binding protein NP_596390.1 3344613 D 284812 CDS SPBC11C11.02 19113183 2540112 join(3347981..3348049,3348144..3348235,3348301..3349973,3350022..3350200) 1 NC_003423.3 contractile ring protein Imp2 3350200 imp2 2540112 imp2 Schizosaccharomyces pombe 972h- contractile ring protein Imp2 NP_596391.1 3347981 D 284812 CDS SPBC11C11.03 19113184 2540097 join(3350848..3350875,3350925..3351108,3351152..3352814) 1 NC_003423.3 spindle pole body protein Ndc80 3352814 ndc80 2540097 ndc80 Schizosaccharomyces pombe 972h- spindle pole body protein Ndc80 NP_596392.1 3350848 D 284812 CDS SPBC11C11.04c 19113185 2539669 complement(join(3353145..3353508,3353551..3353768,3353815..3353950,3353993..3354375,3354415..3355401,3355446..3356534,3356579..3356725)) 1 NC_003423.3 tubulin specific chaperone cofactor D, Alp1 3356725 alp1 2539669 alp1 Schizosaccharomyces pombe 972h- tubulin specific chaperone cofactor D, Alp1 NP_596393.1 3353145 R 284812 CDS SPBC11C11.05 19113186 2539867 3357779..3358633 1 NC_003423.3 KRE9 family cell wall biosynthesis protein (predicted) 3358633 2539867 SPBC11C11.05 Schizosaccharomyces pombe 972h- KRE9 family cell wall biosynthesis protein (predicted) NP_596394.1 3357779 D 284812 CDS SPBC11C11.06c 19113187 2539978 complement(3359360..3359896) 1 NC_003423.3 sequence orphan 3359896 2539978 SPBC11C11.06c Schizosaccharomyces pombe 972h- sequence orphan NP_596395.1 3359360 R 284812 CDS SPBC11C11.07 19113189 2539678 join(3361817..3361819,3361872..3362432) 1 NC_003423.3 60S ribosomal protein L18 3362432 rpl1801 2539678 rpl1801 Schizosaccharomyces pombe 972h- 60S ribosomal protein L18 NP_596397.1 3361817 D 284812 CDS SPBC11C11.08 19113190 2539818 join(3362884..3362969,3363016..3363072,3363122..3363806) 1 NC_003423.3 SR family protein Srp1 3363806 srp1 2539818 srp1 Schizosaccharomyces pombe 972h- SR family protein Srp1 NP_596398.1 3362884 D 284812 CDS SPBC11C11.09c 19113191 2539680 complement(3364746..3365630) 1 NC_003423.3 60S ribosomal protein L5 3365630 rpl502 2539680 rpl502 Schizosaccharomyces pombe 972h- 60S ribosomal protein L5 NP_596399.1 3364746 R 284812 CDS SPBC11C11.10 19113192 2540023 join(3365690..3365894,3365998..3367016) 1 NC_003423.3 tRNA pseudouridine synthase 3367016 2540023 SPBC11C11.10 Schizosaccharomyces pombe 972h- tRNA pseudouridine synthase NP_596400.1 3365690 D 284812 CDS SPBC11C11.11c 162312291 2539613 complement(join(3367171..3368204,3368246..3368397,3368446..3368475,3368515..3368807,3368865..3368996,3369041..3369220)) 1 NC_003423.3 mitochondrial ATP-dependent DNA helicase Irc3 (predicted) 3369220 2539613 SPBC11C11.11c Schizosaccharomyces pombe 972h- mitochondrial ATP-dependent DNA helicase Irc3 (predicted) XP_001713145.1 3367171 R 284812 CDS SPBC3B8.11 19113195 2540951 complement(3369578..3372184) 1 NC_003423.3 ortholog for S. cerevisiae RRN6, alignment will be in next Pfam release; RNA polymerase I transcription factor subunit Rrn6 (predicted) 3372184 rrn6 2540951 rrn6 Schizosaccharomyces pombe 972h- RNA polymerase I transcription factor subunit Rrn6 (predicted) NP_596403.1 3369578 R 284812 CDS SPBC3B8.10c 19113196 2541021 3373465..3374895 1 NC_003423.3 NLI interacting factor family phiosphatase (predicted) 3374895 2541021 SPBC3B8.10c Schizosaccharomyces pombe 972h- NLI interacting factor family phiosphatase (predicted) NP_596404.1 3373465 D 284812 CDS SPBC3B8.09 19113197 2541000 complement(3375561..3377354) 1 NC_003423.3 U3 snoRNP-associated protein Utp3 (predicted) 3377354 2541000 SPBC3B8.09 Schizosaccharomyces pombe 972h- U3 snoRNP-associated protein Utp3 (predicted) NP_596405.1 3375561 R 284812 CDS SPBC3B8.08 19113198 2541054 complement(join(3377815..3378183,3378347..3378439)) 1 NC_003423.3 Sjogren's syndrome/scleroderma autoantigen 1 family 3378439 2541054 SPBC3B8.08 Schizosaccharomyces pombe 972h- Sjogren's syndrome/scleroderma autoantigen 1 family NP_596406.1 3377815 R 284812 CDS SPBC3B8.07c 19113199 2541019 3381862..3382950 1 NC_003423.3 dihydroceramide delta-4 desaturase 3382950 dsd1 2541019 dsd1 Schizosaccharomyces pombe 972h- dihydroceramide delta-4 desaturase NP_596407.1 3381862 D 284812 CDS SPBC3B8.06 19113200 2540266 complement(3383479..3385014) 1 NC_003423.3 overlaps two S.cerevisiae hypotheticals - putative mis-prediction in S. cer ChrIII region), similar (at N-term) eg. to YCR061W, similar (at C-term) eg. to YCR062W; conserved fungal protein 3385014 2540266 SPBC3B8.06 Schizosaccharomyces pombe 972h- conserved fungal protein NP_596408.1 3383479 R 284812 CDS SPBC3B8.05 19113201 2540295 complement(join(3385919..3387025,3387114..3387317)) 1 NC_003423.3 diphthamide biosynthesis protein (predicted) 3387317 2540295 SPBC3B8.05 Schizosaccharomyces pombe 972h- diphthamide biosynthesis protein (predicted) NP_596409.1 3385919 R 284812 CDS SPBC3B8.04c 19113202 2540279 join(3387700..3387716,3387763..3387807,3387863..3387883,3388032..3390552) 1 NC_003423.3 membrane transporter 3390552 2540279 SPBC3B8.04c Schizosaccharomyces pombe 972h- membrane transporter NP_596410.1 3387700 D 284812 CDS SPBC3B8.03 19113203 2540908 complement(3391817..3393169) 1 NC_003423.3 saccharopine dehydrogenase (predicted) 3393169 2540908 SPBC3B8.03 Schizosaccharomyces pombe 972h- saccharopine dehydrogenase (predicted) NP_596411.1 3391817 R 284812 CDS SPBC3B8.02 19113204 2540133 complement(join(3394350..3395222,3395281..3395310,3395356..3395700)) 1 NC_003423.3 CCAAT-binding factor complex subunit Php5 3395700 php5 2540133 php5 Schizosaccharomyces pombe 972h- CCAAT-binding factor complex subunit Php5 NP_596412.1 3394350 R 284812 CDS SPBC3B8.01c 19113205 2541049 join(3397628..3397834,3397917..3399119) 1 NC_003423.3 NADPH-adrenodoxin reductase Arh1 3399119 arh1 2541049 arh1 Schizosaccharomyces pombe 972h- NADPH-adrenodoxin reductase Arh1 NP_596413.1 3397628 D 284812 CDS SPBC13A2.01c 19113206 2539791 complement(join(3399336..3399466,3399548..3399755,3399864..3400073)) 1 NC_003423.3 nuclear cap-binding complex small subunit 3400073 2539791 SPBC13A2.01c Schizosaccharomyces pombe 972h- nuclear cap-binding complex small subunit NP_596414.1 3399336 R 284812 CDS SPBC13A2.02 19113207 2539697 3400603..3403014 1 NC_003423.3 nucleoporin Nup82 3403014 2539697 SPBC13A2.02 Schizosaccharomyces pombe 972h- nucleoporin Nup82 NP_596415.1 3400603 D 284812 CDS SPBC13A2.03 19113208 2540017 join(3403603..3403940,3404124..3404263,3404309..3405150) 1 NC_003423.3 phosphatidate cytidylyltransferase 3405150 2540017 SPBC13A2.03 Schizosaccharomyces pombe 972h- phosphatidate cytidylyltransferase NP_596416.1 3403603 D 284812 CDS SPBC13A2.04c 19113209 2540201 complement(3405836..3407692) 1 NC_003423.3 PTR family peptide transporter 3407692 2540201 SPBC13A2.04c Schizosaccharomyces pombe 972h- PTR family peptide transporter NP_596417.1 3405836 R 284812 CDS SPBC4B4.01c 19113210 2540815 complement(join(3411376..3412392,3412465..3412553,3412607..3412712)) 1 NC_003423.3 fumble family pantothenate kinase (predicted) 3412712 2540815 SPBC4B4.01c Schizosaccharomyces pombe 972h- fumble family pantothenate kinase (predicted) NP_596418.1 3411376 R 284812 CDS SPBC4B4.02c 19113211 2540670 complement(3413338..3415059) 1 NC_003423.3 mitochondrial protein Nca2 (predicted) 3415059 nca2 2540670 nca2 Schizosaccharomyces pombe 972h- mitochondrial protein Nca2 (predicted) NP_596419.1 3413338 R 284812 CDS SPBC4B4.03 19113212 2540749 join(3416021..3416046,3416086..3416154,3416219..3418535) 1 NC_003423.3 RSC complex subunit Rsc1 3418535 rsc1 2540749 rsc1 Schizosaccharomyces pombe 972h- RSC complex subunit Rsc1 NP_596420.1 3416021 D 284812 CDS SPBC4B4.04 19113213 2540999 join(3418888..3418912,3418951..3420656) 1 NC_003423.3 translation initiation factor eIF2A (predicted) 3420656 2540999 SPBC4B4.04 Schizosaccharomyces pombe 972h- translation initiation factor eIF2A (predicted) NP_596421.1 3418888 D 284812 CDS SPBC4B4.05 19113214 2540855 join(3421337..3421369,3421417..3421488,3421534..3421641,3421681..3421701) 1 NC_003423.3 Sm snRNP core protein Smg1 3421701 smg1 2540855 smg1 Schizosaccharomyces pombe 972h- Sm snRNP core protein Smg1 NP_596422.1 3421337 D 284812 CDS SPBC4B4.06 19113215 2540828 join(3422568..3422757,3422813..3422961,3423006..3423194) 1 NC_003423.3 ESCRT II complex subunit Vps25 3423194 vps25 2540828 vps25 Schizosaccharomyces pombe 972h- ESCRT II complex subunit Vps25 NP_596423.1 3422568 D 284812 CDS SPBC4B4.07c 19113216 2540865 complement(join(3423372..3423730,3423788..3424057,3424111..3424231)) 1 NC_003423.3 U1 snRNP-associated protein Usp102 3424231 usp102 2540865 usp102 Schizosaccharomyces pombe 972h- U1 snRNP-associated protein Usp102 NP_596424.1 3423372 R 284812 CDS SPBC4B4.08 19113217 2539977 3427572..3429167 1 NC_003423.3 hexose transporter Ght2 3429167 ght2 2539977 ght2 Schizosaccharomyces pombe 972h- hexose transporter Ght2 NP_596425.1 3427572 D 284812 CDS SPBC4B4.09 19113218 2540869 join(3429801..3429892,3429940..3430126,3430177..3430280,3430326..3430493,3430581..3431176,3431214..3431501,3431571..3431974) 1 NC_003423.3 U1 snRNP-associated protein Usp105 3431974 usp105 2540869 usp105 Schizosaccharomyces pombe 972h- U1 snRNP-associated protein Usp105 NP_596426.1 3429801 D 284812 CDS SPBC4B4.10c 19113219 2540814 complement(join(3432202..3432594,3432666..3432840,3432887..3433005,3433092..3433190)) 1 NC_003423.3 autophagy associated protein Atg5 (predicted) 3433190 mug77 2540814 mug77 Schizosaccharomyces pombe 972h- autophagy associated protein Atg5 (predicted) NP_596427.1 3432202 R 284812 CDS SPBC4B4.11 19113220 2540876 join(3433726..3433819,3433870..3434117) 1 NC_003423.3 conserved fungal protein 3434117 2540876 SPBC4B4.11 Schizosaccharomyces pombe 972h- conserved fungal protein NP_596428.1 3433726 D 284812 CDS SPBC4B4.12c 19113221 2540854 complement(3434228..3434560) 1 NC_003423.3 previously annotated as dubious, but has localization signal; sequence orphan 3434560 2540854 SPBC4B4.12c Schizosaccharomyces pombe 972h- sequence orphan NP_596429.1 3434228 R 284812 CDS SPBC2G2.01c 19113222 2540342 complement(3434828..3436372) 1 NC_003423.3 involved in cell division when ribonucleotide reductase is inhibited (PMID 9950674); pantothenate transporter 3436372 liz1 2540342 liz1 Schizosaccharomyces pombe 972h- pantothenate transporter NP_596430.1 3434828 R 284812 CDS SPBC2G2.02 19113223 2540270 3437553..3440783 1 NC_003423.3 inositol-polyphosphate 5-phosphatase (synaptojanin homolog 1) 3440783 syj1 2540270 syj1 Schizosaccharomyces pombe 972h- inositol-polyphosphate 5-phosphatase (synaptojanin homolog 1) NP_596431.1 3437553 D 284812 CDS SPBC2G2.03c 19113224 2540282 complement(join(3441122..3441221,3441272..3441403,3441468..3441529,3441580..3441594)) 1 NC_003423.3 translocon beta subunit Sbh1 3441594 sbh1 2540282 sbh1 Schizosaccharomyces pombe 972h- translocon beta subunit Sbh1 NP_596432.1 3441122 R 284812 CDS SPBC2G2.04c 19113225 2540461 complement(3442191..3442679) 1 NC_003423.3 sequence possibly needs truncating to second met; YjgF family protein Mmf1 3442679 mmf1 2540461 mmf1 Schizosaccharomyces pombe 972h- YjgF family protein Mmf1 NP_596433.1 3442191 R 284812 CDS SPBC2G2.05 19113226 2540373 join(3443267..3443307,3443366..3443918) 1 NC_003423.3 60S ribosomal protein L13/L16 3443918 rpl1603 2540373 rpl1603 Schizosaccharomyces pombe 972h- 60S ribosomal protein L13/L16 NP_596434.1 3443267 D 284812 CDS SPBC2G2.06c 19113227 2540375 complement(join(3444075..3445461,3445506..3445624,3445669..3445914,3445968..3446013,3446051..3446259,3446306..3446332)) 1 NC_003423.3 AP-2 adaptor complex subunit Apl1 (predicted) 3446332 apl1 2540375 apl1 Schizosaccharomyces pombe 972h- AP-2 adaptor complex subunit Apl1 (predicted) NP_596435.1 3444075 R 284812 CDS SPBC2G2.07c 19113228 2540467 complement(3447213..3447890) 1 NC_003423.3 mitochondrial ribosomal protein subunit L51-b 3447890 mug178 2540467 mug178 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit L51-b NP_596436.1 3447213 R 284812 CDS SPBC2G2.08 19113229 2540300 join(3448976..3449103,3449371..3452152) 1 NC_003423.3 C-1- tetrahydrofolatesynthase/methylenetetrahydrof olatedehydrogenase/methylenetetrahydrofolatecyclohydrolase / formyltetrahydrofolatesynthetase 3452152 ade9 2540300 ade9 Schizosaccharomyces pombe 972h- C-1- tetrahydrofolatesynthase/methylenetetrahydrof olatedehydrogenase/methylenetetrahydrofolatecyclohydrolase / formyltetrahydrofolatesynthetase NP_596437.1 3448976 D 284812 CDS SPBC2G2.09c 295442880 2540450 complement(join(3452323..3452540,3452589..3452769,3452922..3453077,3453119..3453406)) 1 NC_003423.3 meiosis specific cyclin Crs1 3453406 crs1 2540450 crs1 Schizosaccharomyces pombe 972h- meiosis specific cyclin Crs1 NP_596438.2 3452323 R 284812 CDS SPBC2G2.10c 19113231 2540351 complement(join(3453746..3454417,3454461..3454535)) 1 NC_003423.3 sequence orphan 3454535 mug110 2540351 mug110 Schizosaccharomyces pombe 972h- sequence orphan NP_596439.1 3453746 R 284812 CDS SPBC2G2.11 19113232 2540407 join(3455224..3455410,3455481..3455605,3455669..3456559,3456603..3456800) 1 NC_003423.3 N-myristoyltransferase 1 3456800 2540407 SPBC2G2.11 Schizosaccharomyces pombe 972h- N-myristoyltransferase 1 NP_596440.1 3455224 D 284812 CDS SPBC2G2.12 19113233 2540472 3457240..3458856 1 NC_003423.3 mitochondrial and cytoplasmic histidine-tRNA ligase Hrs1 3458856 hrs1 2540472 hrs1 Schizosaccharomyces pombe 972h- mitochondrial and cytoplasmic histidine-tRNA ligase Hrs1 NP_596441.1 3457240 D 284812 CDS SPBC2G2.13c 19113234 2540338 complement(join(3458998..3459104,3459142..3459194,3459234..3459722,3459837..3460234)) 1 NC_003423.3 deoxycytidylate deaminase (predicted) 3460234 2540338 SPBC2G2.13c Schizosaccharomyces pombe 972h- deoxycytidylate deaminase (predicted) NP_596442.1 3458998 R 284812 CDS SPBC2G2.14 19113235 2540281 3461440..3463041 1 NC_003423.3 sequence orphan 3463041 2540281 SPBC2G2.14 Schizosaccharomyces pombe 972h- sequence orphan NP_596443.1 3461440 D 284812 CDS SPBC2G2.15c 19113236 2540444 complement(join(3463215..3463421,3463462..3463510,3463557..3463792,3463834..3463884,3463934..3464047)) 1 NC_003423.3 mitochondrial 2' O-ribose methyltransferase Mrm2 (predicted) 3464047 mrm2 2540444 mrm2 Schizosaccharomyces pombe 972h- mitochondrial 2' O-ribose methyltransferase Mrm2 (predicted) NP_596444.1 3463215 R 284812 CDS SPBC2G2.16 19113237 2540428 join(3464865..3464990,3465040..3466152) 1 NC_003423.3 mannose-6-phosphate isomerase (predicted) 3466152 2540428 SPBC2G2.16 Schizosaccharomyces pombe 972h- mannose-6-phosphate isomerase (predicted) NP_596445.1 3464865 D 284812 CDS SPBC2G2.17c 19113238 2540451 complement(3466570..3467529) 1 NC_003423.3 beta-glucosidase Psu2 (predicted) 3467529 2540451 SPBC2G2.17c Schizosaccharomyces pombe 972h- beta-glucosidase Psu2 (predicted) NP_596446.1 3466570 R 284812 CDS SPBC1718.01 162312293 2540511 3469343..3471670 1 NC_003423.3 F-box/WD repeat protein Pop1 3471670 pop1 2540511 pop1 Schizosaccharomyces pombe 972h- F-box/WD repeat protein Pop1 XP_001713146.1 3469343 D 284812 CDS SPBC1718.02 19113240 2540064 join(3472319..3472413,3472462..3472609,3472654..3472822,3472861..3473101,3473142..3473532,3473580..3473805,3473853..3474169) 1 NC_003423.3 splicing at 3rd exon possibly incorrect; linear element associated protein Hop1 3474169 hop1 2540064 hop1 Schizosaccharomyces pombe 972h- linear element associated protein Hop1 NP_596448.1 3472319 D 284812 CDS SPBC1718.03 19113241 2539675 3474729..3475172 1 NC_003423.3 lysine (K) and glutamic acid (E) Rich protein; DNA-directed RNA polymerase I complex subunit Ker1 3475172 ker1 2539675 ker1 Schizosaccharomyces pombe 972h- DNA-directed RNA polymerase I complex subunit Ker1 NP_596449.1 3474729 D 284812 CDS SPBC1718.04 19113242 2540110 join(3475916..3475961,3476014..3477995) 1 NC_003423.3 glycerol-3-phosphate O-acyltransferase (predicted) 3477995 2540110 SPBC1718.04 Schizosaccharomyces pombe 972h- glycerol-3-phosphate O-acyltransferase (predicted) NP_596450.1 3475916 D 284812 CDS SPBC1718.05 19113243 2540014 join(3478572..3478780,3478825..3479009,3479110..3479234,3479442..3479552) 1 NC_003423.3 TRAPP complex subunit Trs31 (predicted) 3479552 trs31 2540014 trs31 Schizosaccharomyces pombe 972h- TRAPP complex subunit Trs31 (predicted) NP_596451.1 3478572 D 284812 CDS SPBC1718.06 19113244 2539844 3479898..3482609 1 NC_003423.3 mitochondrial GTPase Msp1 3482609 msp1 2539844 msp1 Schizosaccharomyces pombe 972h- mitochondrial GTPase Msp1 NP_596452.1 3479898 D 284812 CDS SPBC1718.07c 19113245 2539958 complement(3483454..3484668) 1 NC_003423.3 Multicopy suppressor of Overexpressed Cyr1; CCCH tandem zinc finger protein, human Tristetraprolin homolog Zfs1 3484668 zfs1 2539958 zfs1 Schizosaccharomyces pombe 972h- CCCH tandem zinc finger protein, human Tristetraprolin homolog Zfs1 NP_596453.1 3483454 R 284812 CDS SPBPB7E8.01 19113246 2541357 3494517..3496226 1 NC_003423.3 NOTE: zinc metallopeptidase is tanetative, below threshold; sequence orphan 3496226 2541357 SPBPB7E8.01 Schizosaccharomyces pombe 972h- sequence orphan NP_596454.1 3494517 D 284812 CDS SPBPB7E8.02 19113247 2541354 3499132..3501381 1 NC_003423.3 S. cerevisiae PSP1 suppresses temperature sensitive mutations in DNA polymerase alpha; PSP1 family protein 3501381 2541354 SPBPB7E8.02 Schizosaccharomyces pombe 972h- PSP1 family protein NP_596455.1 3499132 D 284812 CDS SPBC1105.01 162312295 3361337 join(3502416..3504888,3504931..3505395,3505438..3505505) 1 NC_003423.3 rRNA processing protein Rrp12-like 3505505 rrp12 3361337 rrp12 Schizosaccharomyces pombe 972h- rRNA processing protein Rrp12-like NP_596456.2 3502416 D 284812 CDS SPBC1105.02c 19113250 2539815 complement(3506051..3507307) 1 NC_003423.3 homocitrate synthase (predicted) 3507307 lys4 2539815 lys4 Schizosaccharomyces pombe 972h- homocitrate synthase (predicted) NP_596458.1 3506051 R 284812 CDS SPBC1105.03c 19113251 2539752 complement(3508286..3508933) 1 NC_003423.3 mitochondrial ribosomal protein subunit L16 3508933 mrpl16 2539752 mrpl16 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit L16 NP_596459.1 3508286 R 284812 CDS SPBC1105.04c 19113252 2539971 complement(3510771..3512339) 1 NC_003423.3 CENP-B homolog 3512339 cbp1 2539971 cbp1 Schizosaccharomyces pombe 972h- CENP-B homolog NP_596460.1 3510771 R 284812 CDS SPBC1105.05 19113253 2539993 3515138..3516361 1 NC_003423.3 glucan 1,3-beta-glucosidase I/II precursor 3516361 exg1 2539993 exg1 Schizosaccharomyces pombe 972h- glucan 1,3-beta-glucosidase I/II precursor NP_596461.1 3515138 D 284812 CDS SPBC1105.06 19113254 2539994 3517489..3518208 1 NC_003423.3 mediator complex subunit Pmc4 3518208 pmc4 2539994 pmc4 Schizosaccharomyces pombe 972h- mediator complex subunit Pmc4 NP_596462.1 3517489 D 284812 CDS SPBC1105.07c 19113255 2540003 complement(join(3518466..3518754,3518797..3519048,3519104..3519601,3519649..3519806,3519873..3520004)) 1 NC_003423.3 nuclear pore associated protein Thp1-Sac3 complex subunit (predicted) 3520004 2540003 SPBC1105.07c Schizosaccharomyces pombe 972h- nuclear pore associated protein Thp1-Sac3 complex subunit (predicted) NP_596463.1 3518466 R 284812 CDS SPBC1105.08 19113256 2540158 join(3520361..3520559,3520708..3522398) 1 NC_003423.3 EMP70 family 3522398 2540158 SPBC1105.08 Schizosaccharomyces pombe 972h- EMP70 family NP_596464.1 3520361 D 284812 CDS SPBC1105.09 19113257 2539995 join(3522875..3522919,3523002..3523145,3523224..3523253,3523330..3523555,3523626..3523684) 1 NC_003423.3 Note ubc15 is truncated with respect to YDR054C; ubiquitin conjugating enzyme Ubc15 3523684 ubc15 2539995 ubc15 Schizosaccharomyces pombe 972h- ubiquitin conjugating enzyme Ubc15 NP_596465.1 3522875 D 284812 CDS SPBC1105.10 19113258 2539705 join(3524673..3524759,3524875..3528681) 1 NC_003423.3 RAVE complex subunit Rav1 3528681 rav1 2539705 rav1 Schizosaccharomyces pombe 972h- RAVE complex subunit Rav1 NP_596466.1 3524673 D 284812 CDS SPBC1105.11c 19113259 2539804 complement(3529119..3529529) 1 NC_003423.3 histone H3 h3.3 3529529 hht3 2539804 hht3 Schizosaccharomyces pombe 972h- histone H3 h3.3 NP_596467.1 3529119 R 284812 CDS SPBC1105.12 19113260 2539991 3529767..3530078 1 NC_003423.3 histone H4 h4.3 3530078 hhf3 2539991 hhf3 Schizosaccharomyces pombe 972h- histone H4 h4.3 NP_596468.1 3529767 D 284812 CDS SPBC1105.13c 19113261 2539605 complement(3531760..3532188) 1 NC_003423.3 has transcript profile on microarray; sequence orphan 3532188 2539605 SPBC1105.13c Schizosaccharomyces pombe 972h- sequence orphan NP_596469.1 3531760 R 284812 CDS SPBC1105.14 19113262 2539604 3532931..3534844 1 NC_003423.3 transcription factor Rsv2 3534844 rsv2 2539604 rsv2 Schizosaccharomyces pombe 972h- transcription factor Rsv2 NP_596470.1 3532931 D 284812 CDS SPBC1105.15c 19113263 2539744 complement(3535403..3536305) 1 NC_003423.3 3-hydroxyacyl-ACP dehydratase Htd2 (predicted) 3536305 htd2 2539744 htd2 Schizosaccharomyces pombe 972h- 3-hydroxyacyl-ACP dehydratase Htd2 (predicted) NP_596471.1 3535403 R 284812 CDS SPBC1105.16c 19113264 2539745 complement(3537560..3537883) 1 NC_003423.3 RNase P subunit Rpr2 (predicted) 3537883 rpr2 2539745 rpr2 Schizosaccharomyces pombe 972h- RNase P subunit Rpr2 (predicted) NP_596472.1 3537560 R 284812 CDS SPBC1105.17 19113265 2539658 3538601..3538963 1 NC_003423.3 centromere-specific histone H3 CENP-A 3538963 cnp1 2539658 cnp1 Schizosaccharomyces pombe 972h- centromere-specific histone H3 CENP-A NP_596473.1 3538601 D 284812 CDS SPBC1105.18c 162312297 2539814 complement(3539204..3539692) 1 NC_003423.3 peptide release factor 3539692 2539814 SPBC1105.18c Schizosaccharomyces pombe 972h- peptide release factor NP_596474.2 3539204 R 284812 CDS SPBC887.01 19113267 2541231 3540222..3540758 1 NC_003423.3 acireductone dioxygenase family 3540758 2541231 SPBC887.01 Schizosaccharomyces pombe 972h- acireductone dioxygenase family NP_596475.1 3540222 D 284812 CDS SPBC887.02 19113268 2541132 join(3541262..3541391,3541503..3543376) 1 NC_003423.3 ClC chloride channel 3543376 2541132 SPBC887.02 Schizosaccharomyces pombe 972h- ClC chloride channel NP_596476.1 3541262 D 284812 CDS SPBC887.03c 19113269 2541230 complement(join(3543670..3545802,3545848..3545958)) 1 NC_003423.3 Noc2p-Noc3p complex subunit Noc3 (predicted) 3545958 noc3 2541230 noc3 Schizosaccharomyces pombe 972h- Noc2p-Noc3p complex subunit Noc3 (predicted) NP_596477.1 3543670 R 284812 CDS SPBC887.04c 19113270 2541208 complement(join(3546238..3548159,3548220..3548391,3548458..3548505)) 1 NC_003423.3 NASA from PMID: 16705165 not yet annotated at SGD; WD repeat protein Lub1 3548505 lub1 2541208 lub1 Schizosaccharomyces pombe 972h- WD repeat protein Lub1 NP_596478.1 3546238 R 284812 CDS SPBC887.05c 19113271 2541212 complement(join(3549138..3549786,3549877..3549881)) 1 NC_003423.3 RNA-binding protein Cwf29 3549881 cwf29 2541212 cwf29 Schizosaccharomyces pombe 972h- RNA-binding protein Cwf29 NP_596479.1 3549138 R 284812 CDS SPBC887.06c 19113272 2541210 complement(join(3550020..3550104,3550185..3550381,3550437..3550502,3550552..3550635)) 1 NC_003423.3 sorting nexin Snx3 3550635 snx3 2541210 snx3 Schizosaccharomyces pombe 972h- sorting nexin Snx3 NP_596480.1 3550020 R 284812 CDS SPBC887.07 19113273 2541232 join(3551348..3551389,3551433..3551490,3551554..3551834) 1 NC_003423.3 mitochondrial ribosomal protein subunit L38 3551834 mrpl38 2541232 mrpl38 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit L38 NP_596481.1 3551348 D 284812 CDS SPBC887.08 19113274 2541222 join(3552118..3552243,3552302..3552550) 1 NC_003423.3 sequence orphan 3552550 2541222 SPBC887.08 Schizosaccharomyces pombe 972h- sequence orphan NP_596482.1 3552118 D 284812 CDS SPBC887.09c 19113275 2541171 complement(3552822..3555482) 1 NC_003423.3 leucine-rich repeat protein Sog2 (predicted) 3555482 2541171 SPBC887.09c Schizosaccharomyces pombe 972h- leucine-rich repeat protein Sog2 (predicted) NP_596483.1 3552822 R 284812 CDS SPBC887.10 19113276 2541209 3557274..3558842 1 NC_003423.3 response regulator Mcs4 3558842 mcs4 2541209 mcs4 Schizosaccharomyces pombe 972h- response regulator Mcs4 NP_596484.1 3557274 D 284812 CDS SPBC887.11 19113277 2541236 join(3559396..3560684,3560722..3560788) 1 NC_003423.3 tRNA pseudouridine synthase Pus2 (predicted) 3560788 pus2 2541236 pus2 Schizosaccharomyces pombe 972h- tRNA pseudouridine synthase Pus2 (predicted) NP_596485.1 3559396 D 284812 CDS SPBC887.12 19113278 2541239 3561887..3565663 1 NC_003423.3 P-type ATPase 3565663 2541239 SPBC887.12 Schizosaccharomyces pombe 972h- P-type ATPase NP_596486.1 3561887 D 284812 CDS SPBC887.13c 19113279 2541226 complement(join(3565824..3565994,3566041..3566829,3566867..3567187)) 1 NC_003423.3 3-oxoacyl-[acyl-carrier-protein]-synthase (condensing enzyme) 3567187 2541226 SPBC887.13c Schizosaccharomyces pombe 972h- 3-oxoacyl-[acyl-carrier-protein]-synthase (condensing enzyme) NP_596487.1 3565824 R 284812 CDS SPBC887.14c 19113280 2541213 complement(join(3567730..3568892,3568934..3570188)) 1 NC_003423.3 pif1 helicase homolog Pfh1 3570188 pfh1 2541213 pfh1 Schizosaccharomyces pombe 972h- pif1 helicase homolog Pfh1 NP_596488.1 3567730 R 284812 CDS SPBC887.15c 19113281 2541225 complement(3571380..3572261) 1 NC_003423.3 sphingosine hydroxylase (predicted) 3572261 2541225 SPBC887.15c Schizosaccharomyces pombe 972h- sphingosine hydroxylase (predicted) NP_596489.1 3571380 R 284812 CDS SPBC887.16 19113282 2541215 3574921..3575250 1 NC_003423.3 dubious 3575250 2541215 SPBC887.16 Schizosaccharomyces pombe 972h- dubious NP_596490.1 3574921 D 284812 CDS SPBC887.17 19113283 2541241 3576032..3577909 1 NC_003423.3 uracil permease (predicted) 3577909 2541241 SPBC887.17 Schizosaccharomyces pombe 972h- uracil permease (predicted) NP_596491.1 3576032 D 284812 CDS SPBC887.18c 19113284 2541202 complement(join(3578225..3578700,3578819..3578918,3578970..3579196,3579239..3579455)) 1 NC_003423.3 SAGA complex subunit Hfi1 (predicted) 3579455 hfi1 2541202 hfi1 Schizosaccharomyces pombe 972h- SAGA complex subunit Hfi1 (predicted) NP_596492.1 3578225 R 284812 CDS SPBC887.19 19113285 2541221 3580335..3581918 1 NC_003423.3 Man5GlcNac2-PP-Dol translocation protein Rft1 3581918 rft1 2541221 rft1 Schizosaccharomyces pombe 972h- Man5GlcNac2-PP-Dol translocation protein Rft1 NP_596493.1 3580335 D 284812 CDS SPBC418.01c 63054793 2541224 complement(join(3582095..3583600,3583707..3583826)) 1 NC_003423.3 imidazoleglycerol-phosphate synthase 3583826 his4 2541224 his4 Schizosaccharomyces pombe 972h- imidazoleglycerol-phosphate synthase NP_596494.2 3582095 R 284812 CDS SPBC418.02 19113287 2540808 3585259..3587346 1 NC_003423.3 NatA N-acetyltransferase complex subunit (predicted) 3587346 2540808 SPBC418.02 Schizosaccharomyces pombe 972h- NatA N-acetyltransferase complex subunit (predicted) NP_596495.1 3585259 D 284812 CDS SPBC16D10.01c 162312299 2539899 complement(3587478..3588488) 1 NC_003423.3 transcriptional coregulation predicts a role in ribosome biogenesis for S. cerevisiae ortholog, which is supported by nueceolar localization, however S. cerevisie interaction data indicates a connection to glycolysis; conserved fungal protein 3588488 2539899 SPBC16D10.01c Schizosaccharomyces pombe 972h- conserved fungal protein NP_596496.2 3587478 R 284812 CDS SPBC16D10.02 295442882 2540011 join(3588806..3589595,3589639..3589803,3589845..3590123,3590163..3590278,3590327..3590386) 1 NC_003423.3 tRNA (guanine-N2-)-methyltransferase catalytic subunit Trm11 3590386 trm11 2540011 trm11 Schizosaccharomyces pombe 972h- tRNA (guanine-N2-)-methyltransferase catalytic subunit Trm11 NP_596497.2 3588806 D 284812 CDS SPBC16D10.03 19113290 2540141 join(3591166..3591746,3591787..3592246) 1 NC_003423.3 pombe glycoprotease 2 (PMID 11115118); metallopeptidase Pgp2 3592246 pgp2 2540141 pgp2 Schizosaccharomyces pombe 972h- metallopeptidase Pgp2 NP_596498.1 3591166 D 284812 CDS SPBC16D10.04c 19113291 2540148 complement(join(3592359..3592685,3592733..3593447,3593496..3596292,3596335..3596692)) 1 NC_003423.3 DNA replication endonuclease-helicase Dna2 3596692 dna2 2540148 dna2 Schizosaccharomyces pombe 972h- DNA replication endonuclease-helicase Dna2 NP_596499.1 3592359 R 284812 CDS SPBC16D10.05 19113292 2540007 join(3597571..3597927,3597968..3604687) 1 NC_003423.3 alpha-1,3-glucan synthase Mok13 3604687 mok13 2540007 mok13 Schizosaccharomyces pombe 972h- alpha-1,3-glucan synthase Mok13 NP_596500.1 3597571 D 284812 CDS SPBC16D10.06 19113293 2539655 3607890..3609116 1 NC_003423.3 ZIP zinc transporter Zrt1 3609116 zrt1 2539655 zrt1 Schizosaccharomyces pombe 972h- ZIP zinc transporter Zrt1 NP_596501.1 3607890 D 284812 CDS SPBC16D10.07c 68012661 3361342 complement(join(3609646..3610274,3610339..3610775,3610861..3610892,3611023..3611105,3611147..3611209,3611373..3611556)) 1 NC_003423.3 gene structure updated extended N-term by 9 amino acids, moved 1st splice site downstream by 15 bases (PMID 15545655); Sir2 family histone deacetylase Sir2 3611556 sir2 3361342 sir2 Schizosaccharomyces pombe 972h- Sir2 family histone deacetylase Sir2 NP_001018840.1 3609646 R 284812 CDS SPBC16D10.08c 19113295 2540026 complement(3612359..3615076) 1 NC_003423.3 heat shock protein Hsp104 (predicted) 3615076 2540026 SPBC16D10.08c Schizosaccharomyces pombe 972h- heat shock protein Hsp104 (predicted) NP_596503.1 3612359 R 284812 CDS SPBC16D10.09 19113296 2540020 join(3616685..3616765,3616877..3617578) 1 NC_003423.3 PCNA 3617578 pcn1 2540020 pcn1 Schizosaccharomyces pombe 972h- PCNA NP_596504.1 3616685 D 284812 CDS SPBC16D10.10 295442884 2539634 join(3618117..3618179,3618228..3618617,3618658..3618702,3618747..3618918,3618956..3619071,3619113..3619321,3619366..3619540) 1 NC_003423.3 overlap AT THE C TERMINAL; tRNA specific adenosine deaminase subunit Tad2 (predicted) 3619540 2539634 SPBC16D10.10 Schizosaccharomyces pombe 972h- tRNA specific adenosine deaminase subunit Tad2 (predicted) NP_596505.2 3618117 D 284812 CDS SPBC16D10.11c 19113298 2540180 complement(join(3619838..3620272,3620425..3620448)) 1 NC_003423.3 40S ribosomal protein S18 3620448 rps1801 2540180 rps1801 Schizosaccharomyces pombe 972h- 40S ribosomal protein S18 NP_596506.1 3619838 R 284812 CDS SPBC317.01 19113299 2540350 3626639..3627757 1 NC_003423.3 Mads BoX protrein 2; MADS-box transcription factor Pvg4 3627757 mbx2 2540350 mbx2 Schizosaccharomyces pombe 972h- MADS-box transcription factor Pvg4 NP_596507.1 3626639 D 284812 CDS SPBP8B7.01c 19113300 2541332 complement(join(3634100..3634159,3634229..3634364,3634413..3634525)) 1 NC_003423.3 RNAseP RNAse MRP subunit Pop7 (predicted) 3634525 2541332 SPBP8B7.01c Schizosaccharomyces pombe 972h- RNAseP RNAse MRP subunit Pop7 (predicted) NP_596508.1 3634100 R 284812 CDS SPBP8B7.02 19113301 2541283 3635445..3636230 1 NC_003423.3 sequence orphan 3636230 2541283 SPBP8B7.02 Schizosaccharomyces pombe 972h- sequence orphan NP_596509.1 3635445 D 284812 CDS SPBP8B7.03c 19113302 2541344 complement(3636555..3637646) 1 NC_003423.3 60S ribosomal protein L2 3637646 rpl402 2541344 rpl402 Schizosaccharomyces pombe 972h- 60S ribosomal protein L2 NP_596510.1 3636555 R 284812 CDS SPBP8B7.04 19113303 2541376 join(3638440..3638511,3638554..3640941) 1 NC_003423.3 sequence orphan 3640941 mug45 2541376 mug45 Schizosaccharomyces pombe 972h- sequence orphan NP_596511.1 3638440 D 284812 CDS SPBP8B7.05c 19113304 2541362 complement(3641216..3641950) 1 NC_003423.3 carbonic anhydrase (predicted) 3641950 2541362 SPBP8B7.05c Schizosaccharomyces pombe 972h- carbonic anhydrase (predicted) NP_596512.1 3641216 R 284812 CDS SPBP8B7.06 19113305 2541296 join(3643189..3643497,3643561..3643584) 1 NC_003423.3 60S acidic ribosomal protein P2A subunit 3643584 rpp201 2541296 rpp201 Schizosaccharomyces pombe 972h- 60S acidic ribosomal protein P2A subunit NP_596513.1 3643189 D 284812 CDS SPBP8B7.07c 19113306 2541370 complement(join(3643818..3645050,3645186..3645325,3645364..3645442)) 1 NC_003423.3 histone lysine methyltransferase Set6 (predicted) 3645442 set6 2541370 set6 Schizosaccharomyces pombe 972h- histone lysine methyltransferase Set6 (predicted) NP_596514.1 3643818 R 284812 CDS SPBP8B7.08c 19113307 2541346 complement(join(3645659..3645940,3645990..3646258,3646315..3646438,3646492..3646749)) 1 NC_003423.3 leucine carboxyl methyltransferase (predicted) 3646749 2541346 SPBP8B7.08c Schizosaccharomyces pombe 972h- leucine carboxyl methyltransferase (predicted) NP_596515.1 3645659 R 284812 CDS SPBP8B7.09c 19113308 2541311 complement(3647145..3650081) 1 NC_003423.3 karyopherin Los1 (exportin t) 3650081 los1 2541311 los1 Schizosaccharomyces pombe 972h- karyopherin Los1 (exportin t) NP_596516.1 3647145 R 284812 CDS SPBP8B7.10c 19113309 2541361 complement(join(3650627..3651086,3651174..3651716,3651783..3651820)) 1 NC_003423.3 U3 snoRNP-associated protein Utp16 (predicted) 3651820 2541361 SPBP8B7.10c Schizosaccharomyces pombe 972h- U3 snoRNP-associated protein Utp16 (predicted) NP_596517.1 3650627 R 284812 CDS SPBP8B7.11 19113310 2541364 join(3652307..3652420,3652489..3652563,3652680..3653795) 1 NC_003423.3 ubiquitin protease cofactor (predicted) 3653795 2541364 SPBP8B7.11 Schizosaccharomyces pombe 972h- ubiquitin protease cofactor (predicted) NP_596518.1 3652307 D 284812 CDS SPBP8B7.12c 19113311 2541342 complement(3654474..3655136) 1 NC_003423.3 Sim4 and Mal2 associated (4 and 2 associated) protein 3 3655136 fta3 2541342 fta3 Schizosaccharomyces pombe 972h- Sim4 and Mal2 associated (4 and 2 associated) protein 3 NP_596519.1 3654474 R 284812 CDS SPBP8B7.13 19113312 2541367 join(3655545..3655704,3655780..3656375) 1 NC_003423.3 conserved fungal protein 3656375 2541367 SPBP8B7.13 Schizosaccharomyces pombe 972h- conserved fungal protein NP_596520.1 3655545 D 284812 CDS SPBP8B7.14c 19113313 2541347 complement(join(3656886..3657041,3657082..3657192,3657235..3658752)) 1 NC_003423.3 DNA polymerase epsilon catalytic subunit B, Dpb2 3658752 dpb2 2541347 dpb2 Schizosaccharomyces pombe 972h- DNA polymerase epsilon catalytic subunit B, Dpb2 NP_596521.1 3656886 R 284812 CDS SPBP8B7.15c 19113314 2541385 complement(3660173..3661621) 1 NC_003423.3 ubiquitin-protein ligase E3 RBBP6 family involved in mRNA cleavage (predicted) 3661621 2541385 SPBP8B7.15c Schizosaccharomyces pombe 972h- ubiquitin-protein ligase E3 RBBP6 family involved in mRNA cleavage (predicted) NP_596522.1 3660173 R 284812 CDS SPBP8B7.16c 19113315 2541383 complement(join(3662854..3663206,3663906..3665137,3665234..3665301)) 1 NC_003423.3 large 3' intron like S. cerevisiae DBP2; ATP-dependent RNA helicase Dbp2 3665301 dbp2 2541383 dbp2 Schizosaccharomyces pombe 972h- ATP-dependent RNA helicase Dbp2 NP_596523.1 3662854 R 284812 CDS SPBP8B7.17c 19113316 2540207 complement(3665868..3667388) 1 NC_003423.3 phosphomethylpyrimidine kinase (predicted) 3667388 2540207 SPBP8B7.17c Schizosaccharomyces pombe 972h- phosphomethylpyrimidine kinase (predicted) NP_596524.1 3665868 R 284812 CDS SPBP8B7.18c 19113317 2541373 complement(3668063..3669718) 1 NC_003423.3 phosphomethylpyrimidine kinase (predicted) 3669718 2541373 SPBP8B7.18c Schizosaccharomyces pombe 972h- phosphomethylpyrimidine kinase (predicted) NP_596525.1 3668063 R 284812 CDS SPBP8B7.19 19113318 2541355 3671459..3674518 1 NC_003423.3 FACT complex component Spt16 3674518 spt16 2541355 spt16 Schizosaccharomyces pombe 972h- FACT complex component Spt16 NP_596526.1 3671459 D 284812 CDS SPBP8B7.20c 19113319 2541274 complement(3674751..3676577) 1 NC_003423.3 RNA methyltransferase Nop2 (predicted) 3676577 2541274 SPBP8B7.20c Schizosaccharomyces pombe 972h- RNA methyltransferase Nop2 (predicted) NP_596527.1 3674751 R 284812 CDS SPBP8B7.21 19113320 2541378 join(3677713..3677793,3677832..3679289) 1 NC_003423.3 ubiquitin C-terminal hydrolase Ubp3 3679289 ubp3 2541378 ubp3 Schizosaccharomyces pombe 972h- ubiquitin C-terminal hydrolase Ubp3 NP_596528.1 3677713 D 284812 CDS SPBP8B7.22 19113321 2540214 join(3680026..3680047,3680085..3680210,3680266..3680756) 1 NC_003423.3 HDEL receptor 3680756 erd2 2540214 erd2 Schizosaccharomyces pombe 972h- HDEL receptor NP_596529.1 3680026 D 284812 CDS SPBP8B7.23 19113322 2541365 3682061..3684082 1 NC_003423.3 ubiquitin-protein ligase E3 (predicted) 3684082 2541365 SPBP8B7.23 Schizosaccharomyces pombe 972h- ubiquitin-protein ligase E3 (predicted) NP_596530.1 3682061 D 284812 CDS SPBP8B7.24c 19113323 2541386 complement(join(3684653..3684928,3685095..3685150,3685232..3685265)) 1 NC_003423.3 autophagy associated protein Atg8 (predicted) 3685265 atg8 2541386 atg8 Schizosaccharomyces pombe 972h- autophagy associated protein Atg8 (predicted) NP_596531.1 3684653 R 284812 CDS SPBP8B7.25 19113324 2541395 join(3685901..3686363,3686457..3686599) 1 NC_003423.3 cyclophilin family peptidyl-prolyl cis-trans isomerase Cyp4 3686599 cyp4 2541395 cyp4 Schizosaccharomyces pombe 972h- cyclophilin family peptidyl-prolyl cis-trans isomerase Cyp4 NP_596532.1 3685901 D 284812 CDS SPBP8B7.26 19113325 2541384 join(3687124..3687208,3687263..3687966) 1 NC_003423.3 sequence orphan 3687966 2541384 SPBP8B7.26 Schizosaccharomyces pombe 972h- sequence orphan NP_596533.1 3687124 D 284812 CDS SPBP8B7.27 19113326 2541379 join(3688539..3688772,3688817..3691006) 1 NC_003423.3 first exon may be incorrect; ubiquitin-protein ligase E3 3691006 mug30 2541379 mug30 Schizosaccharomyces pombe 972h- ubiquitin-protein ligase E3 NP_596534.1 3688539 D 284812 CDS SPBP8B7.28c 19113327 2541372 complement(3691201..3691848) 1 NC_003423.3 sequence orphan 3691848 2541372 SPBP8B7.28c Schizosaccharomyces pombe 972h- sequence orphan NP_596535.1 3691201 R 284812 CDS SPBP8B7.29 19113328 2541382 3692563..3694719 1 NC_003423.3 para-aminobenzoate synthase (predicted) 3694719 2541382 SPBP8B7.29 Schizosaccharomyces pombe 972h- para-aminobenzoate synthase (predicted) NP_596536.1 3692563 D 284812 CDS SPBP8B7.30c 19113329 2541388 complement(3695121..3697694) 1 NC_003423.3 transcription factor Thi5 3697694 thi5 2541388 thi5 Schizosaccharomyces pombe 972h- transcription factor Thi5 NP_596537.1 3695121 R 284812 CDS SPBP8B7.31 19113330 2541375 join(3698333..3698414,3698473..3698724,3698800..3698999) 1 NC_003423.3 acid phosphatase (predicted) 3698999 2541375 SPBP8B7.31 Schizosaccharomyces pombe 972h- acid phosphatase (predicted) NP_596538.1 3698333 D 284812 CDS SPBC19F5.01c 19113331 2540654 complement(3699573..3700652) 1 NC_003423.3 cyclin Puc1 3700652 puc1 2540654 puc1 Schizosaccharomyces pombe 972h- cyclin Puc1 NP_596539.1 3699573 R 284812 CDS SPBC19F5.02c 19113332 2540514 complement(3703742..3705874) 1 NC_003423.3 U3 snoRNP protein Utp4 (predicted) 3705874 2540514 SPBC19F5.02c Schizosaccharomyces pombe 972h- U3 snoRNP protein Utp4 (predicted) NP_596540.1 3703742 R 284812 CDS SPBC19F5.03 19113333 2540393 3706732..3708528 1 NC_003423.3 inositol polyphosphate phosphatase (predicted) 3708528 2540393 SPBC19F5.03 Schizosaccharomyces pombe 972h- inositol polyphosphate phosphatase (predicted) NP_596541.1 3706732 D 284812 CDS SPBC19F5.04 19113334 2540602 join(3709272..3709384,3709756..3711202) 1 NC_003423.3 aspartate kinase (predicted) 3711202 2540602 SPBC19F5.04 Schizosaccharomyces pombe 972h- aspartate kinase (predicted) NP_596542.1 3709272 D 284812 CDS SPBC19F5.05c 19113335 2540659 complement(join(3711604..3713237,3713392..3713559,3713598..3713619)) 1 NC_003423.3 pescadillo-family BRCT domain protein 3713619 ppp1 2540659 ppp1 Schizosaccharomyces pombe 972h- pescadillo-family BRCT domain protein NP_596543.1 3711604 R 284812 CDS SPBC25D12.02c 19113336 2540499 complement(join(3715200..3716856,3716909..3717051)) 1 NC_003423.3 nucleolar protein Dnt1 3717051 dnt1 2540499 dnt1 Schizosaccharomyces pombe 972h- nucleolar protein Dnt1 NP_596544.1 3715200 R 284812 CDS SPBC25D12.03c 19113337 2540630 complement(3717638..3719920) 1 NC_003423.3 MCM complex subunit Mcm7 3719920 mcm7 2540630 mcm7 Schizosaccharomyces pombe 972h- MCM complex subunit Mcm7 NP_596545.1 3717638 R 284812 CDS SPBC25D12.04 19113338 2540381 3721755..3722930 1 NC_003423.3 ribonucleotide reductase small subunit Suc22 3722930 suc22 2540381 suc22 Schizosaccharomyces pombe 972h- ribonucleotide reductase small subunit Suc22 NP_596546.1 3721755 D 284812 CDS SPBC25D12.05 19113339 2540604 3723383..3725029 1 NC_003423.3 N2,N2-dimethylguanosine tRNA methyltransferase 3725029 trm1 2540604 trm1 Schizosaccharomyces pombe 972h- N2,N2-dimethylguanosine tRNA methyltransferase NP_596547.1 3723383 D 284812 CDS SPBC25D12.06 19113340 2540404 3725430..3727127 1 NC_003423.3 RNA helicase (predicted) 3727127 2540404 SPBC25D12.06 Schizosaccharomyces pombe 972h- RNA helicase (predicted) NP_596548.1 3725430 D 284812 CDS SPBC13G1.14c 63054796 2539695 complement(join(3727332..3727657,3727705..3727810,3727877..3728176)) 1 NC_003423.3 uncertain translation start point; RNA-binding protein 3728176 2539695 SPBC13G1.14c Schizosaccharomyces pombe 972h- RNA-binding protein NP_596549.2 3727332 R 284812 CDS SPBC13G1.01c 19113342 2540056 complement(join(3728252..3729199,3729253..3729288)) 1 NC_003423.3 mitochondrial ribosomal protein subunit S4 3729288 nam9 2540056 nam9 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit S4 NP_596550.1 3728252 R 284812 CDS SPBC13G1.02 19113343 2539751 join(3729817..3729857,3729921..3729960,3730061..3731224) 1 NC_003423.3 mannose-1-phosphate guanyltransferase (predicted) 3731224 2539751 SPBC13G1.02 Schizosaccharomyces pombe 972h- mannose-1-phosphate guanyltransferase (predicted) NP_596551.1 3729817 D 284812 CDS SPBC13G1.03c 19113344 2540079 complement(join(3731432..3732019,3732080..3732352)) 1 NC_003423.3 peroxisomal docking protein Pex14 3732352 pex14 2540079 pex14 Schizosaccharomyces pombe 972h- peroxisomal docking protein Pex14 NP_596552.1 3731432 R 284812 CDS SPBC13G1.04c 295442886 2539935 complement(join(3732806..3732930,3732994..3733762)) 1 NC_003423.3 alkB homolog 3733762 2539935 SPBC13G1.04c Schizosaccharomyces pombe 972h- alkB homolog NP_596553.2 3732806 R 284812 CDS SPBC13G1.05 19113346 2539819 join(3734792..3735902,3735949..3736232,3736288..3736725,3736788..3736904) 1 NC_003423.3 DUF747 family protein 3736904 2539819 SPBC13G1.05 Schizosaccharomyces pombe 972h- DUF747 family protein NP_596554.1 3734792 D 284812 CDS SPBC13G1.06c 19113347 2539888 complement(join(3737080..3737142,3737222..3737467)) 1 NC_003423.3 this gene product was previously annotated to the NADH dehydrogenase of the mitochondrial respiratory chain complex I, this mapping was removed due to lack of the remaining 40 subunits found in mammals (PMID:1518044); iron sulfur cluster assembly protein Isd11 3737467 isd11 2539888 isd11 Schizosaccharomyces pombe 972h- iron sulfur cluster assembly protein Isd11 NP_596555.1 3737080 R 284812 CDS SPBC13G1.07 19113348 2539719 3737657..3738727 1 NC_003423.3 palmitoyltransferase (predicted) 3738727 2539719 SPBC13G1.07 Schizosaccharomyces pombe 972h- palmitoyltransferase (predicted) NP_596556.1 3737657 D 284812 CDS SPBC13G1.08c 19113349 2539667 complement(3738975..3740933) 1 NC_003423.3 Ash2-trithorax family protein 3740933 ash2 2539667 ash2 Schizosaccharomyces pombe 972h- Ash2-trithorax family protein NP_596557.1 3738975 R 284812 CDS SPBC13G1.15c 19113350 2539742 complement(3741441..3741776) 1 NC_003423.3 sequence orphan 3741776 2539742 SPBC13G1.15c Schizosaccharomyces pombe 972h- sequence orphan NP_596558.1 3741441 R 284812 CDS SPBC13G1.09 19113351 2539887 join(3742426..3743352,3743396..3743818) 1 NC_003423.3 U3 and U14 snoRNA associated protein (predicted) 3743818 2539887 SPBC13G1.09 Schizosaccharomyces pombe 972h- U3 and U14 snoRNA associated protein (predicted) NP_596559.1 3742426 D 284812 CDS SPBC13G1.10c 19113352 2539673 complement(3744068..3749875) 1 NC_003423.3 ATP-dependent RNA helicase Slh1 3749875 mug81 2539673 mug81 Schizosaccharomyces pombe 972h- ATP-dependent RNA helicase Slh1 NP_596560.1 3744068 R 284812 CDS SPBC13G1.11 19113353 2539873 join(3750169..3750272,3750321..3750810) 1 NC_003423.3 SNARE Ykt6 3750810 ykt6 2539873 ykt6 Schizosaccharomyces pombe 972h- SNARE Ykt6 NP_596561.1 3750169 D 284812 CDS SPBC13G1.12 19113354 2539670 join(3752588..3752635,3752757..3752903,3752946..3753014,3753070..3753141,3753194..3753394) 1 NC_003423.3 vacuolar sorting protein Did2 3753394 did2 2539670 did2 Schizosaccharomyces pombe 972h- vacuolar sorting protein Did2 NP_596562.1 3752588 D 284812 CDS SPBC13G1.13 19113355 2539790 join(3754070..3754392,3754438..3755458) 1 NC_003423.3 transcription factor TFIIH complex subunit Tfb2 3755458 tfb2 2539790 tfb2 Schizosaccharomyces pombe 972h- transcription factor TFIIH complex subunit Tfb2 NP_596563.1 3754070 D 284812 CDS SPBC31F10.02 19113356 2540374 3755933..3756418 1 NC_003423.3 thioesterase superfamily protein 3756418 2540374 SPBC31F10.02 Schizosaccharomyces pombe 972h- thioesterase superfamily protein NP_596564.1 3755933 D 284812 CDS SPBC31F10.03 19113357 2540372 3756657..3757268 1 NC_003423.3 ChaC-like protein, predicted cation transport regulator 3757268 2540372 SPBC31F10.03 Schizosaccharomyces pombe 972h- ChaC-like protein, predicted cation transport regulator NP_596565.1 3756657 D 284812 CDS SPBC31F10.04c 19113358 2540294 complement(join(3757531..3758830,3758892..3759140,3759196..3759284)) 1 NC_003423.3 mediator complex subunit Srb4 3759284 srb4 2540294 srb4 Schizosaccharomyces pombe 972h- mediator complex subunit Srb4 NP_596566.1 3757531 R 284812 CDS SPBC31F10.05 19113359 2540391 join(3759893..3760280,3760351..3760616) 1 NC_003423.3 sequence orphan 3760616 mug37 2540391 mug37 Schizosaccharomyces pombe 972h- sequence orphan NP_596567.1 3759893 D 284812 CDS SPBC31F10.06c 19113360 2540439 complement(join(3760951..3761294,3761552..3761657,3761707..3761829)) 1 NC_003423.3 ADP-ribosylation factor Sar1 3761829 sar1 2540439 sar1 Schizosaccharomyces pombe 972h- ADP-ribosylation factor Sar1 NP_596568.1 3760951 R 284812 CDS SPBC31F10.07 19113361 2540327 3763170..3764084 1 NC_003423.3 cortical component Lsb5 (predicted) 3764084 2540327 SPBC31F10.07 Schizosaccharomyces pombe 972h- cortical component Lsb5 (predicted) NP_596569.1 3763170 D 284812 CDS SPBC31F10.08 295442888 2540312 join(3764820..3765437,3765491..3765709) 1 NC_003423.3 mei4-dependent expression 2; Mde2 protein 3765709 mde2 2540312 mde2 Schizosaccharomyces pombe 972h- Mde2 protein NP_596570.2 3764820 D 284812 CDS SPBC31F10.09c 19113363 2540272 complement(3765847..3766263) 1 NC_003423.3 mediator complex subunit Med10 3766263 nut2 2540272 nut2 Schizosaccharomyces pombe 972h- mediator complex subunit Med10 NP_596571.1 3765847 R 284812 CDS SPBC31F10.10c 19113364 2540322 complement(3767253..3768977) 1 NC_003423.3 zf-MYND type zinc finger protein 3768977 2540322 SPBC31F10.10c Schizosaccharomyces pombe 972h- zf-MYND type zinc finger protein NP_596572.1 3767253 R 284812 CDS SPBC31F10.11c 19113365 2540328 complement(3771033..3773057) 1 NC_003423.3 complexed with Cdc5 protein Cwf4 3773057 cwf4 2540328 cwf4 Schizosaccharomyces pombe 972h- complexed with Cdc5 protein Cwf4 NP_596573.1 3771033 R 284812 CDS SPBC31F10.12 295442890 2540396 join(3773308..3773318,3773373..3773525,3773581..3773678,3773795..3773999,3774059..3774116,3774192..3774212) 1 NC_003423.3 RNA-binding protein Tma20 (predicted) 3774212 2540396 SPBC31F10.12 Schizosaccharomyces pombe 972h- RNA-binding protein Tma20 (predicted) NP_596574.2 3773308 D 284812 CDS SPBC31F10.13c 19113367 2540219 complement(join(3774357..3776749,3776790..3776881,3776923..3777121,3777178..3777255,3777314..3777350)) 1 NC_003423.3 HIRA in S. pombe 1; hira protein, histone chaperone Hip1 3777350 hip1 2540219 hip1 Schizosaccharomyces pombe 972h- hira protein, histone chaperone Hip1 NP_596575.1 3774357 R 284812 CDS SPBC31F10.14c 19113368 2540227 complement(3777778..3782670) 1 NC_003423.3 HIRA interacting protein 3; HIRA interacting protein Hip3 3782670 hip3 2540227 hip3 Schizosaccharomyces pombe 972h- HIRA interacting protein Hip3 NP_596576.1 3777778 R 284812 CDS SPBC31F10.15c 19113369 2540229 complement(join(3784187..3784361,3784434..3784462)) 1 NC_003423.3 F0-ATPase epsilon subunit 3784462 atp15 2540229 atp15 Schizosaccharomyces pombe 972h- F0-ATPase epsilon subunit NP_596577.1 3784187 R 284812 CDS SPBC31F10.16 19113370 2540240 join(3785848..3785879,3785929..3786055,3786111..3787820,3787876..3788046) 1 NC_003423.3 ChAPs family protein 3788046 2540240 SPBC31F10.16 Schizosaccharomyces pombe 972h- ChAPs family protein NP_596578.1 3785848 D 284812 CDS SPBC31F10.17c 19113371 2540245 complement(join(3788317..3788649,3788725..3788799)) 1 NC_003423.3 sequence orphan 3788799 2540245 SPBC31F10.17c Schizosaccharomyces pombe 972h- sequence orphan NP_596579.1 3788317 R 284812 CDS SPBC21C3.01c 162312301 2540516 complement(join(3789386..3798466,3798518..3798630,3798682..3798703)) 1 NC_003423.3 chorein homolog 3798703 vps13a 2540516 vps13a Schizosaccharomyces pombe 972h- chorein homolog XP_001713147.1 3789386 R 284812 CDS SPBC21C3.02c 19113374 2540595 complement(3799531..3801006) 1 NC_003423.3 Sds3-like family protein Dep1 3801006 dep1 2540595 dep1 Schizosaccharomyces pombe 972h- Sds3-like family protein Dep1 NP_596582.1 3799531 R 284812 CDS SPBC21C3.03 19113375 2540293 join(3802251..3802829,3802885..3804330) 1 NC_003423.3 ABC1 kinase family protein 3804330 2540293 SPBC21C3.03 Schizosaccharomyces pombe 972h- ABC1 kinase family protein NP_596583.1 3802251 D 284812 CDS SPBC21C3.04c 19113376 2540621 complement(3804575..3804901) 1 NC_003423.3 mitochondrial ribosomal protein subunit L34 3804901 2540621 SPBC21C3.04c Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit L34 NP_596584.1 3804575 R 284812 CDS SPBC21C3.05 19113377 2540622 join(3805802..3805927,3806244..3806685,3806749..3806834) 1 NC_003423.3 zinc finger protein Sap62 3806834 sap62 2540622 sap62 Schizosaccharomyces pombe 972h- zinc finger protein Sap62 NP_596585.1 3805802 D 284812 CDS SPBC21C3.06 19113378 2540417 3807090..3807458 1 NC_003423.3 questionable ORF; sequence orphan 3807458 2540417 SPBC21C3.06 Schizosaccharomyces pombe 972h- sequence orphan NP_596586.1 3807090 D 284812 CDS SPBC21C3.07c 295442893 2540321 complement(join(3807714..3807783,3807831..3807891,3807946..3808607,3808665..3808795)) 1 NC_003423.3 actin binding methyltransferase (predicted) 3808795 2540321 SPBC21C3.07c Schizosaccharomyces pombe 972h- actin binding methyltransferase (predicted) NP_596587.2 3807714 R 284812 CDS SPBC21C3.08c 19113380 2540626 complement(3809411..3810727) 1 NC_003423.3 ornithine aminotransferase 3810727 2540626 SPBC21C3.08c Schizosaccharomyces pombe 972h- ornithine aminotransferase NP_596588.1 3809411 R 284812 CDS SPBC21C3.09c 19113381 2540605 complement(join(3811374..3811992,3812142..3812188)) 1 NC_003423.3 fumarylacetoacetate (FAA) hydrolase 3812188 2540605 SPBC21C3.09c Schizosaccharomyces pombe 972h- fumarylacetoacetate (FAA) hydrolase NP_596589.1 3811374 R 284812 CDS SPBC21C3.10c 19113382 2540625 complement(3812462..3813268) 1 NC_003423.3 5-amino-6-(5-phosphoribosylamino) uracil reductase 3813268 2540625 SPBC21C3.10c Schizosaccharomyces pombe 972h- 5-amino-6-(5-phosphoribosylamino) uracil reductase NP_596590.1 3812462 R 284812 CDS SPBC21C3.11 19113383 2540575 3815525..3816802 1 NC_003423.3 note PSI Blast shows conserved N-terminal region, needs Pfam submission; UBX domain protein Ubx4 (predicted) 3816802 ubx4 2540575 ubx4 Schizosaccharomyces pombe 972h- UBX domain protein Ubx4 (predicted) NP_596591.1 3815525 D 284812 CDS SPBC21C3.12c 19113384 2540715 complement(3817041..3817415) 1 NC_003423.3 DUF953 family protein 3817415 2540715 SPBC21C3.12c Schizosaccharomyces pombe 972h- DUF953 family protein NP_596592.1 3817041 R 284812 CDS SPBC21C3.13 19113385 2540447 join(3818298..3818373,3818530..3818888) 1 NC_003423.3 40S ribosomal protein S19 3818888 rps1901 2540447 rps1901 Schizosaccharomyces pombe 972h- 40S ribosomal protein S19 NP_596593.1 3818298 D 284812 CDS SPBC21C3.14c 19113386 2540519 complement(3819384..3821909) 1 NC_003423.3 sequence orphan 3821909 2540519 SPBC21C3.14c Schizosaccharomyces pombe 972h- sequence orphan NP_596594.1 3819384 R 284812 CDS SPBC21C3.15c 19113387 2540508 complement(3822568..3824136) 1 NC_003423.3 aldehyde dehydrogenase (predicted) 3824136 2540508 SPBC21C3.15c Schizosaccharomyces pombe 972h- aldehyde dehydrogenase (predicted) NP_596595.1 3822568 R 284812 CDS SPBC21C3.16c 19113388 2540700 complement(3824636..3824953) 1 NC_003423.3 transcription elongation factor complex subunit Spt4 3824953 spt4 2540700 spt4 Schizosaccharomyces pombe 972h- transcription elongation factor complex subunit Spt4 NP_596596.1 3824636 R 284812 CDS SPBC21C3.17c 19113389 2540488 complement(join(3825604..3826073,3826124..3826214)) 1 NC_003423.3 homology to YKL077W is low but has conserved residues by multiple alignment, conserved N-terminal signal peptide and C-terminal transmenbrane helix; conserved fungal protein 3826214 2540488 SPBC21C3.17c Schizosaccharomyces pombe 972h- conserved fungal protein NP_596597.1 3825604 R 284812 CDS SPBC21C3.18 19113390 2540745 join(3827178..3828171,3828294..3828461,3828722..3828849) 1 NC_003423.3 serine/threonine protein kinase Spo4 3828849 spo4 2540745 spo4 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Spo4 NP_596598.1 3827178 D 284812 CDS SPBC21C3.19 19113391 2540610 3830167..3830487 1 NC_003423.3 DUF1960 family protein 3830487 2540610 SPBC21C3.19 Schizosaccharomyces pombe 972h- DUF1960 family protein NP_596599.1 3830167 D 284812 CDS SPBC21C3.20c 19113392 2540617 complement(3831197..3834493) 1 NC_003423.3 glucose insensitive transcription; C2 domain protein Git1 3834493 git1 2540617 git1 Schizosaccharomyces pombe 972h- C2 domain protein Git1 NP_596600.1 3831197 R 284812 CDS SPBC23E6.01c 162312303 2540551 complement(3835843..3837264) 1 NC_003423.3 RNA-binding protein, rrm type 3837264 2540551 SPBC23E6.01c Schizosaccharomyces pombe 972h- RNA-binding protein, rrm type NP_596601.2 3835843 R 284812 CDS SPBC23E6.02 19113394 2540464 3839637..3842759 1 NC_003423.3 ATP-dependent DNA helicase (predicted) 3842759 2540464 SPBC23E6.02 Schizosaccharomyces pombe 972h- ATP-dependent DNA helicase (predicted) NP_596602.1 3839637 D 284812 CDS SPBC23E6.03c 19113395 2540661 complement(join(3842842..3843560,3843607..3843748)) 1 NC_003423.3 protein N-terminal amidase Nta1 (predicted) 3843748 nta1 2540661 nta1 Schizosaccharomyces pombe 972h- protein N-terminal amidase Nta1 (predicted) NP_596603.1 3842842 R 284812 CDS SPBC23E6.04c 19113396 2540284 complement(3844447..3849396) 1 NC_003423.3 U3 snoRNP-associated protein Utp10 (predicted) 3849396 utp10 2540284 utp10 Schizosaccharomyces pombe 972h- U3 snoRNP-associated protein Utp10 (predicted) NP_596604.1 3844447 R 284812 CDS SPBC23E6.05 19113397 2540457 join(3850011..3850187,3850324..3850484,3850522..3851437) 1 NC_003423.3 ribosomal export complex protein Arx1 (predicted) 3851437 arx1 2540457 arx1 Schizosaccharomyces pombe 972h- ribosomal export complex protein Arx1 (predicted) NP_596605.1 3850011 D 284812 CDS SPBC23E6.06c 19113398 2540577 complement(join(3851754..3852213,3852257..3852374,3852423..3852459)) 1 NC_003423.3 3,4-dihydroxy-2-butanone 4-phosphate synthase (predicted) 3852459 2540577 SPBC23E6.06c Schizosaccharomyces pombe 972h- 3,4-dihydroxy-2-butanone 4-phosphate synthase (predicted) NP_596606.1 3851754 R 284812 CDS SPBC23E6.07c 19113399 2540426 complement(join(3852962..3855515,3855576..3855635,3855684..3855802,3855871..3855942)) 1 NC_003423.3 DNA replication factor C complex subunit Rfc1 3855942 rfc1 2540426 rfc1 Schizosaccharomyces pombe 972h- DNA replication factor C complex subunit Rfc1 NP_596607.1 3852962 R 284812 CDS SPBC23E6.08 19113400 2540531 join(3856354..3856696,3856987..3858296) 1 NC_003423.3 Golgi membrane exchange factor subunit Sat1 (predicted) 3858296 sat1 2540531 sat1 Schizosaccharomyces pombe 972h- Golgi membrane exchange factor subunit Sat1 (predicted) NP_596608.1 3856354 D 284812 CDS SPBC23E6.09 19113401 2540656 3863505..3866813 1 NC_003423.3 recruited by sequence-specific DNA-binding proteins (predicted); transcriptional corepressor Ssn6 3866813 ssn6 2540656 ssn6 Schizosaccharomyces pombe 972h- transcriptional corepressor Ssn6 NP_596609.1 3863505 D 284812 CDS SPBC23E6.10c 19113402 2540540 complement(3867522..3868601) 1 NC_003423.3 methylthioribose-1-phosphate isomerase (predicted) 3868601 2540540 SPBC23E6.10c Schizosaccharomyces pombe 972h- methylthioribose-1-phosphate isomerase (predicted) NP_596610.1 3867522 R 284812 CDS SPBC211.01 63054799 2540539 join(3870305..3870372,3870439..3871045) 1 NC_003423.3 this is reported to be mitochondrial...but maybe it is really cytoplasmic?; mitochondrial ribosomal protein subunit S10 3871045 rsm10 2540539 rsm10 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit S10 NP_596611.2 3870305 D 284812 CDS SPBC211.02c 19113404 2540753 complement(join(3871208..3872764,3872823..3873638)) 1 NC_003423.3 complexed with Cdc5 protein Cwf3 3873638 cwf3 2540753 cwf3 Schizosaccharomyces pombe 972h- complexed with Cdc5 protein Cwf3 NP_596612.1 3871208 R 284812 CDS SPBC211.03c 19113405 2540746 complement(3875452..3879840) 1 NC_003423.3 guanyl-nucleotide exchange factor (predicted) 3879840 2540746 SPBC211.03c Schizosaccharomyces pombe 972h- guanyl-nucleotide exchange factor (predicted) NP_596613.1 3875452 R 284812 CDS SPBC211.04c 19113406 2540784 complement(3880318..3882996) 1 NC_003423.3 MCM complex subunit Mcm6 3882996 mcm6 2540784 mcm6 Schizosaccharomyces pombe 972h- MCM complex subunit Mcm6 NP_596614.1 3880318 R 284812 CDS SPBC211.05 19113407 2540636 join(3883221..3883223,3883286..3883368,3883424..3883595) 1 NC_003423.3 splicing factor 3B 3883595 2540636 SPBC211.05 Schizosaccharomyces pombe 972h- splicing factor 3B NP_596615.1 3883221 D 284812 CDS SPBC211.06 19113408 2540667 3883933..3885666 1 NC_003423.3 possibility of internal splice but predicted intron has poor score, and homology not improved; Gcp Four Homolog; gamma tubulin complex subunit Gfh1 3885666 gfh1 2540667 gfh1 Schizosaccharomyces pombe 972h- gamma tubulin complex subunit Gfh1 NP_596616.1 3883933 D 284812 CDS SPBC211.07c 19113409 2540738 complement(3886012..3886566) 1 NC_003423.3 ubiquitin conjugating enzyme Ubc8 3886566 ubc8 2540738 ubc8 Schizosaccharomyces pombe 972h- ubiquitin conjugating enzyme Ubc8 NP_596617.1 3886012 R 284812 CDS SPBC211.08c 19113410 2540412 complement(join(3887467..3888125,3888164..3888278)) 1 NC_003423.3 exosomal 3'-5' exoribonuclease, PH-like 3888278 2540412 SPBC211.08c Schizosaccharomyces pombe 972h- exosomal 3'-5' exoribonuclease, PH-like NP_596618.1 3887467 R 284812 CDS SPBC1604.21c 162312305 2540744 join(3888696..3888701,3888760..3888824,3888933..3891900) 1 NC_003423.3 ubiquitin activating enzyme (E1) 3891900 ptr3 2540744 ptr3 Schizosaccharomyces pombe 972h- ubiquitin activating enzyme (E1) XP_001713148.1 3888696 D 284812 CDS SPBC1604.25 295442895 9406967 join(3892255..3892350,3892404..3892574) 1 NC_003423.3 Pet117 cytochrome c oxidase assemby protein (predicted) 3892574 pet117 9406967 pet117 Schizosaccharomyces pombe 972h- Pet117 cytochrome c oxidase assemby protein (predicted) XP_002788942.1 3892255 D 284812 CDS SPBC1604.20c 19113412 2539857 3893201..3895087 1 NC_003423.3 kinesin-like protein Tea2 3895087 tea2 2539857 tea2 Schizosaccharomyces pombe 972h- kinesin-like protein Tea2 NP_596620.1 3893201 D 284812 CDS SPBC1604.19c 19113413 2539665 3895410..3897386 1 NC_003423.3 TRAPP complex subunit Trs85 (predicted) 3897386 2539665 SPBC1604.19c Schizosaccharomyces pombe 972h- TRAPP complex subunit Trs85 (predicted) NP_596621.1 3895410 D 284812 CDS SPBC1604.18c 19113414 2539983 join(3898096..3898374,3898418..3898819,3898881..3899549) 1 NC_003423.3 vacuolar sorting protein (predicted) 3899549 2539983 SPBC1604.18c Schizosaccharomyces pombe 972h- vacuolar sorting protein (predicted) NP_596622.1 3898096 D 284812 CDS SPBC1604.17c 295442897 2539771 join(3900047..3900121,3900166..3901170,3901219..3901542) 1 NC_003423.3 coordinates updated 29/4/2002 previous coordinates (8945..8971,9475..10455,10528..10851) VW; Tel Two Interacting protein 2 3901542 tti2 2539771 tti2 Schizosaccharomyces pombe 972h- Tel Two Interacting protein 2 NP_596623.3 3900047 D 284812 CDS SPBC1604.16c 19113416 2539734 3901632..3902231 1 NC_003423.3 RNA-binding protein, G-patch type (predicted) 3902231 2539734 SPBC1604.16c Schizosaccharomyces pombe 972h- RNA-binding protein, G-patch type (predicted) NP_596624.1 3901632 D 284812 CDS SPBC1604.15 19113417 2539759 complement(3902420..3904057) 1 NC_003423.3 pig-T (predicted) 3904057 gpi16 2539759 gpi16 Schizosaccharomyces pombe 972h- pig-T (predicted) NP_596625.1 3902420 R 284812 CDS SPBC1604.14c 19113418 2539997 3905082..3907058 1 NC_003423.3 PAK-related kinase Shk1 3907058 shk1 2539997 shk1 Schizosaccharomyces pombe 972h- PAK-related kinase Shk1 NP_596626.1 3905082 D 284812 CDS SPBC1604.13c 19113419 2539681 3908138..3908449 1 NC_003423.3 mitochondrial ribosomal protein subunit L32 3908449 mrpl32 2539681 mrpl32 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit L32 NP_596627.1 3908138 D 284812 CDS SPBC1604.12 19113420 2539702 complement(3908893..3911475) 1 NC_003423.3 multiple TSS; sequence orphan 3911475 2539702 SPBC1604.12 Schizosaccharomyces pombe 972h- sequence orphan NP_596628.1 3908893 R 284812 CDS SPBC1604.11 19113421 2539609 complement(join(3912167..3912403,3912456..3912509)) 1 NC_003423.3 F0-ATPase subunit F 3912509 atp17 2539609 atp17 Schizosaccharomyces pombe 972h- F0-ATPase subunit F NP_596629.1 3912167 R 284812 CDS SPBC1604.10 19113422 2540209 complement(join(3913050..3913300,3913353..3913382,3913436..3913529,3913571..3913612)) 1 NC_003423.3 mediator complex subunit Srb7 3913612 srb7 2540209 srb7 Schizosaccharomyces pombe 972h- mediator complex subunit Srb7 NP_596630.1 3913050 R 284812 CDS SPBC1604.09c 19113423 2540203 join(3914696..3914728,3914803..3915552) 1 NC_003423.3 exoribonuclease Rex4 (predicted) 3915552 2540203 SPBC1604.09c Schizosaccharomyces pombe 972h- exoribonuclease Rex4 (predicted) NP_596631.1 3914696 D 284812 CDS SPBC1604.08c 19113424 2539928 3916626..3918245 1 NC_003423.3 importin alpha 3918245 imp1 2539928 imp1 Schizosaccharomyces pombe 972h- importin alpha NP_596632.1 3916626 D 284812 CDS SPBC1604.07 19113425 2539732 complement(join(3918769..3919484,3919529..3919547)) 1 NC_003423.3 F0-ATPase subunit 3919547 atp4 2539732 atp4 Schizosaccharomyces pombe 972h- F0-ATPase subunit NP_596633.1 3918769 R 284812 CDS SPBC1604.06c 19113426 2539987 3920073..3921530 1 NC_003423.3 CBF/Mak21 family 3921530 2539987 SPBC1604.06c Schizosaccharomyces pombe 972h- CBF/Mak21 family NP_596634.1 3920073 D 284812 CDS SPBC1604.05 19113427 2539625 complement(3921802..3923454) 1 NC_003423.3 glucose-6-phosphate isomerase (predicted) 3923454 pgi1 2539625 pgi1 Schizosaccharomyces pombe 972h- glucose-6-phosphate isomerase (predicted) NP_596635.1 3921802 R 284812 CDS SPBC1604.04 19113428 2540155 complement(join(3924320..3925172,3925219..3925310)) 1 NC_003423.3 mitochondrial thiamine pyrophosphate transporter 3925310 2540155 SPBC1604.04 Schizosaccharomyces pombe 972h- mitochondrial thiamine pyrophosphate transporter NP_596636.1 3924320 R 284812 CDS SPBC1604.03c 19113429 2539628 3927014..3928006 1 NC_003423.3 sequence orphan 3928006 2539628 SPBC1604.03c Schizosaccharomyces pombe 972h- sequence orphan NP_596637.1 3927014 D 284812 CDS SPBC1604.02c 19113430 2539860 3928423..3930516 1 NC_003423.3 sequence orphan 3930516 2539860 SPBC1604.02c Schizosaccharomyces pombe 972h- sequence orphan NP_596638.1 3928423 D 284812 CDS SPBC1604.01 162312307 2539656 complement(3930792..3933113) 1 NC_003423.3 sulfatase modifying factor 1 related 3933113 mug158 2539656 mug158 Schizosaccharomyces pombe 972h- sulfatase modifying factor 1 related NP_596639.2 3930792 R 284812 CDS SPBC1677.02 19113432 2539664 join(3935144..3935359,3935425..3935481) 1 NC_003423.3 dolichol-phosphate mannosyltransferase subunit 3 3935481 dpm3 2539664 dpm3 Schizosaccharomyces pombe 972h- dolichol-phosphate mannosyltransferase subunit 3 NP_596640.1 3935144 D 284812 CDS SPBC1677.03c 19113433 2540162 complement(3935864..3937666) 1 NC_003423.3 threonine ammonia-lyase 3937666 2540162 SPBC1677.03c Schizosaccharomyces pombe 972h- threonine ammonia-lyase NP_596641.1 3935864 R 284812 CDS SPBC26H8.01 19113434 2540526 3940574..3941560 1 NC_003423.3 Match to PF01946 Thi4, Thi4 family Score 628.69; thiazole biosynthetic enzyme 3941560 thi2 2540526 thi2 Schizosaccharomyces pombe 972h- thiazole biosynthetic enzyme NP_596642.1 3940574 D 284812 CDS SPBC26H8.02c 19113435 2540623 complement(3942485..3943744) 1 NC_003423.3 SNAP-25 homologue, t-SNARE component Sec9 3943744 sec9 2540623 sec9 Schizosaccharomyces pombe 972h- SNAP-25 homologue, t-SNARE component Sec9 NP_596643.1 3942485 R 284812 CDS SPBC26H8.03 19113436 2540538 3946061..3948778 1 NC_003423.3 phosphatidylethanolamine N-methyltransferase Cho2 3948778 cho2 2540538 cho2 Schizosaccharomyces pombe 972h- phosphatidylethanolamine N-methyltransferase Cho2 NP_596644.1 3946061 D 284812 CDS SPBC26H8.04c 19113437 2540559 complement(3949185..3953675) 1 NC_003423.3 DEP domain protein 3953675 2540559 SPBC26H8.04c Schizosaccharomyces pombe 972h- DEP domain protein NP_596645.1 3949185 R 284812 CDS SPBC26H8.05c 19113438 2540680 complement(join(3954715..3955236,3955290..3955744,3955860..3955929)) 1 NC_003423.3 possible intron between 145 21,14639 would improve homology slightly, but has no good acceptor, and insertions are present at this position; serine/threonine protein phosphatase (predicted) 3955929 2540680 SPBC26H8.05c Schizosaccharomyces pombe 972h- serine/threonine protein phosphatase (predicted) NP_596646.1 3954715 R 284812 CDS SPBC26H8.06 19113439 2540578 3957504..3958238 1 NC_003423.3 glutaredoxin Grx4 3958238 grx4 2540578 grx4 Schizosaccharomyces pombe 972h- glutaredoxin Grx4 NP_596647.1 3957504 D 284812 CDS SPBC26H8.13c 19113440 2540583 complement(join(3960642..3960696,3960781..3961100)) 1 NC_003423.3 sequence orphan 3961100 2540583 SPBC26H8.13c Schizosaccharomyces pombe 972h- sequence orphan NP_596648.1 3960642 R 284812 CDS SPBC26H8.14c 19113441 2540423 complement(join(3961943..3961973,3962021..3962124,3962202..3962279)) 1 NC_003423.3 cytochrome C oxidase copper chaperone Cox17 3962279 cox17 2540423 cox17 Schizosaccharomyces pombe 972h- cytochrome C oxidase copper chaperone Cox17 NP_596649.1 3961943 R 284812 CDS SPBC26H8.16 295442899 9407048 complement(join(3963243..3963323,3963394..3963615)) 1 NC_003423.3 derived from SPNG1907-08; mitochondrial protein, DUF1674 family 3963615 9407048 SPBC26H8.16 Schizosaccharomyces pombe 972h- mitochondrial protein, DUF1674 family XP_002788943.1 3963243 R 284812 CDS SPBC26H8.07c 19113442 2540582 complement(join(3964276..3964577,3964663..3965548,3965638..3965692,3965734..3965775,3965827..3965876,3965913..3965924)) 1 NC_003423.3 tubulin beta Nda3 3965924 nda3 2540582 nda3 Schizosaccharomyces pombe 972h- tubulin beta Nda3 NP_596650.1 3964276 R 284812 CDS SPBC26H8.08c 19113443 2540469 complement(join(3966700..3968099,3968143..3968155)) 1 NC_003423.3 GTPase Grn1 3968155 grn1 2540469 grn1 Schizosaccharomyces pombe 972h- GTPase Grn1 NP_596651.1 3966700 R 284812 CDS SPBC26H8.09c 19113444 2540474 complement(3968556..3970103) 1 NC_003423.3 repeat consensus HHDNSNKESTNLDDLNMLEEPK; SWI/SNF complex subunit Snf59 3970103 snf59 2540474 snf59 Schizosaccharomyces pombe 972h- SWI/SNF complex subunit Snf59 NP_596652.1 3968556 R 284812 CDS SPBC26H8.10 19113445 2540398 join(3970969..3971161,3971326..3974045) 1 NC_003423.3 does not bind GeneDB_Spombe:SPBC776.02c PMID 1944266; 3'-5' exoribonuclease subunit Dis3 (predicted) 3974045 dis3 2540398 dis3 Schizosaccharomyces pombe 972h- 3'-5' exoribonuclease subunit Dis3 (predicted) NP_596653.1 3970969 D 284812 CDS SPBC26H8.11c 19113446 2540376 complement(3974366..3974893) 1 NC_003423.3 conserved fungal protein 3974893 2540376 SPBC26H8.11c Schizosaccharomyces pombe 972h- conserved fungal protein NP_596654.1 3974366 R 284812 CDS SPBC26H8.12 19113447 2540445 3976841..3977974 1 NC_003423.3 cytochrome c heme lyase 3977974 2540445 SPBC26H8.12 Schizosaccharomyces pombe 972h- cytochrome c heme lyase NP_596655.1 3976841 D 284812 CDS SPBC32C12.02 19113448 2540258 3985586..3986992 1 NC_003423.3 the equivalent function in S. cerevisiae is performed by STE12, but this is STE-like not HMG; transcription factor Ste11 3986992 ste11 2540258 ste11 Schizosaccharomyces pombe 972h- transcription factor Ste11 NP_596656.1 3985586 D 284812 CDS SPBC32C12.03c 19113449 2540267 complement(3988015..3989286) 1 NC_003423.3 serine/threonine protein kinase Ppk25 (predicted) 3989286 ppk25 2540267 ppk25 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Ppk25 (predicted) NP_596657.1 3988015 R 284812 CDS SPBC3B9.01 19113450 2540288 3990667..3991530 1 NC_003423.3 Hsp70 nucleotide exchange factor (predicted) 3991530 2540288 SPBC3B9.01 Schizosaccharomyces pombe 972h- Hsp70 nucleotide exchange factor (predicted) NP_596658.1 3990667 D 284812 CDS SPBC3B9.02c 19113451 2540302 complement(3991692..3992837) 1 NC_003423.3 splicing factor Cwf28 3992837 cwf28 2540302 cwf28 Schizosaccharomyces pombe 972h- splicing factor Cwf28 NP_596659.1 3991692 R 284812 CDS SPBC3B9.03 19113452 2540909 join(3993457..3993657,3993836..3994996,3995075..3995356) 1 NC_003423.3 signal recognition particle receptor alpha subunit Srp101 3995356 2540909 SPBC3B9.03 Schizosaccharomyces pombe 972h- signal recognition particle receptor alpha subunit Srp101 NP_596660.1 3993457 D 284812 CDS SPBC3B9.04 19113453 2540448 3995638..3996384 1 NC_003423.3 mitochondrial methyltransferase (predicted) 3996384 2540448 SPBC3B9.04 Schizosaccharomyces pombe 972h- mitochondrial methyltransferase (predicted) NP_596661.1 3995638 D 284812 CDS SPBC3B9.21 19113454 2541033 join(3996671..3996805,3997067..3997315) 1 NC_003423.3 mRNA decapping complex subunit Dcp1 3997315 dcp1 2541033 dcp1 Schizosaccharomyces pombe 972h- mRNA decapping complex subunit Dcp1 NP_596662.1 3996671 D 284812 CDS SPBC3B9.05 19113455 2540485 join(3997671..3997675,3997819..3998019,3998116..3998260) 1 NC_003423.3 helper of TIM (predicted) 3998260 2540485 SPBC3B9.05 Schizosaccharomyces pombe 972h- helper of TIM (predicted) NP_596663.1 3997671 D 284812 CDS SPBC3B9.06c 19113456 2541025 complement(join(3998786..3999393,3999439..3999553,3999595..3999699)) 1 NC_003423.3 autophagy associated protein Apg3 (predicted) 3999699 apg3 2541025 apg3 Schizosaccharomyces pombe 972h- autophagy associated protein Apg3 (predicted) NP_596664.1 3998786 R 284812 CDS SPBC3B9.07c 19113457 2540989 complement(join(4000537..4000591,4000658..4000856,4000963..4001230)) 1 NC_003423.3 DNA-directed RNA polymerase I complex subunit Rpa43 4001230 rpa43 2540989 rpa43 Schizosaccharomyces pombe 972h- DNA-directed RNA polymerase I complex subunit Rpa43 NP_596665.1 4000537 R 284812 CDS SPBC3B9.08c 19113458 2540522 complement(join(4001878..4002024,4002094..4002181,4002224..4002287,4002339..4002392,4002465..4002491,4002544..4002581,4002628..4002653)) 1 NC_003423.3 non-consensus gc donor; Mago-nashi homolog 4002653 2540522 SPBC3B9.08c Schizosaccharomyces pombe 972h- Mago-nashi homolog NP_596666.1 4001878 R 284812 CDS SPBC3B9.09 19113459 2540981 4003312..4004715 1 NC_003423.3 possible additional N-terminal exon; RBZ zinc finger protein Vps36 4004715 vps36 2540981 vps36 Schizosaccharomyces pombe 972h- RBZ zinc finger protein Vps36 NP_596667.1 4003312 D 284812 CDS SPBC3B9.10 19113460 2540970 join(4004957..4004982,4005020..4005125,4005172..4005282,4005388..4005639,4005804..4005865,4005941..4006028) 1 NC_003423.3 SNARE Vti1 4006028 vti1 2540970 vti1 Schizosaccharomyces pombe 972h- SNARE Vti1 NP_596668.1 4004957 D 284812 CDS SPBC3B9.22c 162312309 5802828 complement(join(4006057..4006170,4006230..4006334)) 1 NC_003423.3 DASH complex subunit Dad4 4006334 dad4 5802828 dad4 Schizosaccharomyces pombe 972h- DASH complex subunit Dad4 XP_001713149.1 4006057 R 284812 CDS SPBC3B9.11c 19113461 2541018 complement(join(4006857..4006967,4007005..4007954,4007997..4008027)) 1 NC_003423.3 mRNA cleavage and polyadenylation specificity factor complex subunit Ctf1 4008027 ctf1 2541018 ctf1 Schizosaccharomyces pombe 972h- mRNA cleavage and polyadenylation specificity factor complex subunit Ctf1 NP_596669.1 4006857 R 284812 CDS SPBC3B9.12 19113462 2540976 join(4008184..4008302,4008508..4008787) 1 NC_003423.3 TRAPP complex subunit Trs23 (predicted) 4008787 2540976 SPBC3B9.12 Schizosaccharomyces pombe 972h- TRAPP complex subunit Trs23 (predicted) NP_596670.1 4008184 D 284812 CDS SPBC3B9.13c 19113463 2540299 complement(join(4008796..4008819,4008937..4009176,4009316..4009384)) 1 NC_003423.3 60S acidic ribosomal protein Rpp1-2 4009384 rpp102 2540299 rpp102 Schizosaccharomyces pombe 972h- 60S acidic ribosomal protein Rpp1-2 NP_596671.1 4008796 R 284812 CDS SPBC3B9.14c 19113464 2541040 complement(join(4009482..4009637,4009909..4010169,4010209..4010772)) 1 NC_003423.3 mitochondrial ribosomal protein subunit L3 4010772 mrpl3 2541040 mrpl3 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit L3 NP_596672.1 4009482 R 284812 CDS SPBC3B9.15c 19113465 2541065 complement(join(4011458..4013789,4013847..4014775)) 1 NC_003423.3 Sre1 cleavage activating protein Scp1 4014775 scp1 2541065 scp1 Schizosaccharomyces pombe 972h- Sre1 cleavage activating protein Scp1 NP_596673.1 4011458 R 284812 CDS SPBC3B9.16c 19113466 2540505 complement(4015357..4018767) 1 NC_003423.3 nucleoporin Nup120 4018767 nup120 2540505 nup120 Schizosaccharomyces pombe 972h- nucleoporin Nup120 NP_596674.1 4015357 R 284812 CDS SPBC3B9.17 19113467 2540984 join(4020309..4020754,4020824..4020995) 1 NC_003423.3 iron-sulfur protein Isa2 4020995 isa2 2540984 isa2 Schizosaccharomyces pombe 972h- iron-sulfur protein Isa2 NP_596675.1 4020309 D 284812 CDS SPBC3B9.18c 19113468 2540982 complement(join(4021202..4021428,4021487..4021622)) 1 NC_003423.3 V-type ATPase subunit F (predicted) 4021622 vma7 2540982 vma7 Schizosaccharomyces pombe 972h- V-type ATPase subunit F (predicted) NP_596676.1 4021202 R 284812 CDS SPBC3B9.19 19113469 2541039 4022547..4023218 1 NC_003423.3 mitochondrial GrpE domain chaperone protein 4023218 mge1 2541039 mge1 Schizosaccharomyces pombe 972h- mitochondrial GrpE domain chaperone protein NP_596677.1 4022547 D 284812 CDS SPBC215.01 162312311 2540535 4024572..4027076 1 NC_003423.3 GTPase activating protein (predicted) 4027076 2540535 SPBC215.01 Schizosaccharomyces pombe 972h- GTPase activating protein (predicted) NP_596678.2 4024572 D 284812 CDS SPBC215.02 19113471 2540664 join(4027418..4027604,4027659..4027768,4027812..4027917,4027983..4028044) 1 NC_003423.3 prefoldin subunit 5 (predicted) 4028044 bob1 2540664 bob1 Schizosaccharomyces pombe 972h- prefoldin subunit 5 (predicted) NP_596679.1 4027418 D 284812 CDS SPBC215.03c 19113472 2540352 complement(join(4028117..4028305,4028347..4029090,4029165..4029439,4029499..4029559)) 1 NC_003423.3 N-terminal exon possibly incorrect; COP9/signalosome complex subunit Csn1 4029559 csn1 2540352 csn1 Schizosaccharomyces pombe 972h- COP9/signalosome complex subunit Csn1 NP_596680.1 4028117 R 284812 CDS SPBC215.04 19113473 2540666 join(4030555..4030610,4030700..4030862) 1 NC_003423.3 glucose insensitive transcription; term=related to S. cerevisiae YJR086W but not functional ortholog; date=19700101; heterotrimeric G protein gamma subunit Git11 4030862 git11 2540666 git11 Schizosaccharomyces pombe 972h- heterotrimeric G protein gamma subunit Git11 NP_596681.1 4030555 D 284812 CDS SPBC215.05 19113474 2540455 4035814..4036971 1 NC_003423.3 glycerol-3-phosphate dehydrogenase Gpd1 4036971 gpd1 2540455 gpd1 Schizosaccharomyces pombe 972h- glycerol-3-phosphate dehydrogenase Gpd1 NP_596682.1 4035814 D 284812 CDS SPBC215.06c 19113475 2540743 complement(4038119..4038655) 1 NC_003423.3 human LYHRT homolog 4038655 2540743 SPBC215.06c Schizosaccharomyces pombe 972h- human LYHRT homolog NP_596683.1 4038119 R 284812 CDS SPBC215.07c 19113476 2540653 complement(4039416..4041122) 1 NC_003423.3 PWWP domain protein 4041122 2540653 SPBC215.07c Schizosaccharomyces pombe 972h- PWWP domain protein NP_596684.1 4039416 R 284812 CDS SPBC215.08c 19113477 2540729 complement(4041736..4045218) 1 NC_003423.3 arginine specific carbamoyl-phosphate synthase Arg4 (predicted) 4045218 arg4 2540729 arg4 Schizosaccharomyces pombe 972h- arginine specific carbamoyl-phosphate synthase Arg4 (predicted) NP_596685.1 4041736 R 284812 CDS SPBC215.09c 19113478 2540616 complement(join(4045979..4047155,4047216..4047226)) 1 NC_003423.3 acetyl-CoA C-acetyltransferase Erg10 (predicted) 4047226 erg10 2540616 erg10 Schizosaccharomyces pombe 972h- acetyl-CoA C-acetyltransferase Erg10 (predicted) NP_596686.1 4045979 R 284812 CDS SPBC215.10 19113479 2540671 4049179..4050087 1 NC_003423.3 haloacid dehalogenase-like hydrolase 4050087 2540671 SPBC215.10 Schizosaccharomyces pombe 972h- haloacid dehalogenase-like hydrolase NP_596687.1 4049179 D 284812 CDS SPBC215.11c 19113480 2540698 complement(4050462..4051382) 1 NC_003423.3 aldo/keto reductase, unknown biological role 4051382 2540698 SPBC215.11c Schizosaccharomyces pombe 972h- aldo/keto reductase, unknown biological role NP_596688.1 4050462 R 284812 CDS SPBC215.12 19113481 2540711 join(4052604..4052626,4052671..4053030,4053069..4053420,4053480..4055696) 1 NC_003423.3 GTPase Cwf10 (predicted) 4055696 cwf10 2540711 cwf10 Schizosaccharomyces pombe 972h- GTPase Cwf10 (predicted) NP_596689.1 4052604 D 284812 CDS SPBC215.13 19113482 2540669 4056168..4057772 1 NC_003423.3 sequence orphan 4057772 2540669 SPBC215.13 Schizosaccharomyces pombe 972h- sequence orphan NP_596690.1 4056168 D 284812 CDS SPBC215.14c 19113483 2540725 complement(4058394..4059074) 1 NC_003423.3 vacuolar sorting protein Vps20 4059074 vps20 2540725 vps20 Schizosaccharomyces pombe 972h- vacuolar sorting protein Vps20 NP_596691.1 4058394 R 284812 CDS SPBC215.15 19113484 2540716 join(4060033..4060068,4060145..4061002) 1 NC_003423.3 COPII-coated vesicle component Sec13 4061002 sec13 2540716 sec13 Schizosaccharomyces pombe 972h- COPII-coated vesicle component Sec13 NP_596692.1 4060033 D 284812 CDS SPBC1347.01c 162312313 2539723 complement(4061351..4064158) 1 NC_003423.3 deoxycytidyl transferase Rev1 (predicted) 4064158 rev1 2539723 rev1 Schizosaccharomyces pombe 972h- deoxycytidyl transferase Rev1 (predicted) NP_596693.2 4061351 R 284812 CDS SPBC1347.02 19113486 2539812 4064557..4065642 1 NC_003423.3 FKBP-type peptidyl-prolyl cis-trans isomerase (predicted) 4065642 fkbp39 2539812 fkbp39 Schizosaccharomyces pombe 972h- FKBP-type peptidyl-prolyl cis-trans isomerase (predicted) NP_596694.1 4064557 D 284812 CDS SPBC1347.03 19113487 2539892 join(4066294..4066375,4066417..4067342) 1 NC_003423.3 possibly a protein kinase inhibitor as related to S. cerevisiae LSP1 and PIL1; sporulation protein Meu14 4067342 meu14 2539892 meu14 Schizosaccharomyces pombe 972h- sporulation protein Meu14 NP_596695.1 4066294 D 284812 CDS SPBC1347.04 19113488 2540096 4068030..4069073 1 NC_003423.3 TIM22 inner membrane protein import complex subunit Tim54 4069073 tim54 2540096 tim54 Schizosaccharomyces pombe 972h- TIM22 inner membrane protein import complex subunit Tim54 NP_596696.1 4068030 D 284812 CDS SPBC1347.05c 63054805 2540021 complement(join(4069285..4069334,4069390..4070366,4070422..4070540)) 1 NC_003423.3 new C-terminal exon 11 Oct 2002; DNAJ domain protein Scj1 4070540 2540021 SPBC1347.05c Schizosaccharomyces pombe 972h- DNAJ domain protein Scj1 NP_596697.2 4069285 R 284812 CDS SPBC1347.06c 19113490 2539610 complement(join(4071711..4072925,4073009..4073134)) 1 NC_003423.3 serine/threonine protein kinase Cki1 4073134 cki1 2539610 cki1 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Cki1 NP_596698.1 4071711 R 284812 CDS SPBC1347.07 19113491 2539853 join(4073912..4073951,4074033..4074118,4074238..4074303,4074366..4074716) 1 NC_003423.3 RNA exonuclease 4074716 rex2 2539853 rex2 Schizosaccharomyces pombe 972h- RNA exonuclease NP_596699.1 4073912 D 284812 CDS SPBC1347.08c 19113492 2539891 complement(4074840..4075721) 1 NC_003423.3 orthology predicition, pers comm C. Chahwan; ribonuclease H2 complex subunit 4075721 2539891 SPBC1347.08c Schizosaccharomyces pombe 972h- ribonuclease H2 complex subunit NP_596700.1 4074840 R 284812 CDS SPBC1347.09 19113493 2540005 4077450..4078304 1 NC_003423.3 hexaprenyldihydroxybenzoate methyltransferase 4078304 2540005 SPBC1347.09 Schizosaccharomyces pombe 972h- hexaprenyldihydroxybenzoate methyltransferase NP_596701.1 4077450 D 284812 CDS SPBC1347.10 19113494 2539838 4079439..4081220 1 NC_003423.3 MCM-associated protein Mcm10 4081220 cdc23 2539838 cdc23 Schizosaccharomyces pombe 972h- MCM-associated protein Mcm10 NP_596702.1 4079439 D 284812 CDS SPBC1347.11 19113495 2540136 4082207..4082527 1 NC_003423.3 Stress Responsive Orphan 1 4082527 sro1 2540136 sro1 Schizosaccharomyces pombe 972h- Stress Responsive Orphan 1 NP_596703.1 4082207 D 284812 CDS SPBC1347.14c 162312315 5802830 complement(4082279..4082644) 1 NC_003423.3 dubious 4082644 5802830 SPBC1347.14c Schizosaccharomyces pombe 972h- dubious XP_001713150.1 4082279 R 284812 CDS SPBC1347.12 19113496 2539676 join(4083937..4083953,4083997..4084027,4084097..4084161,4084201..4085227) 1 NC_003423.3 actin-like protein Arp1 (predicted) 4085227 arp1 2539676 arp1 Schizosaccharomyces pombe 972h- actin-like protein Arp1 (predicted) NP_596704.1 4083937 D 284812 CDS SPBC1347.13c 19113497 2539800 complement(join(4085349..4085476,4085520..4085793,4085840..4086055,4086151..4086438)) 1 NC_003423.3 ribose methyltransferase 4086438 2539800 SPBC1347.13c Schizosaccharomyces pombe 972h- ribose methyltransferase NP_596705.1 4085349 R 284812 CDS SPBC56F2.12 162312317 3361354 complement(4086879..4088093) 1 NC_003423.3 acetohydroxyacid reductoisomerase 4088093 ilv5 3361354 ilv5 Schizosaccharomyces pombe 972h- acetohydroxyacid reductoisomerase NP_001018845.2 4086879 R 284812 CDS SPBC56F2.11 19113498 2540848 complement(4089357..4090826) 1 NC_003423.3 homoserine O-acetyltransferase 4090826 met6 2540848 met6 Schizosaccharomyces pombe 972h- homoserine O-acetyltransferase NP_596706.1 4089357 R 284812 CDS SPBC56F2.10c 19113499 2541053 join(4092328..4092384,4092540..4093451) 1 NC_003423.3 dolichyl-phosphate beta-glucosyltransferase Alg5 (predicted) 4093451 alg5 2541053 alg5 Schizosaccharomyces pombe 972h- dolichyl-phosphate beta-glucosyltransferase Alg5 (predicted) NP_596707.1 4092328 D 284812 CDS SPBC56F2.09c 19113500 2541060 4094648..4095895 1 NC_003423.3 arginine specific carbamoyl-phosphate synthase subunit Arg5 (predicted) 4095895 arg5 2541060 arg5 Schizosaccharomyces pombe 972h- arginine specific carbamoyl-phosphate synthase subunit Arg5 (predicted) NP_596708.1 4094648 D 284812 CDS SPBC56F2.08c 19113501 2540913 4096945..4098930 1 NC_003423.3 RNA-binding protein 4098930 2540913 SPBC56F2.08c Schizosaccharomyces pombe 972h- RNA-binding protein NP_596709.1 4096945 D 284812 CDS SPBC56F2.07c 19113502 2540537 4100581..4103010 1 NC_003423.3 NAS from PMID:17646390, not yet annotated at SGD; ribosome biogenesis factor recycling AAA family ATPase 4103010 2540537 SPBC56F2.07c Schizosaccharomyces pombe 972h- ribosome biogenesis factor recycling AAA family ATPase NP_596710.1 4100581 D 284812 CDS SPBC56F2.06 19113503 2540663 complement(4104214..4105449) 1 NC_003423.3 sequence orphan 4105449 mug147 2540663 mug147 Schizosaccharomyces pombe 972h- sequence orphan NP_596711.1 4104214 R 284812 CDS SPBC56F2.05c 19113504 2540955 4111501..4112694 1 NC_003423.3 transcription factor (predicted) 4112694 2540955 SPBC56F2.05c Schizosaccharomyces pombe 972h- transcription factor (predicted) NP_596712.1 4111501 D 284812 CDS SPBC56F2.04 19113505 2540842 complement(join(4113062..4120417,4120502..4120588,4120654..4120692)) 1 NC_003423.3 U3 snoRNP protein Utp20 4120692 utp20 2540842 utp20 Schizosaccharomyces pombe 972h- U3 snoRNP protein Utp20 NP_596713.1 4113062 R 284812 CDS SPBC56F2.03 19113506 2540863 complement(4121486..4122628) 1 NC_003423.3 actin-like protein Arp10 (predicted) 4122628 2540863 SPBC56F2.03 Schizosaccharomyces pombe 972h- actin-like protein Arp10 (predicted) NP_596714.1 4121486 R 284812 CDS SPBC56F2.02 19113507 2540870 complement(4123139..4123720) 1 NC_003423.3 60S ribosomal protein L19 4123720 rpl1901 2540870 rpl1901 Schizosaccharomyces pombe 972h- 60S ribosomal protein L19 NP_596715.1 4123139 R 284812 CDS SPBC56F2.01 19113508 2540914 complement(join(4124173..4125348,4125435..4125581)) 1 NC_003423.3 F-box protein Pof12 4125581 pof12 2540914 pof12 Schizosaccharomyces pombe 972h- F-box protein Pof12 NP_596716.1 4124173 R 284812 CDS SPBC56F2.14 68013146 3361356 join(4125883..4126072,4126146..4126258) 1 NC_003423.3 added 20.03.2004, found by targeting ortholog of MRP144 TBLASTN; 100 aa but spliced so missed initially; mitochondrial ribosomal protein subunit l44 4126258 mrpl44 3361356 mrpl44 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit l44 NP_001018846.1 4125883 D 284812 CDS SPBC1861.01c 162312319 2539620 complement(join(4126370..4126488,4126569..4127996,4128104..4128411,4128492..4128568)) 1 NC_003423.3 CENP-C 4128568 cnp3 2539620 cnp3 Schizosaccharomyces pombe 972h- CENP-C XP_001713151.1 4126370 R 284812 CDS SPBC1861.02 19113511 2539827 4131702..4133285 1 NC_003423.3 ARS binding protein Abp2 4133285 abp2 2539827 abp2 Schizosaccharomyces pombe 972h- ARS binding protein Abp2 NP_596719.1 4131702 D 284812 CDS SPBC1861.03 19113512 2539689 join(4133719..4135413,4135459..4135890) 1 NC_003423.3 NatC N-acetyltransferase complex subunit Mak10 (predicted) 4135890 mak10 2539689 mak10 Schizosaccharomyces pombe 972h- NatC N-acetyltransferase complex subunit Mak10 (predicted) NP_596720.1 4133719 D 284812 CDS SPBC1861.04c 19113513 2539617 complement(join(4135981..4138527,4138586..4138851,4138976..4139207)) 1 NC_003423.3 RNA-binding protein Prp24 4139207 2539617 SPBC1861.04c Schizosaccharomyces pombe 972h- RNA-binding protein Prp24 NP_596721.1 4135981 R 284812 CDS SPBC1861.05 19113514 2539763 4140551..4142794 1 NC_003423.3 carbohydrate kinase 4142794 2539763 SPBC1861.05 Schizosaccharomyces pombe 972h- carbohydrate kinase NP_596722.1 4140551 D 284812 CDS SPBC1861.06c 19113515 2539708 complement(4142843..4144144) 1 NC_003423.3 S. pombe specific UPF0300 family protein 4 4144144 mug131 2539708 mug131 Schizosaccharomyces pombe 972h- S. pombe specific UPF0300 family protein 4 NP_596723.1 4142843 R 284812 CDS SPBC1861.07 19113516 2539714 join(4144684..4144789,4144830..4144878,4144922..4145055,4145094..4145098) 1 NC_003423.3 elongin C 4145098 2539714 SPBC1861.07 Schizosaccharomyces pombe 972h- elongin C NP_596724.1 4144684 D 284812 CDS SPBC1861.08c 19113517 2539730 complement(join(4145289..4145929,4145985..4146063)) 1 NC_003423.3 splice donor sequence is incorrect (not GT) homology shows that position of intron is correct but cosmid sequence has good coverage in this region. This region will be checked by sequencing PCR products primed from genomic DNA; U2 snRNP-associated protein Lea1 (predicted) 4146063 2539730 SPBC1861.08c Schizosaccharomyces pombe 972h- U2 snRNP-associated protein Lea1 (predicted) NP_596725.1 4145289 R 284812 CDS SPBC1861.09 19113518 2540803 4147656..4149236 1 NC_003423.3 serine/threonine protein kinase Ppk22 (predicted) 4149236 ppk22 2540803 ppk22 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Ppk22 (predicted) NP_596726.1 4147656 D 284812 CDS SPBC14F5.01 162312321 2539849 4149764..4150600 1 NC_003423.3 sequence orphan 4150600 2539849 SPBC14F5.01 Schizosaccharomyces pombe 972h- sequence orphan NP_596727.2 4149764 D 284812 CDS SPBC14F5.02 19113520 2539755 join(4151559..4151676,4151718..4151963,4152010..4153193) 1 NC_003423.3 sequence orphan 4153193 2539755 SPBC14F5.02 Schizosaccharomyces pombe 972h- sequence orphan NP_596728.1 4151559 D 284812 CDS SPBC14F5.03c 19113521 2539863 complement(4153391..4156594) 1 NC_003423.3 karyopherin Kap123 4156594 kap123 2539863 kap123 Schizosaccharomyces pombe 972h- karyopherin Kap123 NP_596729.1 4153391 R 284812 CDS SPBC14F5.04c 19113522 2539764 complement(4158172..4159416) 1 NC_003423.3 phosphoglycerate kinase Pgk1 (predicted) 4159416 pgk1 2539764 pgk1 Schizosaccharomyces pombe 972h- phosphoglycerate kinase Pgk1 (predicted) NP_596730.1 4158172 R 284812 CDS SPBC14F5.05c 19113523 2539943 complement(4162528..4163676) 1 NC_003423.3 S-adenosylmethionine synthetase 4163676 sam1 2539943 sam1 Schizosaccharomyces pombe 972h- S-adenosylmethionine synthetase NP_596731.1 4162528 R 284812 CDS SPBC14F5.06 19113524 2539753 join(4164659..4164715,4165153..4166877) 1 NC_003423.3 iron-sulfur protein 4166877 2539753 SPBC14F5.06 Schizosaccharomyces pombe 972h- iron-sulfur protein NP_596732.1 4164659 D 284812 CDS SPBC14F5.07 19113525 2539855 join(4167588..4167661,4167716..4167754,4167820..4167893,4167944..4171485) 1 NC_003423.3 Added the human name because the yeast name Ssm4 is already used in S. pombe; ER-localized ubiquitin ligase Doa10 (predicted) 4171485 doa10 2539855 doa10 Schizosaccharomyces pombe 972h- ER-localized ubiquitin ligase Doa10 (predicted) NP_596733.1 4167588 D 284812 CDS SPBC14F5.08 19113526 2539773 join(4172642..4172887,4172954..4173838) 1 NC_003423.3 mediator complex subunit Med7 4173838 med7 2539773 med7 Schizosaccharomyces pombe 972h- mediator complex subunit Med7 NP_596734.1 4172642 D 284812 CDS SPBC14F5.09c 19113527 2539985 complement(4173999..4175447) 1 NC_003423.3 adenylosuccinate lyase Ade8 4175447 ade8 2539985 ade8 Schizosaccharomyces pombe 972h- adenylosuccinate lyase Ade8 NP_596735.1 4173999 R 284812 CDS SPBC14F5.10c 19113528 2539750 complement(4176252..4177712) 1 NC_003423.3 ubiquitin-protein ligase E3 (predicted) 4177712 2539750 SPBC14F5.10c Schizosaccharomyces pombe 972h- ubiquitin-protein ligase E3 (predicted) NP_596736.1 4176252 R 284812 CDS SPBC14F5.11c 19113529 2539722 complement(join(4178610..4180082,4180201..4180488)) 1 NC_003423.3 sorting nexin Snx41 4180488 mug186 2539722 mug186 Schizosaccharomyces pombe 972h- sorting nexin Snx41 NP_596737.1 4178610 R 284812 CDS SPBC14F5.12c 19113530 2539728 complement(4180866..4182410) 1 NC_003423.3 CENP-B homolog Cbh2 4182410 cbh2 2539728 cbh2 Schizosaccharomyces pombe 972h- CENP-B homolog Cbh2 NP_596738.1 4180866 R 284812 CDS SPBC14F5.13c 19113531 2539926 complement(join(4182792..4184185,4184320..4184524)) 1 NC_003423.3 alkaline phosphatase (predicted) 4184524 2539926 SPBC14F5.13c Schizosaccharomyces pombe 972h- alkaline phosphatase (predicted) NP_596739.1 4182792 R 284812 CDS SPBC3F6.01c 19113532 2541004 complement(4185473..4186894) 1 NC_003423.3 serine/threonine protein phosphatase (predicted) 4186894 2541004 SPBC3F6.01c Schizosaccharomyces pombe 972h- serine/threonine protein phosphatase (predicted) NP_596740.1 4185473 R 284812 CDS SPBC3F6.02c 19113533 2540634 complement(4187707..4188729) 1 NC_003423.3 3 beta-hydroxysteroid dehydrogenase/delta 5-->4-isomerase (predicted) 4188729 2540634 SPBC3F6.02c Schizosaccharomyces pombe 972h- 3 beta-hydroxysteroid dehydrogenase/delta 5-->4-isomerase (predicted) NP_596741.1 4187707 R 284812 CDS SPBC3F6.03 68013174 3361358 join(4189967,4190267..4191234) 1 NC_003423.3 thioredoxin reductase Trr1 4191234 trr1 3361358 trr1 Schizosaccharomyces pombe 972h- thioredoxin reductase Trr1 NP_001018848.1 4189967 D 284812 CDS SPBC3F6.04c 19113534 2540674 complement(join(4191623..4193956,4194008..4194157)) 1 NC_003423.3 U3 snoRNP protein Nop14 (predicted) 4194157 2540674 SPBC3F6.04c Schizosaccharomyces pombe 972h- U3 snoRNP protein Nop14 (predicted) NP_596742.1 4191623 R 284812 CDS SPBC3F6.05 19113535 2541022 4196295..4199747 1 NC_003423.3 Rho-type GTPase activating protein Rga1 4199747 rga1 2541022 rga1 Schizosaccharomyces pombe 972h- Rho-type GTPase activating protein Rga1 NP_596743.1 4196295 D 284812 CDS SPBC342.01c 19113536 2540993 complement(join(4200076..4200276,4200335..4200458,4200507..4201702)) 1 NC_003423.3 initially annotated as hypothetical protein but no Met or homology in adjoining cosmid; glucosyltransferase Alg6 4201702 alg6 2540993 alg6 Schizosaccharomyces pombe 972h- glucosyltransferase Alg6 NP_596744.1 4200076 R 284812 CDS SPBC342.02 19113537 2540978 4203417..4205852 1 NC_003423.3 cytoplasmic glutaminyl-tRNA ligase Qrs1 (predicted) 4205852 qrs1 2540978 qrs1 Schizosaccharomyces pombe 972h- cytoplasmic glutaminyl-tRNA ligase Qrs1 (predicted) NP_596745.1 4203417 D 284812 CDS SPBC342.03 19113538 2540920 4206247..4207617 1 NC_003423.3 sporulation specific 1,3-beta-glucanosyltransferase Gas4 4207617 gas4 2540920 gas4 Schizosaccharomyces pombe 972h- sporulation specific 1,3-beta-glucanosyltransferase Gas4 NP_596746.1 4206247 D 284812 CDS SPBC342.04 19113539 2540980 join(4208298..4208377,4208418..4208499,4208566..4209279) 1 NC_003423.3 adhesion regulating molecule protein homolog 4209279 2540980 SPBC342.04 Schizosaccharomyces pombe 972h- adhesion regulating molecule protein homolog NP_596747.1 4208298 D 284812 CDS SPBC342.05 19113540 2540992 4211087..4213423 1 NC_003423.3 DNA repair protein RAD9 homolog, Rhp9 4213423 crb2 2540992 crb2 Schizosaccharomyces pombe 972h- DNA repair protein RAD9 homolog, Rhp9 NP_596748.1 4211087 D 284812 CDS SPBC342.06c 19113541 2540945 complement(4213640..4214749) 1 NC_003423.3 this may have broader species conservation which has not yet been detected; RTT109 family histone lysine acetyltransferase 4214749 rtt109 2540945 rtt109 Schizosaccharomyces pombe 972h- RTT109 family histone lysine acetyltransferase NP_596749.1 4213640 R 284812 CDS SPBC16G5.01 63054811 2540025 join(4215006..4215156,4215208..4215869) 1 NC_003423.3 19S proteasome regulatory subunit Rpn12 4215869 rpn12 2540025 rpn12 Schizosaccharomyces pombe 972h- 19S proteasome regulatory subunit Rpn12 NP_596750.2 4215006 D 284812 CDS SPBC16G5.02c 19113543 2539822 complement(4216147..4217103) 1 NC_003423.3 ribokinase (predicted) 4217103 2539822 SPBC16G5.02c Schizosaccharomyces pombe 972h- ribokinase (predicted) NP_596751.1 4216147 R 284812 CDS SPBC16G5.03 19113544 2539998 4218674..4219480 1 NC_003423.3 ubiquitin-protein ligase E3 (predicted) 4219480 2539998 SPBC16G5.03 Schizosaccharomyces pombe 972h- ubiquitin-protein ligase E3 (predicted) NP_596752.1 4218674 D 284812 CDS SPBC16G5.04 19113545 2540088 join(4219903..4219923,4219966..4220418) 1 NC_003423.3 mitochondrial ribosomal protein subunit L13 4220418 mrpl23 2540088 mrpl23 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit L13 NP_596753.1 4219903 D 284812 CDS SPBC16G5.05c 19113546 2540009 complement(join(4220945..4221906,4222177..4222366)) 1 NC_003423.3 MSP domain 4222366 2540009 SPBC16G5.05c Schizosaccharomyces pombe 972h- MSP domain NP_596754.1 4220945 R 284812 CDS SPBC16G5.06 19113547 2540182 4223177..4223869 1 NC_003423.3 sequence orphan 4223869 2540182 SPBC16G5.06 Schizosaccharomyces pombe 972h- sequence orphan NP_596755.1 4223177 D 284812 CDS SPBC16G5.07c 19113548 2539877 complement(join(4224140..4224410,4224453..4225031,4225128..4225342)) 1 NC_003423.3 prohibitin (predicted) 4225342 2539877 SPBC16G5.07c Schizosaccharomyces pombe 972h- prohibitin (predicted) NP_596756.1 4224140 R 284812 CDS SPBC16G5.08 19113549 2540065 4227286..4228350 1 NC_003423.3 assignment made from mapping data; phosphoribosylanthranilate transferase Trp4 4228350 trp4 2540065 trp4 Schizosaccharomyces pombe 972h- phosphoribosylanthranilate transferase Trp4 NP_596757.1 4227286 D 284812 CDS SPBC16G5.09 19113550 2540202 join(4228817..4229044,4229112..4229810,4229858..4230463) 1 NC_003423.3 serine carboxypeptidase (predicted) 4230463 2540202 SPBC16G5.09 Schizosaccharomyces pombe 972h- serine carboxypeptidase (predicted) NP_596758.1 4228817 D 284812 CDS SPBC16G5.10 19113551 2540116 join(4231953..4232200,4232298..4232949) 1 NC_003423.3 exosome subunit Rrp42 (predicted) 4232949 2540116 SPBC16G5.10 Schizosaccharomyces pombe 972h- exosome subunit Rrp42 (predicted) NP_596759.1 4231953 D 284812 CDS SPBC16G5.11c 19113552 2539843 complement(4233197..4233784) 1 NC_003423.3 budding yeast presumed ortholog YIL016W does not have N-terminal ubiquitin domain; BAG family molecular chaperone regulator Bag101 4233784 bag101 2539843 bag101 Schizosaccharomyces pombe 972h- BAG family molecular chaperone regulator Bag101 NP_596760.1 4233197 R 284812 CDS SPBC16G5.12c 19113553 2539881 complement(join(4233935..4233979,4234081..4234816,4234864..4235000,4235051..4235543,4235633..4236009,4236057..4236137)) 1 NC_003423.3 DNA topoisomerase III 4236137 top3 2539881 top3 Schizosaccharomyces pombe 972h- DNA topoisomerase III NP_596761.1 4233935 R 284812 CDS SPBC16G5.13 19113554 2539706 4237222..4237602 1 NC_003423.3 was previously annotated as dubious; sequence orphan 4237602 2539706 SPBC16G5.13 Schizosaccharomyces pombe 972h- sequence orphan NP_596762.1 4237222 D 284812 CDS SPBC16G5.14c 19113555 2539797 complement(join(4238325..4239038,4239291..4239326)) 1 NC_003423.3 40S ribosomal protein S3 4239326 rps3 2539797 rps3 Schizosaccharomyces pombe 972h- 40S ribosomal protein S3 NP_596763.1 4238325 R 284812 CDS SPBC16G5.15c 19113556 2539703 complement(join(4240442..4241858,4242151..4242662)) 1 NC_003423.3 fork head transcription factor Fkh2 4242662 fkh2 2539703 fkh2 Schizosaccharomyces pombe 972h- fork head transcription factor Fkh2 NP_596764.1 4240442 R 284812 CDS SPBC16G5.16 19113557 2539631 join(4244000..4244089,4244360..4244390,4244498..4246860) 1 NC_003423.3 transcription factor, zf-fungal binuclear cluster type (predicted) 4246860 2539631 SPBC16G5.16 Schizosaccharomyces pombe 972h- transcription factor, zf-fungal binuclear cluster type (predicted) NP_596765.1 4244000 D 284812 CDS SPBC16G5.17 19113558 2539906 4247818..4249500 1 NC_003423.3 transcription factor, zf-fungal binuclear cluster type (predicted) 4249500 2539906 SPBC16G5.17 Schizosaccharomyces pombe 972h- transcription factor, zf-fungal binuclear cluster type (predicted) NP_596766.1 4247818 D 284812 CDS SPBC16G5.18 19113559 2540113 4250067..4251341 1 NC_003423.3 C-14 sterol reductase Erg24 4251341 erg24 2540113 erg24 Schizosaccharomyces pombe 972h- C-14 sterol reductase Erg24 NP_596767.1 4250067 D 284812 CDS SPBC16G5.19 19113560 2540062 4251907..4252224 1 NC_003423.3 was previously annotated as dubious; sequence orphan 4252224 2540062 SPBC16G5.19 Schizosaccharomyces pombe 972h- sequence orphan NP_596768.1 4251907 D 284812 CDS SPBC1652.01 162312323 3361360 4253280..4254440 1 NC_003423.3 ribosomal RNA processing element (RRPE)-binding protein (predicted) 4254440 3361360 SPBC1652.01 Schizosaccharomyces pombe 972h- ribosomal RNA processing element (RRPE)-binding protein (predicted) NP_001019056.2 4253280 D 284812 CDS SPBC1652.02 162312325 2540163 4256509..4258293 1 NC_003423.3 APC amino acid transporter 4258293 aap1 2540163 aap1 Schizosaccharomyces pombe 972h- APC amino acid transporter NP_596769.2 4256509 D 284812 CDS SPBC16A3.19 19113562 2539989 complement(join(4260349..4260876,4260939..4261072,4261163..4261319)) 1 NC_003423.3 histone acetyltransferase complex subunit Eaf7 4261319 eaf7 2539989 eaf7 Schizosaccharomyces pombe 972h- histone acetyltransferase complex subunit Eaf7 NP_596770.1 4260349 R 284812 CDS SPBC16A3.18 19113563 2539823 complement(4262473..4263945) 1 NC_003423.3 Csx1-interacting protein 1; RNA-binding protein Cip1 4263945 cip1 2539823 cip1 Schizosaccharomyces pombe 972h- RNA-binding protein Cip1 NP_596771.1 4262473 R 284812 CDS SPBC16A3.17c 19113564 2539979 4265559..4267358 1 NC_003423.3 membrane transporter 4267358 2539979 SPBC16A3.17c Schizosaccharomyces pombe 972h- membrane transporter NP_596772.1 4265559 D 284812 CDS SPBC16A3.16 19113565 2539684 complement(join(4267784..4267870,4267920..4268090)) 1 NC_003423.3 was previusly annotated as cwc27 in error; mitochondrial inner membrane protein involved in cytochrome c oxidase assembly Pet191 (predicted) 4268090 2539684 SPBC16A3.16 Schizosaccharomyces pombe 972h- mitochondrial inner membrane protein involved in cytochrome c oxidase assembly Pet191 (predicted) NP_596773.1 4267784 R 284812 CDS SPBC16A3.15c 19113566 2539864 join(4268991..4269045,4269136..4270448) 1 NC_003423.3 tubulin alpha 1 4270448 nda2 2539864 nda2 Schizosaccharomyces pombe 972h- tubulin alpha 1 NP_596774.1 4268991 D 284812 CDS SPBC16A3.14 295442901 2539915 complement(4271131..4271937) 1 NC_003423.3 mitochondrial ribosomal protein subunit S26 4271937 2539915 SPBC16A3.14 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit S26 NP_596775.2 4271131 R 284812 CDS SPBC16A3.13 19113568 2539749 complement(4272341..4274665) 1 NC_003423.3 260 residue sequence containing 9 1/2 highly similar repeats; large repeat insertion potential glycosylation sites; alpha-amylase homolog Aah4 4274665 meu7 2539749 meu7 Schizosaccharomyces pombe 972h- alpha-amylase homolog Aah4 NP_596776.1 4272341 R 284812 CDS SPBC16A3.12c 19113569 2539875 join(4275257..4275288,4275339..4275762,4275915..4276302,4276350..4276699,4276751..4276888) 1 NC_003423.3 triglyceride lipase-cholesterol esterase (predicted) 4276888 2539875 SPBC16A3.12c Schizosaccharomyces pombe 972h- triglyceride lipase-cholesterol esterase (predicted) NP_596777.1 4275257 D 284812 CDS SPBC16A3.11 19113570 2539666 complement(4276973..4279591) 1 NC_003423.3 sister chromatid cohesion protein/DNA polymerase eta Eso1 4279591 eso1 2539666 eso1 Schizosaccharomyces pombe 972h- sister chromatid cohesion protein/DNA polymerase eta Eso1 NP_596778.1 4276973 R 284812 CDS SPBC16A3.10 19113571 2539940 complement(4279996..4281525) 1 NC_003423.3 membrane bound O-acyltransferase, MBOAT (predicted) 4281525 2539940 SPBC16A3.10 Schizosaccharomyces pombe 972h- membrane bound O-acyltransferase, MBOAT (predicted) NP_596779.1 4279996 R 284812 CDS SPBC16A3.09c 19113572 2539623 join(4282154..4282156,4282204..4282372,4282553..4282585,4282642..4282763,4282812..4283513) 1 NC_003423.3 ubiquitin fusion degradation protein-1 (predicted); Cdc48-Ufd1-Npl4 complex component Ufd1 (predicted) 4283513 ufd1 2539623 ufd1 Schizosaccharomyces pombe 972h- Cdc48-Ufd1-Npl4 complex component Ufd1 (predicted) NP_596780.1 4282154 D 284812 CDS SPBC16A3.08c 19113573 2539743 join(4283938..4283955,4284224..4284597,4284660..4285122) 1 NC_003423.3 serpine1 related protein (predicted) 4285122 2539743 SPBC16A3.08c Schizosaccharomyces pombe 972h- serpine1 related protein (predicted) NP_596781.1 4283938 D 284812 CDS SPBC16A3.07c 19113574 2539737 4286042..4287070 1 NC_003423.3 negative regulator of MBF 4287070 nrm1 2539737 nrm1 Schizosaccharomyces pombe 972h- negative regulator of MBF NP_596782.1 4286042 D 284812 CDS SPBC16A3.06 19113575 2540035 complement(join(4287361..4288228,4288287..4288376,4288419..4288433,4288475..4288668)) 1 NC_003423.3 tRNA specific adenosine deaminase (predicted) 4288668 2540035 SPBC16A3.06 Schizosaccharomyces pombe 972h- tRNA specific adenosine deaminase (predicted) NP_596783.1 4287361 R 284812 CDS SPBC16A3.05c 19113576 2539741 join(4288945..4289016,4289067..4289143,4289563..4290472) 1 NC_003423.3 RNA export factor Rae1 4290472 rae1 2539741 rae1 Schizosaccharomyces pombe 972h- RNA export factor Rae1 NP_596784.1 4288945 D 284812 CDS SPBC16A3.04 19113577 2539878 complement(4291026..4291688) 1 NC_003423.3 mitochondrial ribosomal protein subunit Rsm25 4291688 rsm25 2539878 rsm25 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit Rsm25 NP_596785.1 4291026 R 284812 CDS SPBC16A3.03c 19113578 2539934 4293597..4295573 1 NC_003423.3 Late cYtokiNesis 1; sequence orphan 4295573 lyn1 2539934 lyn1 Schizosaccharomyces pombe 972h- sequence orphan NP_596786.1 4293597 D 284812 CDS SPBC16A3.02c 19113579 2540039 4297584..4298627 1 NC_003423.3 mitochondrial peptidase (predicted) 4298627 2540039 SPBC16A3.02c Schizosaccharomyces pombe 972h- mitochondrial peptidase (predicted) NP_596787.1 4297584 D 284812 CDS SPBC16A3.01 162312327 2540029 complement(join(4299042..4299794,4299858..4300036,4300263..4300569)) 1 NC_003423.3 septin Spn3 4300569 spn3 2540029 spn3 Schizosaccharomyces pombe 972h- septin Spn3 XP_001713152.1 4299042 R 284812 CDS SPBC543.02c 19113582 2541066 complement(4301185..4302615) 1 NC_003423.3 DNAJ/TPR domain protein DNAJC7 family 4302615 2541066 SPBC543.02c Schizosaccharomyces pombe 972h- DNAJ/TPR domain protein DNAJC7 family NP_596790.1 4301185 R 284812 CDS SPBC543.03c 19113583 2541045 complement(join(4303141..4304977,4305018..4305084,4305140..4305194,4305239..4305367)) 1 NC_003423.3 Ku domain protein Pku80 4305367 pku80 2541045 pku80 Schizosaccharomyces pombe 972h- Ku domain protein Pku80 NP_596791.1 4303141 R 284812 CDS SPBC543.04 19113584 2541073 join(4306029..4307092,4307158..4307851) 1 NC_003423.3 UPF0171 family protein 4307851 2541073 SPBC543.04 Schizosaccharomyces pombe 972h- UPF0171 family protein NP_596792.1 4306029 D 284812 CDS SPBC543.05c 19113585 2540261 complement(join(4308056..4308379,4308433..4308777,4308816..4309251,4309309..4309608,4309676..4309824)) 1 NC_003423.3 inorganic anion exchanger (predicted) 4309824 2540261 SPBC543.05c Schizosaccharomyces pombe 972h- inorganic anion exchanger (predicted) NP_596793.1 4308056 R 284812 CDS SPBC543.06c 19113586 2541069 complement(join(4310239..4311346,4311436..4311559,4311627..4311756)) 1 NC_003423.3 ATP-dependent RNA helicase Dbp8 (predicted) 4311756 dbp8 2541069 dbp8 Schizosaccharomyces pombe 972h- ATP-dependent RNA helicase Dbp8 (predicted) NP_596794.1 4310239 R 284812 CDS SPBC543.07 19113587 2540919 4312763..4313854 1 NC_003423.3 MAP kinase kinase Pek1 4313854 pek1 2540919 pek1 Schizosaccharomyces pombe 972h- MAP kinase kinase Pek1 NP_596795.1 4312763 D 284812 CDS SPBC543.08 19113588 2540872 4314488..4315240 1 NC_003423.3 phosphoinositide biosynthesis protein (predicted) 4315240 2540872 SPBC543.08 Schizosaccharomyces pombe 972h- phosphoinositide biosynthesis protein (predicted) NP_596796.1 4314488 D 284812 CDS SPBC543.09 19113589 2541079 4316288..4318609 1 NC_003423.3 mitochondrial m-AAA protease 4318609 2541079 SPBC543.09 Schizosaccharomyces pombe 972h- mitochondrial m-AAA protease NP_596797.1 4316288 D 284812 CDS SPBC543.10 19113590 2540893 join(4318947..4319033,4319082..4319448,4319542..4319603) 1 NC_003423.3 GET complex subunit Get1 (predicted) 4319603 get1 2540893 get1 Schizosaccharomyces pombe 972h- GET complex subunit Get1 (predicted) NP_596798.1 4318947 D 284812 CDS SPBC16C6.01c 162312329 2540125 complement(4320120..4321541) 1 NC_003423.3 lysine methyltransferase (predicted) 4321541 2540125 SPBC16C6.01c Schizosaccharomyces pombe 972h- lysine methyltransferase (predicted) NP_596799.2 4320120 R 284812 CDS SPBC16C6.14 295442903 9407224 complement(4322221..4322622) 1 NC_003423.3 gene created from C-tem of SPBC16C6.02c; Spo2 is recruited to the SPB during meiosis and assists in the localization of Spo13 to the outer surface of the SPB; sporulation specific protein Spo2 4322622 spo2 9407224 spo2 Schizosaccharomyces pombe 972h- sporulation specific protein Spo2 XP_002788944.1 4322221 R 284812 CDS SPBC16C6.02c 295442905 2540138 complement(join(4322829..4331555,4331641..4331793,4331856..4331968,4332007..4332028)) 1 NC_003423.3 chorein homolog 4332028 vps1302 2540138 vps1302 Schizosaccharomyces pombe 972h- chorein homolog NP_596800.2 4322829 R 284812 CDS SPBC16C6.03c 295442907 2539890 complement(4332698..4333123) 1 NC_003423.3 ribosome assembly protein (predicted) 4333123 2539890 SPBC16C6.03c Schizosaccharomyces pombe 972h- ribosome assembly protein (predicted) NP_596801.2 4332698 R 284812 CDS SPBC16C6.04 19113594 2539754 4334150..4335202 1 NC_003423.3 sequence orphan 4335202 2539754 SPBC16C6.04 Schizosaccharomyces pombe 972h- sequence orphan NP_596802.1 4334150 D 284812 CDS SPBC16C6.05 19113595 2540154 join(4335619..4335687,4335741..4336244) 1 NC_003423.3 mitochondrial translation initiation factor (predicted) 4336244 2540154 SPBC16C6.05 Schizosaccharomyces pombe 972h- mitochondrial translation initiation factor (predicted) NP_596803.1 4335619 D 284812 CDS SPBC16C6.06 19113596 2539861 join(4337012..4337185,4337226..4341452) 1 NC_003423.3 sorting receptor for CPY 4341452 pep1 2539861 pep1 Schizosaccharomyces pombe 972h- sorting receptor for CPY NP_596804.1 4337012 D 284812 CDS SPBC16C6.07c 19113597 2539862 complement(join(4341801..4342921,4343117..4343198,4343255..4343368)) 1 NC_003423.3 19S proteasome regulatory subunit Rpt1 (predicted) 4343368 rpt1 2539862 rpt1 Schizosaccharomyces pombe 972h- 19S proteasome regulatory subunit Rpt1 (predicted) NP_596805.1 4341801 R 284812 CDS SPBC16C6.08c 19113598 2540140 complement(join(4344557..4344735,4344783..4344971,4345028..4345099,4345226..4345430)) 1 NC_003423.3 ubiquinol-cytochrome-c reductase complex subunit 8 4345430 qcr6 2540140 qcr6 Schizosaccharomyces pombe 972h- ubiquinol-cytochrome-c reductase complex subunit 8 NP_596806.1 4344557 R 284812 CDS SPBC16C6.09 19113599 2539761 4346652..4348988 1 NC_003423.3 O-glycoside mannosyltransferase 4; protein O-mannosyltransferase Ogm4 4348988 ogm4 2539761 ogm4 Schizosaccharomyces pombe 972h- protein O-mannosyltransferase Ogm4 NP_596807.1 4346652 D 284812 CDS SPBC16C6.10 19113600 2540047 join(4349995..4350558,4350596..4351174) 1 NC_003423.3 chromodomain protein 2 4351174 chp2 2540047 chp2 Schizosaccharomyces pombe 972h- chromodomain protein 2 NP_596808.1 4349995 D 284812 CDS SPBC16C6.11 19113601 2540135 4351896..4352279 1 NC_003423.3 60S ribosomal protein L32 4352279 rpl3201 2540135 rpl3201 Schizosaccharomyces pombe 972h- 60S ribosomal protein L32 NP_596809.1 4351896 D 284812 CDS SPBC16C6.12c 19113602 2540034 complement(4352663..4354075) 1 NC_003423.3 Las1-like protein 4354075 2540034 SPBC16C6.12c Schizosaccharomyces pombe 972h- Las1-like protein NP_596810.1 4352663 R 284812 CDS SPBC16C6.13c 162312331 2540050 complement(join(4354568..4356937,4357000..4357020)) 1 NC_003423.3 coatomer beta' subunit (predicted) 4357020 sec27 2540050 sec27 Schizosaccharomyces pombe 972h- coatomer beta' subunit (predicted) XP_001713153.1 4354568 R 284812 CDS SPBC244.02c 19113605 2540651 4357993..4359459 1 NC_003423.3 U3 snoRNP-associated protein Utp6 (predicted) 4359459 2540651 SPBC244.02c Schizosaccharomyces pombe 972h- U3 snoRNP-associated protein Utp6 (predicted) NP_596813.1 4357993 D 284812 CDS SPBC244.01c 19113606 2540650 join(4360640..4360754,4360975..4362842) 1 NC_003423.3 Septum Initiation Defective; SIN component scaffold protein Sid4 4362842 sid4 2540650 sid4 Schizosaccharomyces pombe 972h- SIN component scaffold protein Sid4 NP_596814.1 4360640 D 284812 CDS SPBC1539.01c 19113607 2539929 complement(4363050..4363682) 1 NC_003423.3 mitochondrial ribosomal protein subunit L15 4363682 2539929 SPBC1539.01c Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit L15 NP_596815.1 4363050 R 284812 CDS SPBC1539.02 19113608 2539927 4364016..4365176 1 NC_003423.3 conserved eukaryotic nuclear protein implicated in meiotic chromosome segregation 4365176 2539927 SPBC1539.02 Schizosaccharomyces pombe 972h- conserved eukaryotic nuclear protein implicated in meiotic chromosome segregation NP_596816.1 4364016 D 284812 CDS SPBC1539.03c 19113609 2539950 complement(4365385..4366767) 1 NC_003423.3 argininosuccinate lyase 4366767 2539950 SPBC1539.03c Schizosaccharomyces pombe 972h- argininosuccinate lyase NP_596817.1 4365385 R 284812 CDS SPBC1539.04 19113610 2539923 join(4368389..4368448,4368635..4369414) 1 NC_003423.3 conserved eukaryotic protein 4369414 2539923 SPBC1539.04 Schizosaccharomyces pombe 972h- conserved eukaryotic protein NP_596818.1 4368389 D 284812 CDS SPBC1539.05 19113611 2539758 join(4370000..4370068,4370111..4370512,4370563..4370733,4370774..4370911,4370967..4371197,4371241..4371777,4371819..4372478) 1 NC_003423.3 Golgi transport complex subunit Cog3 (predicted) 4372478 cog3 2539758 cog3 Schizosaccharomyces pombe 972h- Golgi transport complex subunit Cog3 (predicted) NP_596819.1 4370000 D 284812 CDS SPBC1539.06 19113612 2539982 join(4372917..4372994,4373052..4373237) 1 NC_003423.3 acyl-coenzyme A binding protein (predicted) 4373237 2539982 SPBC1539.06 Schizosaccharomyces pombe 972h- acyl-coenzyme A binding protein (predicted) NP_596820.1 4372917 D 284812 CDS SPBC1539.07c 19113613 2540073 complement(join(4373675..4374734,4374842..4374885,4375043..4375075)) 1 NC_003423.3 glutathione-dependent formaldehyde dehydrogenase (predicted) 4375075 2540073 SPBC1539.07c Schizosaccharomyces pombe 972h- glutathione-dependent formaldehyde dehydrogenase (predicted) NP_596821.1 4373675 R 284812 CDS SPBC1539.08 19113614 2539937 join(4375857..4375962,4376062..4376092,4376295..4376367,4376423..4376621,4376665..4376810) 1 NC_003423.3 ADP-ribosylation factor, Arf family Arf6 4376810 arf6 2539937 arf6 Schizosaccharomyces pombe 972h- ADP-ribosylation factor, Arf family Arf6 NP_596822.1 4375857 D 284812 CDS SPBC1539.09c 19113615 2539973 complement(4377221..4379500) 1 NC_003423.3 anthranilate synthase component II (predicted) 4379500 trp1 2539973 trp1 Schizosaccharomyces pombe 972h- anthranilate synthase component II (predicted) NP_596823.1 4377221 R 284812 CDS SPBC1539.10 19113616 2539893 join(4380486..4380631,4380754..4381237) 1 NC_003423.3 ribosome biogenesis protein Nop16 (predicted) 4381237 nop16 2539893 nop16 Schizosaccharomyces pombe 972h- ribosome biogenesis protein Nop16 (predicted) NP_596824.1 4380486 D 284812 CDS SPBC1289.01c 162312333 2539716 complement(4381640..4383541) 1 NC_003423.3 1,3-beta-glucan synthase regulatory factor Chf3/Chr4 4383541 chr4 2539716 chr4 Schizosaccharomyces pombe 972h- 1,3-beta-glucan synthase regulatory factor Chf3/Chr4 NP_596825.2 4381640 R 284812 CDS SPBC1289.02c 19113618 2539783 complement(join(4384281..4384704,4384816..4385387,4385450..4385557)) 1 NC_003423.3 U2 snRNP-associated protein Uap2 4385557 uap2 2539783 uap2 Schizosaccharomyces pombe 972h- U2 snRNP-associated protein Uap2 NP_596826.1 4384281 R 284812 CDS SPBC1289.03c 19113619 2540149 complement(join(4386347..4386684,4386819..4387005,4387191..4387316)) 1 NC_003423.3 Supressor of PIm; Ran GTPase Spi1 4387316 spi1 2540149 spi1 Schizosaccharomyces pombe 972h- Ran GTPase Spi1 NP_596827.1 4386347 R 284812 CDS SPBC1289.04c 19113620 2539992 complement(join(4388343..4390826,4391022..4391153)) 1 NC_003423.3 Boi family protein 4391153 pob1 2539992 pob1 Schizosaccharomyces pombe 972h- Boi family protein NP_596828.1 4388343 R 284812 CDS SPBC1289.05c 19113621 2540172 complement(join(4392091..4392231,4392288..4392388,4392432..4392474,4392522..4392560,4392608..4392610)) 1 NC_003423.3 V-type ATPase subunit G 4392610 vma10 2540172 vma10 Schizosaccharomyces pombe 972h- V-type ATPase subunit G NP_596829.1 4392091 R 284812 CDS SPBC1289.06c 19113622 2539603 complement(join(4393946..4395211,4395257..4395436)) 1 NC_003423.3 sequence orphan 4395436 2539603 SPBC1289.06c Schizosaccharomyces pombe 972h- sequence orphan NP_596830.1 4393946 R 284812 CDS SPBC1289.07c 19113623 2539663 complement(4396053..4397099) 1 NC_003423.3 DNA-directed RNA polymerase I and III subunit Rpc40 (predicted) 4397099 rpc40 2539663 rpc40 Schizosaccharomyces pombe 972h- DNA-directed RNA polymerase I and III subunit Rpc40 (predicted) NP_596831.1 4396053 R 284812 CDS SPBC1289.08 19113624 2540183 4397340..4398767 1 NC_003423.3 UDP-N-acetylglucosamine diphosphorylase Uap1/Qri1(predicted) 4398767 uap1 2540183 uap1 Schizosaccharomyces pombe 972h- UDP-N-acetylglucosamine diphosphorylase Uap1/Qri1(predicted) NP_596832.1 4397340 D 284812 CDS SPBC1289.09 19113625 2539981 4399320..4399991 1 NC_003423.3 Translocase of the Inner Membrane; TIM23 translocase complex subunit Tim21 (predicted) 4399991 tim21 2539981 tim21 Schizosaccharomyces pombe 972h- TIM23 translocase complex subunit Tim21 (predicted) NP_596833.1 4399320 D 284812 CDS SPBC1289.10c 19113626 2540193 complement(4400616..4402847) 1 NC_003423.3 transcription factor (predicted) 4402847 adn2 2540193 adn2 Schizosaccharomyces pombe 972h- transcription factor (predicted) NP_596834.1 4400616 R 284812 CDS SPBC1289.11 19113627 2539984 join(4404561..4404605,4404647..4404751,4404790..4404862,4404912..4405171,4405217..4405460,4405522..4405817) 1 NC_003423.3 splicing factor Spf38 4405817 spf38 2539984 spf38 Schizosaccharomyces pombe 972h- splicing factor Spf38 NP_596835.1 4404561 D 284812 CDS SPBC1289.12 19113628 2540117 4406049..4407107 1 NC_003423.3 U1 snRNP-associated protein Usp109 4407107 usp109 2540117 usp109 Schizosaccharomyces pombe 972h- U1 snRNP-associated protein Usp109 NP_596836.1 4406049 D 284812 CDS SPBC1289.13c 19113629 2540001 complement(4408061..4409188) 1 NC_003423.3 alpha-1,2-galactosyltransferase (predicted) 4409188 2540001 SPBC1289.13c Schizosaccharomyces pombe 972h- alpha-1,2-galactosyltransferase (predicted) NP_596837.1 4408061 R 284812 CDS SPBC1289.14 19113630 2539990 4412376..4413350 1 NC_003423.3 adducin 4413350 2539990 SPBC1289.14 Schizosaccharomyces pombe 972h- adducin NP_596838.1 4412376 D 284812 CDS SPBC1289.17 19113631 2540036 4414657..4418658 1 NC_003423.3 retrotransposable element 4418658 Tf2-11 2540036 Tf2-11 Schizosaccharomyces pombe 972h- retrotransposable element NP_596839.1 4414657 D 284812 CDS SPBC1289.15 19113632 2540145 4421413..4425264 1 NC_003423.3 26 copies of a 35 amino acid repeat; cell surface glycoprotein (predicted) 4425264 2540145 SPBC1289.15 Schizosaccharomyces pombe 972h- cell surface glycoprotein (predicted) NP_596840.1 4421413 D 284812 CDS SPBC1289.16c 162312335 2539624 complement(4426235..4428619) 1 NC_003423.3 no amine oxidase activity detected when expressed in S. cerevisiae PMID:16946276; copper amine oxidase-like protein Cao2 4428619 cao2 2539624 cao2 Schizosaccharomyces pombe 972h- copper amine oxidase-like protein Cao2 NP_596841.2 4426235 R 284812 CDS SPBC8E4.05c 19113634 2541238 4430190..4431533 1 NC_003423.3 fumarate lyase superfamily 4431533 2541238 SPBC8E4.05c Schizosaccharomyces pombe 972h- fumarate lyase superfamily NP_596842.1 4430190 D 284812 CDS SPBC8E4.04 19113635 2541256 complement(4432418..4433395) 1 NC_003423.3 aldo/keto reductase involved in pentose catabolism (predicted) 4433395 2541256 SPBC8E4.04 Schizosaccharomyces pombe 972h- aldo/keto reductase involved in pentose catabolism (predicted) NP_596843.1 4432418 R 284812 CDS SPBC8E4.03 19113636 2541279 complement(4434367..4435608) 1 NC_003423.3 NAS from Biocyc pathway hole filling; agmatinase 2 (predicted) 4435608 2541279 SPBC8E4.03 Schizosaccharomyces pombe 972h- agmatinase 2 (predicted) NP_596844.1 4434367 R 284812 CDS SPBC8E4.12c 295442909 9407219 complement(4441340..4441609) 1 NC_003423.3 extender of the chronological lifespan protein Ecl3 4441609 ecl3 9407219 ecl3 Schizosaccharomyces pombe 972h- extender of the chronological lifespan protein Ecl3 XP_002788945.1 4441340 R 284812 CDS SPBC8E4.02c 19113637 2541246 4443155..4443544 1 NC_003423.3 sequence orphan 4443544 2541246 SPBC8E4.02c Schizosaccharomyces pombe 972h- sequence orphan NP_596845.1 4443155 D 284812 CDS SPBC8E4.01c 162312337 2541258 4444252..4445970 1 NC_003423.3 inorganic phosphate transporter (predicted) 4445970 2541258 SPBC8E4.01c Schizosaccharomyces pombe 972h- inorganic phosphate transporter (predicted) NP_596846.2 4444252 D 284812 CDS SPBP4G3.02 19113639 2541339 4447557..4448918 1 NC_003423.3 acid phosphatase Pho1 4448918 pho1 2541339 pho1 Schizosaccharomyces pombe 972h- acid phosphatase Pho1 NP_596847.1 4447557 D 284812 CDS SPBP4G3.03 19113640 2541335 4453078..4453803 1 NC_003423.3 PI31 proteasome regulator related 4453803 2541335 SPBP4G3.03 Schizosaccharomyces pombe 972h- PI31 proteasome regulator related NP_596848.1 4453078 D 284812 CDS SPBPB2B2.01 19113641 2541403 4458010..4459767 1 NC_003423.3 amino acid permease, unknown 12 4459767 2541403 SPBPB2B2.01 Schizosaccharomyces pombe 972h- amino acid permease, unknown 12 NP_596849.1 4458010 D 284812 CDS SPBPB2B2.02 19113642 2541394 4460559..4461704 1 NC_003423.3 esterase/lipase (predicted) 4461704 mug180 2541394 mug180 Schizosaccharomyces pombe 972h- esterase/lipase (predicted) NP_596850.1 4460559 D 284812 CDS SPBPB2B2.05 19113643 2541359 join(4466723..4466725,4466805..4467515) 1 NC_003423.3 peptidase family C26 protein 4467515 2541359 SPBPB2B2.05 Schizosaccharomyces pombe 972h- peptidase family C26 protein NP_596851.1 4466723 D 284812 CDS SPBPB2B2.06c 19113644 2541387 complement(4469200..4471005) 1 NC_003423.3 phosphoprotein phosphatase (predicted) 4471005 2541387 SPBPB2B2.06c Schizosaccharomyces pombe 972h- phosphoprotein phosphatase (predicted) NP_596852.1 4469200 R 284812 CDS SPBPB2B2.07c 295442911 2541406 complement(join(4474145..4474403,4474438..4474931)) 1 NC_003423.3 altered coordinates based on Solexa transcript SPNG2000, added exon 4474145..4474403; S. pombe specific DUF999 protein family 7 4474931 2541406 SPBPB2B2.07c Schizosaccharomyces pombe 972h- S. pombe specific DUF999 protein family 7 NP_596853.2 4474145 R 284812 CDS SPBPB2B2.08 19113646 2541397 4476012..4476674 1 NC_003423.3 conserved fungal protein 4476674 2541397 SPBPB2B2.08 Schizosaccharomyces pombe 972h- conserved fungal protein NP_596854.1 4476012 D 284812 CDS SPBPB2B2.09c 19113647 2541389 complement(4479110..4480162) 1 NC_003423.3 2-dehydropantoate 2-reductase (predicted) 4480162 2541389 SPBPB2B2.09c Schizosaccharomyces pombe 972h- 2-dehydropantoate 2-reductase (predicted) NP_596855.1 4479110 R 284812 CDS SPBPB2B2.10c 19113648 2541407 complement(4482569..4483678) 1 NC_003423.3 galactose-1-phosphate uridylyltransferase (predicted) 4483678 2541407 SPBPB2B2.10c Schizosaccharomyces pombe 972h- galactose-1-phosphate uridylyltransferase (predicted) NP_596856.1 4482569 R 284812 CDS SPBPB2B2.11 19113649 2541398 4484059..4485156 1 NC_003423.3 appears to be part of a galactose metabolism cluster; nucleotide-sugar 4,6-dehydratase (predicted) 4485156 2541398 SPBPB2B2.11 Schizosaccharomyces pombe 972h- nucleotide-sugar 4,6-dehydratase (predicted) NP_596857.1 4484059 D 284812 CDS SPBPB2B2.12c 19113650 2541411 complement(4485277..4487418) 1 NC_003423.3 UDP-glucose 4-epimerase 4487418 2541411 SPBPB2B2.12c Schizosaccharomyces pombe 972h- UDP-glucose 4-epimerase NP_596858.1 4485277 R 284812 CDS SPBPB2B2.13 19113651 2541380 4488491..4490050 1 NC_003423.3 galactokinase Gal1 (predicted) 4490050 2541380 SPBPB2B2.13 Schizosaccharomyces pombe 972h- galactokinase Gal1 (predicted) NP_596859.1 4488491 D 284812 CDS SPBPB2B2.14c 19113652 2541408 complement(join(4492580..4492854,4492905..4493322)) 1 NC_003423.3 S. pombe specific DUF999 protein family 8 4493322 2541408 SPBPB2B2.14c Schizosaccharomyces pombe 972h- S. pombe specific DUF999 protein family 8 NP_596860.1 4492580 R 284812 CDS SPBPB2B2.15 19113653 2541415 4496373..4496984 1 NC_003423.3 conserved fungal family 4496984 2541415 SPBPB2B2.15 Schizosaccharomyces pombe 972h- conserved fungal family NP_596861.1 4496373 D 284812 CDS SPBPB2B2.16c 19113654 2541400 complement(4497937..4499394) 1 NC_003423.3 MFS family membrane transporter (predicted) 4499394 2541400 SPBPB2B2.16c Schizosaccharomyces pombe 972h- MFS family membrane transporter (predicted) NP_596862.1 4497937 R 284812 CDS SPBPB2B2.17c 19113655 2541410 complement(4501956..4502396) 1 NC_003423.3 dubious 4502396 2541410 SPBPB2B2.17c Schizosaccharomyces pombe 972h- dubious NP_596863.1 4501956 R 284812 CDS SPBPB2B2.18 295442913 2541404 join(4502692..4502725,4502787..4502857,4503068..4503286,4503527..4503664) 1 NC_003423.3 There is a region which is duplicated in PB2B2 which is represented by the ORF SPBPB2B2.18 although the similarity is not very high...the predicition looks odd. The exon structure is not typical. There is also a region which is duplicated at the DNA level in c750 which is not incorporated into the prediction.; sequence orphan 4503664 2541404 SPBPB2B2.18 Schizosaccharomyces pombe 972h- sequence orphan NP_596864.2 4502692 D 284812 CDS SPBPB2B2.19c 19113657 2541343 complement(4503910..4504944) 1 NC_003423.3 S. pombe specific 5Tm protein family 4504944 2541343 SPBPB2B2.19c Schizosaccharomyces pombe 972h- S. pombe specific 5Tm protein family NP_596865.1 4503910 R 284812 CDS SPBCPT2R1.01c 162312339 2541416 complement(join(4506606..4506925,4506984..4507473)) 1 NC_003423.3 S. pombe specific DUF999 protein family 9 4507473 2541416 SPBCPT2R1.01c Schizosaccharomyces pombe 972h- S. pombe specific DUF999 protein family 9 XP_001713154.1 4506606 R 284812 CDS SPBCPT2R1.02 162312341 5802836 4508450..4508809 1 NC_003423.3 sequence orphan 4508809 5802836 SPBCPT2R1.02 Schizosaccharomyces pombe 972h- sequence orphan XP_001713155.1 4508450 D 284812 CDS SPBCPT2R1.03 162312343 5802837 4512231..4512620 1 NC_003423.3 hypothetical protein 4512620 5802837 SPBCPT2R1.03 Schizosaccharomyces pombe 972h- hypothetical protein XP_001713156.1 4512231 D 284812 CDS SPBCPT2R1.04c 162312345 5802838 complement(join(4513701..4514053,4514112..4514601)) 1 NC_003423.3 S. pombe specific DUF999 protein family 10 4514601 5802838 SPBCPT2R1.04c Schizosaccharomyces pombe 972h- S. pombe specific DUF999 protein family 10 XP_001713157.1 4513701 R 284812 CDS SPBCPT2R1.08c 162312347 5802845 4526885..4532644 1 NC_003423.3 RecQ type DNA helicase Tlh1 4532644 tlh2 5802845 tlh2 Schizosaccharomyces pombe 972h- RecQ type DNA helicase Tlh1 XP_001713158.1 4526885 D 284812 CDS SPAC212.11 19115952 2541932 complement(<1..5662) 1 NC_003424.3 RecQ type DNA helicase 5662 tlh1 2541932 tlh1 Schizosaccharomyces pombe 972h- RecQ type DNA helicase NP_595040.1 <1 R 284812 CDS SPAC212.08c 19115951 2542009 12158..12994 1 NC_003424.3 GPI anchored protein (predicted) 12994 2542009 SPAC212.08c Schizosaccharomyces pombe 972h- GPI anchored protein (predicted) NP_595039.1 12158 D 284812 CDS SPAC212.04c 19115950 2541911 join(21587..22076,22132..22508) 1 NC_003424.3 repeat expansion SQRSQRS; S. pombe specific DUF999 family protein 1 22508 2541911 SPAC212.04c Schizosaccharomyces pombe 972h- S. pombe specific DUF999 family protein 1 NP_595038.1 21587 D 284812 CDS SPAC212.03 19115949 2542026 complement(23589..23978) 1 NC_003424.3 has transcript profile on microarray; hypothetical protein 23978 2542026 SPAC212.03 Schizosaccharomyces pombe 972h- hypothetical protein NP_595037.1 23589 R 284812 CDS SPAC212.02 19115948 2542050 complement(27353..27763) 1 NC_003424.3 has transcript profile on microarray; sequence orphan 27763 2542050 SPAC212.02 Schizosaccharomyces pombe 972h- sequence orphan NP_595036.1 27353 R 284812 CDS SPAC212.01c 19115947 2542040 join(28738..29227,29286..29638) 1 NC_003424.3 repeat expansion SQRSQRS; S. pombe specific DUF999 family protein 2 29638 2542040 SPAC212.01c Schizosaccharomyces pombe 972h- S. pombe specific DUF999 family protein 2 NP_595035.1 28738 D 284812 CDS SPAC977.01 19113686 2543353 <29764..30716 3 NC_003424.3 S. pombe specific 5Tm protein family 30716 2543353 SPAC977.01 Schizosaccharomyces pombe 972h- S. pombe specific 5Tm protein family NP_592774.1 <29764 D 284812 CDS SPAC977.02 19113687 2543349 32230..32670 1 NC_003424.3 S. pombe specific 5Tm protein family 32670 2543349 SPAC977.02 Schizosaccharomyces pombe 972h- S. pombe specific 5Tm protein family NP_592775.1 32230 D 284812 CDS SPAC977.03 19113688 2543345 33835..34272 1 NC_003424.3 methyltransferase (predicted) 34272 2543345 SPAC977.03 Schizosaccharomyces pombe 972h- methyltransferase (predicted) NP_592776.1 33835 D 284812 CDS SPAC977.05c 19113689 2543096 complement(35768..36382) 1 NC_003424.3 conserved fungal family 36382 2543096 SPAC977.05c Schizosaccharomyces pombe 972h- conserved fungal family NP_592777.1 35768 R 284812 CDS SPAC977.06 19113690 2543115 join(39431..39848,39899..40050) 1 NC_003424.3 S. pombe specific DUF999 family protein 3 40050 2543115 SPAC977.06 Schizosaccharomyces pombe 972h- S. pombe specific DUF999 family protein 3 NP_592778.1 39431 D 284812 CDS SPAC977.07c 19113691 2543047 complement(42057..43307) 1 NC_003424.3 cell surface glycoprotein (predicted) 43307 2543047 SPAC977.07c Schizosaccharomyces pombe 972h- cell surface glycoprotein (predicted) NP_592779.1 42057 R 284812 CDS SPAC977.08 19113692 2543330 44704..45414 1 NC_003424.3 short chain dehydrogenase (predicted) 45414 2543330 SPAC977.08 Schizosaccharomyces pombe 972h- short chain dehydrogenase (predicted) NP_592780.1 44704 D 284812 CDS SPAC977.09c 19113693 2541836 complement(join(46075..46143,46208..48160)) 1 NC_003424.3 phospholipase (predicted) 48160 2541836 SPAC977.09c Schizosaccharomyces pombe 972h- phospholipase (predicted) NP_592781.1 46075 R 284812 CDS SPAC977.10 19113694 2543239 join(52117..52240,52318..53600) 1 NC_003424.3 plasma membrane sodium ion/proton antiporter Sod2 53600 sod2 2543239 sod2 Schizosaccharomyces pombe 972h- plasma membrane sodium ion/proton antiporter Sod2 NP_592782.1 52117 D 284812 CDS SPAC977.11 19113695 2543234 55274..56209 1 NC_003424.3 CRCB domain protein 56209 2543234 SPAC977.11 Schizosaccharomyces pombe 972h- CRCB domain protein NP_592783.1 55274 D 284812 CDS SPAC977.12 19113696 2543314 56492..57562 1 NC_003424.3 L-asparaginase (predicted) 57562 2543314 SPAC977.12 Schizosaccharomyces pombe 972h- L-asparaginase (predicted) NP_592784.1 56492 D 284812 CDS SPAC977.14c 19113697 2543325 complement(59715..60770) 1 NC_003424.3 aldo/keto reductase, unknown biological role 60770 2543325 SPAC977.14c Schizosaccharomyces pombe 972h- aldo/keto reductase, unknown biological role NP_592785.1 59715 R 284812 CDS SPAC977.15 19113698 2543311 62989..63732 1 NC_003424.3 dienelactone hydrolase family 63732 2543311 SPAC977.15 Schizosaccharomyces pombe 972h- dienelactone hydrolase family NP_592786.1 62989 D 284812 CDS SPAC977.16c 19113699 2541810 complement(64904..66679) 1 NC_003424.3 dihydroxyacetone kinase Dak2 66679 dak2 2541810 dak2 Schizosaccharomyces pombe 972h- dihydroxyacetone kinase Dak2 NP_592787.1 64904 R 284812 CDS SPAC977.17 19113700 2543301 67143..68939 1 NC_003424.3 MIP water channel (predicted) 68939 2543301 SPAC977.17 Schizosaccharomyces pombe 972h- MIP water channel (predicted) NP_592788.1 67143 D 284812 CDS SPAPJ695.01c 19113701 2543320 complement(77578..77931) 1 NC_003424.3 possibly not coding, may be a spurious ORF; S. pombe specific UPF0321 family protein 3 77931 2543320 SPAPJ695.01c Schizosaccharomyces pombe 972h- S. pombe specific UPF0321 family protein 3 NP_592789.1 77578 R 284812 CDS SPAC1F8.01 19113702 2541758 82936..84603 1 NC_003424.3 hexose transporter Ght3 84603 ght3 2541758 ght3 Schizosaccharomyces pombe 972h- hexose transporter Ght3 NP_592790.1 82936 D 284812 CDS SPAC1F8.02c 19113703 2541821 complement(85598..86278) 1 NC_003424.3 sequence orphan 86278 2541821 SPAC1F8.02c Schizosaccharomyces pombe 972h- sequence orphan NP_592791.1 85598 R 284812 CDS SPAC1F8.03c 19113704 2541891 complement(88367..90259) 1 NC_003424.3 siderophore-iron transporter Str3 90259 str3 2541891 str3 Schizosaccharomyces pombe 972h- siderophore-iron transporter Str3 NP_592792.1 88367 R 284812 CDS SPAC1F8.04c 19113705 2541820 complement(92480..93871) 1 NC_003424.3 hydrolase (predicted) 93871 2541820 SPAC1F8.04c Schizosaccharomyces pombe 972h- hydrolase (predicted) NP_592793.1 92480 R 284812 CDS SPAC1F8.05 19113706 2541879 96000..96548 1 NC_003424.3 may not be protein coding (strange AA composiition and GC plot); sequence orphan 96548 isp3 2541879 isp3 Schizosaccharomyces pombe 972h- sequence orphan NP_592794.1 96000 D 284812 CDS SPAC1F8.06 19113707 2541854 100011..101168 1 NC_003424.3 Sim4 and Mal2 associated (4 and 2 associated) protein 5, predicted cell surface glycoprotein 101168 fta5 2541854 fta5 Schizosaccharomyces pombe 972h- Sim4 and Mal2 associated (4 and 2 associated) protein 5, predicted cell surface glycoprotein NP_592795.1 100011 D 284812 CDS SPAC1F8.07c 295442915 2541874 complement(join(101836..101872,101872..103544)) 1 NC_003424.3 pyruvate decarboxylase (predicted) 103544 2541874 SPAC1F8.07c Schizosaccharomyces pombe 972h- pyruvate decarboxylase (predicted) NP_592796.2 101836 R 284812 CDS SPAC1F8.08 19113709 2541747 103941..104303 1 NC_003424.3 sequence orphan 104303 2541747 SPAC1F8.08 Schizosaccharomyces pombe 972h- sequence orphan NP_592797.1 103941 D 284812 CDS SPAC11D3.01c 19113710 2542984 complement(108908..109147) 1 NC_003424.3 conserved fungal protein 109147 2542984 SPAC11D3.01c Schizosaccharomyces pombe 972h- conserved fungal protein NP_592798.1 108908 R 284812 CDS SPAC11D3.02c 19113711 2542974 complement(109829..110281) 1 NC_003424.3 ELLA family acetyltransferase (predicted) 110281 2542974 SPAC11D3.02c Schizosaccharomyces pombe 972h- ELLA family acetyltransferase (predicted) NP_592799.1 109829 R 284812 CDS SPAC11D3.03c 19113712 2542947 complement(111005..111913) 1 NC_003424.3 meiotic chromosome segregation protein 111913 2542947 SPAC11D3.03c Schizosaccharomyces pombe 972h- meiotic chromosome segregation protein NP_592800.1 111005 R 284812 CDS SPAC11D3.04c 19113713 2543007 complement(112917..113309) 1 NC_003424.3 has transcript profile on microarray; SnoaL 113309 2543007 SPAC11D3.04c Schizosaccharomyces pombe 972h- SnoaL NP_592801.1 112917 R 284812 CDS SPAC11D3.05 19113714 2542991 114080..115720 1 NC_003424.3 MFS family membrane transporter (predicted) 115720 mfs2 2542991 mfs2 Schizosaccharomyces pombe 972h- MFS family membrane transporter (predicted) NP_592802.1 114080 D 284812 CDS SPAC11D3.06 19113715 2542994 116693..118060 1 NC_003424.3 MatE family transporter (predicted) 118060 2542994 SPAC11D3.06 Schizosaccharomyces pombe 972h- MatE family transporter (predicted) NP_592803.1 116693 D 284812 CDS SPAC11D3.07c 295442917 2541653 complement(118195..120108) 1 NC_003424.3 transcription factor (predicted) 120108 2541653 SPAC11D3.07c Schizosaccharomyces pombe 972h- transcription factor (predicted) NP_592804.2 118195 R 284812 CDS SPAC11D3.08c 19113717 2542911 complement(120556..122208) 1 NC_003424.3 amino acid permease, unknown 1 122208 2542911 SPAC11D3.08c Schizosaccharomyces pombe 972h- amino acid permease, unknown 1 NP_592805.1 120556 R 284812 CDS SPAC11D3.09 19113718 2541568 122845..124029 1 NC_003424.3 agmatinase (predicted) 124029 2541568 SPAC11D3.09 Schizosaccharomyces pombe 972h- agmatinase (predicted) NP_592806.1 122845 D 284812 CDS SPAC11D3.10 19113719 2542999 125582..126886 1 NC_003424.3 nifs homolog 126886 2542999 SPAC11D3.10 Schizosaccharomyces pombe 972h- nifs homolog NP_592807.1 125582 D 284812 CDS SPAC11D3.13 19113720 2542927 130329..130997 1 NC_003424.3 ThiJ domain protein 130997 2542927 SPAC11D3.13 Schizosaccharomyces pombe 972h- ThiJ domain protein NP_592808.1 130329 D 284812 CDS SPAC11D3.14c 19113721 2542986 complement(131319..135101) 1 NC_003424.3 oxoprolinase (predicted) 135101 2542986 SPAC11D3.14c Schizosaccharomyces pombe 972h- oxoprolinase (predicted) NP_592809.1 131319 R 284812 CDS SPAC11D3.15 19113722 2542983 136331..140284 1 NC_003424.3 oxoprolinase (predicted) 140284 2542983 SPAC11D3.15 Schizosaccharomyces pombe 972h- oxoprolinase (predicted) NP_592810.1 136331 D 284812 CDS SPAC11D3.16c 19113723 2542990 complement(140805..141200) 1 NC_003424.3 sequence orphan 141200 2542990 SPAC11D3.16c Schizosaccharomyces pombe 972h- sequence orphan NP_592811.1 140805 R 284812 CDS SPAC11D3.17 19113724 2543006 142675..144432 1 NC_003424.3 zf-C2H2 type zinc finger protein 144432 2543006 SPAC11D3.17 Schizosaccharomyces pombe 972h- zf-C2H2 type zinc finger protein NP_592812.1 142675 D 284812 CDS SPAC11D3.18c 19113725 2543005 complement(144862..146358) 1 NC_003424.3 nicotinic acid plasma membrane transporter (predicted) 146358 2543005 SPAC11D3.18c Schizosaccharomyces pombe 972h- nicotinic acid plasma membrane transporter (predicted) NP_592813.1 144862 R 284812 CDS SPAC5H10.01 19113726 2541830 146974..147879 1 NC_003424.3 annotated to mitochondria based on Pence subcellular location mitochondria 99.938%; DUF1445 family protein 147879 2541830 SPAC5H10.01 Schizosaccharomyces pombe 972h- DUF1445 family protein NP_592814.1 146974 D 284812 CDS SPAC5H10.02c 19113727 2541799 complement(148213..148935) 1 NC_003424.3 ThiJ domain protein 148935 2541799 SPAC5H10.02c Schizosaccharomyces pombe 972h- ThiJ domain protein NP_592815.1 148213 R 284812 CDS SPAC5H10.03 19113728 2541759 151913..152572 1 NC_003424.3 phosphoglycerate mutase family 152572 2541759 SPAC5H10.03 Schizosaccharomyces pombe 972h- phosphoglycerate mutase family NP_592816.1 151913 D 284812 CDS SPAC5H10.04 19113729 2541543 153387..154535 1 NC_003424.3 NADPH dehydrogenase (predicted) 154535 2541543 SPAC5H10.04 Schizosaccharomyces pombe 972h- NADPH dehydrogenase (predicted) NP_592817.1 153387 D 284812 CDS SPAC5H10.05c 19113730 2542621 complement(154807..155397) 1 NC_003424.3 FAD binding oxidoreductase (predicted) 155397 2542621 SPAC5H10.05c Schizosaccharomyces pombe 972h- FAD binding oxidoreductase (predicted) NP_592818.1 154807 R 284812 CDS SPAC5H10.06c 19113731 2542714 complement(156548..157816) 1 NC_003424.3 alcohol dehydrogenase Adh4 157816 adh4 2542714 adh4 Schizosaccharomyces pombe 972h- alcohol dehydrogenase Adh4 NP_592819.1 156548 R 284812 CDS SPAC5H10.07 19113732 2542699 159203..159472 1 NC_003424.3 has EST; sequence orphan 159472 2542699 SPAC5H10.07 Schizosaccharomyces pombe 972h- sequence orphan NP_592820.1 159203 D 284812 CDS SPAC5H10.08c 19113733 2541618 complement(160094..160945) 1 NC_003424.3 possibly coexpressed with SPAC5H10.09c which is also involved in pantothenate biosynthesis; pantoate-beta-alanine ligase 160945 pan6 2541618 pan6 Schizosaccharomyces pombe 972h- pantoate-beta-alanine ligase NP_592821.1 160094 R 284812 CDS SPAC5H10.09c 19113734 2542731 complement(160977..161780) 1 NC_003424.3 possibly coexpressed with SPAC5H10.08c which is also involved in pantothenate biosynthesis; 3-methyl-2-oxobutanoatehydroxymethyltransferase (predicted) 161780 2542731 SPAC5H10.09c Schizosaccharomyces pombe 972h- 3-methyl-2-oxobutanoatehydroxymethyltransferase (predicted) NP_592822.1 160977 R 284812 CDS SPAC5H10.10 19113735 2541553 162960..164138 1 NC_003424.3 NADPH dehydrogenase (predicted) 164138 2541553 SPAC5H10.10 Schizosaccharomyces pombe 972h- NADPH dehydrogenase (predicted) NP_592823.1 162960 D 284812 CDS SPAC5H10.11 19113736 2542018 164728..165717 1 NC_003424.3 alpha-1,2-galactosyltransferase Gmh1 (predicted) 165717 gmh1 2542018 gmh1 Schizosaccharomyces pombe 972h- alpha-1,2-galactosyltransferase Gmh1 (predicted) NP_592824.1 164728 D 284812 CDS SPAC5H10.12c 19113737 2541724 complement(166420..167535) 1 NC_003424.3 acetylglucosaminyltransferase (predicted) 167535 2541724 SPAC5H10.12c Schizosaccharomyces pombe 972h- acetylglucosaminyltransferase (predicted) NP_592825.1 166420 R 284812 CDS SPAC5H10.13c 19113738 2542227 complement(168810..169850) 1 NC_003424.3 alpha-1,2-galactosyltransferase Gmh2 (predicted) 169850 gmh2 2542227 gmh2 Schizosaccharomyces pombe 972h- alpha-1,2-galactosyltransferase Gmh2 (predicted) NP_592826.1 168810 R 284812 CDS SPAC13G6.01c 162312350 3361391 complement(170972..174373) 1 NC_003424.3 ubiquitin-protein ligase E3 (predicted) 174373 rad8 3361391 rad8 Schizosaccharomyces pombe 972h- ubiquitin-protein ligase E3 (predicted) XP_001713034.1 170972 R 284812 CDS SPAC13G6.02c 19113740 2542817 complement(175013..175771) 1 NC_003424.3 40S ribosomal protein S3a 175771 rps101 2542817 rps101 Schizosaccharomyces pombe 972h- 40S ribosomal protein S3a NP_592828.1 175013 R 284812 CDS SPAC13G6.03 19113741 2542835 177292..179568 1 NC_003424.3 GPI anchor biosynthesis protein Gpi7 (predicted) 179568 gpi7 2542835 gpi7 Schizosaccharomyces pombe 972h- GPI anchor biosynthesis protein Gpi7 (predicted) NP_592829.1 177292 D 284812 CDS SPAC13G6.04 295442919 2542819 join(180423..180528,180586..180721,180890..180911) 1 NC_003424.3 TIM22 inner membrane protein import complex subunit Tim8 (predicted) 180911 tim8 2542819 tim8 Schizosaccharomyces pombe 972h- TIM22 inner membrane protein import complex subunit Tim8 (predicted) NP_592830.2 180423 D 284812 CDS SPAC13G6.05c 19113743 2542905 complement(join(181077..181436,181485..181574,181632..181749,182001..182170)) 1 NC_003424.3 TRAPP complex subunit Bet3 (predicted) 182170 2542905 SPAC13G6.05c Schizosaccharomyces pombe 972h- TRAPP complex subunit Bet3 (predicted) NP_592831.1 181077 R 284812 CDS SPAC13G6.06c 19113744 2542828 complement(182976..186029) 1 NC_003424.3 glycine cleavage complex subunit P (predicted) 186029 gcv2 2542828 gcv2 Schizosaccharomyces pombe 972h- glycine cleavage complex subunit P (predicted) NP_592832.1 182976 R 284812 CDS SPAC13G6.07c 19113745 2542870 complement(186844..187563) 1 NC_003424.3 40S ribosomal protein S6 187563 rps601 2542870 rps601 Schizosaccharomyces pombe 972h- 40S ribosomal protein S6 NP_592833.1 186844 R 284812 CDS SPAC13G6.08 19113746 2542840 188377..189984 1 NC_003424.3 Cdc20/Fizzy family WD repeat protein 189984 2542840 SPAC13G6.08 Schizosaccharomyces pombe 972h- Cdc20/Fizzy family WD repeat protein NP_592834.1 188377 D 284812 CDS SPAC13G6.09 19113747 2542826 join(190322..190584,190730..191291) 1 NC_003424.3 programmed cell death protein homolog 191291 2542826 SPAC13G6.09 Schizosaccharomyces pombe 972h- programmed cell death protein homolog NP_592835.1 190322 D 284812 CDS SPAC13G6.10c 19113748 2542895 complement(192296..193888) 1 NC_003424.3 cell wall protein Asl1, O-glucosyl hydrolase (predicted) 193888 asl1 2542895 asl1 Schizosaccharomyces pombe 972h- cell wall protein Asl1, O-glucosyl hydrolase (predicted) NP_592836.1 192296 R 284812 CDS SPAC13G6.11c 19113749 2542818 complement(join(194119..195258,195508..195582)) 1 NC_003424.3 mevalonate kinase Erg12 (predicted) 195582 erg12 2542818 erg12 Schizosaccharomyces pombe 972h- mevalonate kinase Erg12 (predicted) NP_592837.1 194119 R 284812 CDS SPAC13G6.12c 19113750 2542858 complement(join(196090..196174,196221..198715)) 1 NC_003424.3 chitin synthase I 198715 chs1 2542858 chs1 Schizosaccharomyces pombe 972h- chitin synthase I NP_592838.1 196090 R 284812 CDS SPAC13G6.13 19113751 2542859 198884..199231 1 NC_003424.3 was previously annotated as dubious in error; sequence orphan 199231 2542859 SPAC13G6.13 Schizosaccharomyces pombe 972h- sequence orphan NP_592839.1 198884 D 284812 CDS SPAC13G6.14 19113752 2542890 200235..200867 1 NC_003424.3 diadenosine 5',5'''-p1,p6-hexaphosphate hydrolase Aps1 200867 aps1 2542890 aps1 Schizosaccharomyces pombe 972h- diadenosine 5',5'''-p1,p6-hexaphosphate hydrolase Aps1 NP_592840.1 200235 D 284812 CDS SPAC13G6.15c 19113753 2542877 complement(202487..202978) 1 NC_003424.3 calcipressin 202978 2542877 SPAC13G6.15c Schizosaccharomyces pombe 972h- calcipressin NP_592841.1 202487 R 284812 CDS SPAC24B11.05 19113754 2541562 205213..205893 1 NC_003424.3 pyrimidine 5'-nucleotidase (predicted) 205893 2541562 SPAC24B11.05 Schizosaccharomyces pombe 972h- pyrimidine 5'-nucleotidase (predicted) NP_592842.1 205213 D 284812 CDS SPAC24B11.06c 19113755 2541652 complement(206864..207913) 1 NC_003424.3 MAP kinase Sty1 207913 sty1 2541652 sty1 Schizosaccharomyces pombe 972h- MAP kinase Sty1 NP_592843.1 206864 R 284812 CDS SPAC24B11.07c 19113756 2541561 complement(209346..211031) 1 NC_003424.3 ketopantoate reductase (predicted) 211031 2541561 SPAC24B11.07c Schizosaccharomyces pombe 972h- ketopantoate reductase (predicted) NP_592844.1 209346 R 284812 CDS SPAC24B11.08c 19113757 2541538 complement(212034..213206) 1 NC_003424.3 COPII-coated vesicle component Erv46 213206 2541538 SPAC24B11.08c Schizosaccharomyces pombe 972h- COPII-coated vesicle component Erv46 NP_592845.1 212034 R 284812 CDS SPAC24B11.09 19113758 2541475 216483..216839 1 NC_003424.3 human BRP44 ortholog 216839 2541475 SPAC24B11.09 Schizosaccharomyces pombe 972h- human BRP44 ortholog NP_592846.1 216483 D 284812 CDS SPAC24B11.10c 19113759 2541607 complement(218657..221455) 1 NC_003424.3 possibility of splicing at 3' end but extra exon (20311..20497) doesn't improve homology; Chs Four Homologue (pers. comm. Henar Montero); chitin synthase regulatory factor Chr3 (predicted) 221455 chr3 2541607 chr3 Schizosaccharomyces pombe 972h- chitin synthase regulatory factor Chr3 (predicted) NP_592847.1 218657 R 284812 CDS SPAC24B11.11c 19113760 2541599 complement(222029..223852) 1 NC_003424.3 Septum Initiation Defective; Sid2p-Mob1p kinase complex protein kinase subunit Sid2 223852 sid2 2541599 sid2 Schizosaccharomyces pombe 972h- Sid2p-Mob1p kinase complex protein kinase subunit Sid2 NP_592848.1 222029 R 284812 CDS SPAC24B11.12c 19113761 2541560 complement(join(224396..228232,228312..228683)) 1 NC_003424.3 P-type ATPase (predicted) 228683 2541560 SPAC24B11.12c Schizosaccharomyces pombe 972h- P-type ATPase (predicted) NP_592849.1 224396 R 284812 CDS SPAC24B11.14 162312352 2541528 join(230545..230681,230743..230799,230830..231136) 1 NC_003424.3 added 3-9-99; neither intron was detected in transcriptome data, unlikely to be coding; dubious 231136 2541528 SPAC24B11.14 Schizosaccharomyces pombe 972h- dubious XP_001713035.1 230545 D 284812 CDS SPAC24B11.13 67989478 3361383 231655..232665 1 NC_003424.3 hydroxymethylbilane synthase 232665 hem3 3361383 hem3 Schizosaccharomyces pombe 972h- hydroxymethylbilane synthase NP_001018179.1 231655 D 284812 CDS SPAC806.02c 19113764 2542122 complement(join(233231..235053,235103..235106)) 1 NC_003424.3 gene structure confirmed (pers. comm. Ryo Hanai); in S. cerevisiae, both genes are involved in iron sulfur cluster assembly; Par A family ATPase/WD repeat iron cluster assembly fusion protein 235106 2542122 SPAC806.02c Schizosaccharomyces pombe 972h- Par A family ATPase/WD repeat iron cluster assembly fusion protein NP_592852.1 233231 R 284812 CDS SPAC806.03c 19113765 2543085 complement(235653..236015) 1 NC_003424.3 40S ribosomal protein S26 236015 rps2601 2543085 rps2601 Schizosaccharomyces pombe 972h- 40S ribosomal protein S26 NP_592853.1 235653 R 284812 CDS SPAC806.11 162312354 5802854 complement(237212..237430) 1 NC_003424.3 dubious 237430 5802854 SPAC806.11 Schizosaccharomyces pombe 972h- dubious XP_001713036.1 237212 R 284812 CDS SPAC806.04c 19113766 2543077 complement(join(241426..241537,241589..241693,241735..242815,242917..242941)) 1 NC_003424.3 DUF89 family protein 242941 2543077 SPAC806.04c Schizosaccharomyces pombe 972h- DUF89 family protein NP_592854.1 241426 R 284812 CDS SPAC806.05 19113767 2543073 244731..245108 1 NC_003424.3 DUF1763 family protein 245108 2543073 SPAC806.05 Schizosaccharomyces pombe 972h- DUF1763 family protein NP_592855.1 244731 D 284812 CDS SPAC806.06c 19113768 2543055 complement(245304..246401) 1 NC_003424.3 nicotinamide mononucleotide (NMN) adenylyltransferase (predicted) 246401 2543055 SPAC806.06c Schizosaccharomyces pombe 972h- nicotinamide mononucleotide (NMN) adenylyltransferase (predicted) NP_592856.1 245304 R 284812 CDS SPAC806.07 19113769 2543111 247928..248383 1 NC_003424.3 nucleoside diphosphate kinase Ndk1 248383 ndk1 2543111 ndk1 Schizosaccharomyces pombe 972h- nucleoside diphosphate kinase Ndk1 NP_592857.1 247928 D 284812 CDS SPAC806.08c 19113770 2543117 complement(248680..250536) 1 NC_003424.3 gamma tubulin complex subunit Mod21 250536 mod21 2543117 mod21 Schizosaccharomyces pombe 972h- gamma tubulin complex subunit Mod21 NP_592858.1 248680 R 284812 CDS SPAC1639.01c 295442922 2543177 complement(join(251726..251745,251863..252337,252392..252752,253590..253630)) 1 NC_003424.3 GNS1/SUR4 family protein 253630 2543177 SPAC1639.01c Schizosaccharomyces pombe 972h- GNS1/SUR4 family protein NP_592859.2 251726 R 284812 CDS SPAC1639.02c 162312356 3361385 complement(join(256030..256134,256345..256370,256427..256445,256542..256612,256684..256750,256797..257009,257055..257070,257116..257135,257179..257181,257229..258184,258220..259120,259161..259406)) 1 NC_003424.3 potassium ion transporter Trk2 259406 trk2 3361385 trk2 Schizosaccharomyces pombe 972h- potassium ion transporter Trk2 XP_001713037.1 256030 R 284812 CDS SPAC1F5.11c 19113774 2541659 join(259719..259782,259844..270747) 1 NC_003424.3 possibly lacks protein kinase activity; not detected in SAGA (pers. comm. Dom Helmlinger); phosphatidylinositol kinase-related protein Tra2 270747 tra2 2541659 tra2 Schizosaccharomyces pombe 972h- phosphatidylinositol kinase-related protein Tra2 NP_592862.1 259719 D 284812 CDS SPAC1F5.10 19113775 2541602 complement(join(271020..272116,272170..272190,272257..272323)) 1 NC_003424.3 ATP-dependent RNA helicase, eIF4A related (predicted) 272323 2541602 SPAC1F5.10 Schizosaccharomyces pombe 972h- ATP-dependent RNA helicase, eIF4A related (predicted) NP_592863.1 271020 R 284812 CDS SPAC1F5.09c 19113776 2541468 273152..274921 1 NC_003424.3 PAK-related kinase Shk2 274921 shk2 2541468 shk2 Schizosaccharomyces pombe 972h- PAK-related kinase Shk2 NP_592864.1 273152 D 284812 CDS SPAC1F5.08c 19113777 2541627 275089..276549 1 NC_003424.3 calcium channel regulatory subunit Yam8 276549 yam8 2541627 yam8 Schizosaccharomyces pombe 972h- calcium channel regulatory subunit Yam8 NP_592865.1 275089 D 284812 CDS SPAC1F5.07c 19113778 2541631 276893..278365 1 NC_003424.3 protoporphyrinogen oxidase (predicted) 278365 hem14 2541631 hem14 Schizosaccharomyces pombe 972h- protoporphyrinogen oxidase (predicted) NP_592866.1 276893 D 284812 CDS SPAC1F5.06 19113779 2541537 complement(278599..281145) 1 NC_003424.3 heat shock protein Lhs1 (predicted) 281145 2541537 SPAC1F5.06 Schizosaccharomyces pombe 972h- heat shock protein Lhs1 (predicted) NP_592867.1 278599 R 284812 CDS SPAC1F5.05c 19113780 2541432 281949..282404 1 NC_003424.3 has EST; sequence orphan 282404 2541432 SPAC1F5.05c Schizosaccharomyces pombe 972h- sequence orphan NP_592868.1 281949 D 284812 CDS SPAC1F5.04c 19113781 2541603 283476..289001 1 NC_003424.3 formin Cdc12 289001 cdc12 2541603 cdc12 Schizosaccharomyces pombe 972h- formin Cdc12 NP_592869.1 283476 D 284812 CDS SPAC1F5.03c 19113782 2541471 join(289952..289985,290187..291301) 1 NC_003424.3 FAD-dependent oxidoreductase (predicted) 291301 2541471 SPAC1F5.03c Schizosaccharomyces pombe 972h- FAD-dependent oxidoreductase (predicted) NP_592870.1 289952 D 284812 CDS SPAC1F5.02 19113783 2541460 complement(292260..293738) 1 NC_003424.3 protein disulfide isomerase (predicted) 293738 2541460 SPAC1F5.02 Schizosaccharomyces pombe 972h- protein disulfide isomerase (predicted) NP_592871.1 292260 R 284812 CDS SPAC18B11.11 162312358 3361388 complement(294902..298786) 1 NC_003424.3 GTPase activating protein (predicted) 298786 3361388 SPAC18B11.11 Schizosaccharomyces pombe 972h- GTPase activating protein (predicted) XP_001713038.1 294902 R 284812 CDS SPAC18B11.10 19113785 2542299 complement(join(299628..301263,301436..301520,301588..301711)) 1 NC_003424.3 a number of genes are differentially affected by mutations in tup11 and tup 12 in response to cation stress (PMID 156320722); transcriptional corepressor Tup11 301711 tup11 2542299 tup11 Schizosaccharomyces pombe 972h- transcriptional corepressor Tup11 NP_592873.1 299628 R 284812 CDS SPAC18B11.09c 19113786 2542578 join(303161..303231,303334..303640,303716..303793,303852..304019) 1 NC_003424.3 serine O-acetyltransferase activity (predicted) 304019 2542578 SPAC18B11.09c Schizosaccharomyces pombe 972h- serine O-acetyltransferase activity (predicted) NP_592874.1 303161 D 284812 CDS SPAC18B11.08c 19113787 2542581 join(304463..304535,304674..304731,304771..304860,304919..304955,305000..305029) 1 NC_003424.3 conserved fungal protein 305029 2542581 SPAC18B11.08c Schizosaccharomyces pombe 972h- conserved fungal protein NP_592875.1 304463 D 284812 CDS SPAC18B11.07c 19113788 2542622 join(305723..305764,305812..305876,306090..306210,306316..306419,306468..306591) 1 NC_003424.3 Rad6 homolog, ubiquitin conjugating enzyme E2 Rhp6 306591 rhp6 2542622 rhp6 Schizosaccharomyces pombe 972h- Rad6 homolog, ubiquitin conjugating enzyme E2 Rhp6 NP_592876.1 305723 D 284812 CDS SPAC18B11.06 19113789 2542587 complement(306964..307947) 1 NC_003424.3 U3 snoRNP-associated protein Lcp5 (predicted) 307947 2542587 SPAC18B11.06 Schizosaccharomyces pombe 972h- U3 snoRNP-associated protein Lcp5 (predicted) NP_592877.1 306964 R 284812 CDS SPAC18B11.05 19113790 2542588 complement(308381..309661) 1 NC_003424.3 pig-V (predicted) 309661 gpi18 2542588 gpi18 Schizosaccharomyces pombe 972h- pig-V (predicted) NP_592878.1 308381 R 284812 CDS SPAC18B11.04 19113791 2542523 complement(join(310659..310790,310837..311180,311299..311331,311371..311434)) 1 NC_003424.3 related to neuronal calcium sensor Ncs1 311434 ncs1 2542523 ncs1 Schizosaccharomyces pombe 972h- related to neuronal calcium sensor Ncs1 NP_592879.1 310659 R 284812 CDS SPAC18B11.03c 19113792 2542613 312264..313586 1 NC_003424.3 N-acetyltransferase (predicted) 313586 2542613 SPAC18B11.03c Schizosaccharomyces pombe 972h- N-acetyltransferase (predicted) NP_592880.1 312264 D 284812 CDS SPAC18B11.02c 19113793 2542607 314030..315214 1 NC_003424.3 tRNA pseudouridylate synthase (predicted) 315214 2542607 SPAC18B11.02c Schizosaccharomyces pombe 972h- tRNA pseudouridylate synthase (predicted) NP_592881.1 314030 D 284812 CDS SPAC12G12.16c 19113794 2543216 315707..317197 1 NC_003424.3 nuclease, XP-G family 317197 2543216 SPAC12G12.16c Schizosaccharomyces pombe 972h- nuclease, XP-G family NP_592882.1 315707 D 284812 CDS SPAC12G12.15 162312360 2543091 complement(join(317310..317462,317514..318172,318221..318941)) 1 NC_003424.3 GO:0005515 and GO:0005816 pers. comm. Osami Niwa; NAS inferred; Sad1 interacting factor 3 318941 sif3 2543091 sif3 Schizosaccharomyces pombe 972h- Sad1 interacting factor 3 NP_592883.3 317310 R 284812 CDS SPAC12G12.14c 19113796 2543089 319974..321503 1 NC_003424.3 WD repeat protein Pfs2 321503 pfs2 2543089 pfs2 Schizosaccharomyces pombe 972h- WD repeat protein Pfs2 NP_592884.1 319974 D 284812 CDS SPAC12G12.13c 67989518 3361384 321924..323978 1 NC_003424.3 poly(A) polymerase Cid14 323978 cid14 3361384 cid14 Schizosaccharomyces pombe 972h- poly(A) polymerase Cid14 NP_001018181.1 321924 D 284812 CDS SPAC12G12.12 19113798 2542918 complement(join(324194..324407,324462..325166,325225..325280)) 1 NC_003424.3 NST UDP-galactose transporter (predicted) 325280 2542918 SPAC12G12.12 Schizosaccharomyces pombe 972h- NST UDP-galactose transporter (predicted) NP_592886.1 324194 R 284812 CDS SPAC12G12.11c 19113799 2543045 join(326694..326856,326942..327391,327498..327982) 1 NC_003424.3 DUF544 family protein 327982 2543045 SPAC12G12.11c Schizosaccharomyces pombe 972h- DUF544 family protein NP_592887.1 326694 D 284812 CDS SPAC12G12.10 19113800 2541535 complement(328222..329484) 1 NC_003424.3 WD repeat protein, human WDR21 family 329484 2541535 SPAC12G12.10 Schizosaccharomyces pombe 972h- WD repeat protein, human WDR21 family NP_592888.1 328222 R 284812 CDS SPAC12G12.09 19113801 2542958 complement(329810..332743) 1 NC_003424.3 sequence orphan 332743 2542958 SPAC12G12.09 Schizosaccharomyces pombe 972h- sequence orphan NP_592889.1 329810 R 284812 CDS SPAC12G12.17 295442924 9407221 join(333214..333239,333291..333441) 1 NC_003424.3 non-classical export protein 1 333441 9407221 SPAC12G12.17 Schizosaccharomyces pombe 972h- non-classical export protein 1 XP_002742498.1 333214 D 284812 CDS SPAC12G12.08 19113802 2542846 complement(333695..334336) 1 NC_003424.3 mitochondrial ribosomal protein subunit L16 (predicted) 334336 mrpl6 2542846 mrpl6 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit L16 (predicted) NP_592890.1 333695 R 284812 CDS SPAC12G12.07c 19113803 2542964 join(334660..334782,334830..335945) 1 NC_003424.3 conserved fungal protein 335945 2542964 SPAC12G12.07c Schizosaccharomyces pombe 972h- conserved fungal protein NP_592891.1 334660 D 284812 CDS SPAC12G12.06c 19113804 2542936 336428..337519 1 NC_003424.3 RNA 3'-terminal phosphate cyclase (predicted) 337519 2542936 SPAC12G12.06c Schizosaccharomyces pombe 972h- RNA 3'-terminal phosphate cyclase (predicted) NP_592892.1 336428 D 284812 CDS SPAC12G12.05c 19113805 2543133 338392..338883 1 NC_003424.3 SAGA complex/ transcription initiation factor Taf9 (predicted) 338883 taf9 2543133 taf9 Schizosaccharomyces pombe 972h- SAGA complex/ transcription initiation factor Taf9 (predicted) NP_592893.1 338392 D 284812 CDS SPAC12G12.04 19113806 2543131 complement(340107..341855) 1 NC_003424.3 mitochondrial heat shock protein Hsp60/Mcp60 341855 mcp60 2543131 mcp60 Schizosaccharomyces pombe 972h- mitochondrial heat shock protein Hsp60/Mcp60 NP_592894.1 340107 R 284812 CDS SPAC12G12.03 19113807 2543139 complement(343399..345129) 1 NC_003424.3 Csx1-interacting protein 2 (PMID 16407405); RNA-binding protein Cip2 345129 cip2 2543139 cip2 Schizosaccharomyces pombe 972h- RNA-binding protein Cip2 NP_592895.1 343399 R 284812 CDS SPAC12G12.02 19113808 2543142 complement(join(345839..346051,346114..346244,346307..346439,346544..346618)) 1 NC_003424.3 rRNA processing protein, unnamed 346618 2543142 SPAC12G12.02 Schizosaccharomyces pombe 972h- rRNA processing protein, unnamed NP_592896.1 345839 R 284812 CDS SPAC12G12.01c 162312362 3361381 347195..349912 1 NC_003424.3 ubiquitin-protein ligase E3 349912 3361381 SPAC12G12.01c Schizosaccharomyces pombe 972h- ubiquitin-protein ligase E3 XP_001713039.1 347195 D 284812 CDS SPAC630.03 19113810 2543233 join(350477..350511,350575..350598,350671..351199,351295..351894,351960..352055) 1 NC_003424.3 actin-like protein Arp3 352055 arp3 2543233 arp3 Schizosaccharomyces pombe 972h- actin-like protein Arp3 NP_592898.1 350477 D 284812 CDS SPAC630.04c 19113811 2543431 complement(352427..352927) 1 NC_003424.3 was previously annotated as dubious; sequence orphan 352927 2543431 SPAC630.04c Schizosaccharomyces pombe 972h- sequence orphan NP_592899.1 352427 R 284812 CDS SPAC630.05 19113812 2543609 353900..356131 1 NC_003424.3 GTPase activating protein Gyp7 (predicted) 356131 gyp7 2543609 gyp7 Schizosaccharomyces pombe 972h- GTPase activating protein Gyp7 (predicted) NP_592900.1 353900 D 284812 CDS SPAC630.06c 19113813 2543368 complement(join(356233..356433,356511..356592,356635..356904,356984..356997)) 1 NC_003424.3 conserved fungal protein 356997 2543368 SPAC630.06c Schizosaccharomyces pombe 972h- conserved fungal protein NP_592901.1 356233 R 284812 CDS SPAC630.07c 19113814 2543370 complement(357593..358885) 1 NC_003424.3 sequence orphan 358885 2543370 SPAC630.07c Schizosaccharomyces pombe 972h- sequence orphan NP_592902.1 357593 R 284812 CDS SPAC630.08c 19113815 2543373 complement(360060..360962) 1 NC_003424.3 C-4 methylsterol oxidase (predicted) 360962 erg25 2543373 erg25 Schizosaccharomyces pombe 972h- C-4 methylsterol oxidase (predicted) NP_592903.1 360060 R 284812 CDS SPAC630.15 19113816 2543435 361557..361874 1 NC_003424.3 has transcript profile on microarray; poor correlation score; sequence orphan 361874 mug177 2543435 mug177 Schizosaccharomyces pombe 972h- sequence orphan NP_592904.1 361557 D 284812 CDS SPAC630.09c 19113817 2543381 complement(362769..363602) 1 NC_003424.3 glycerate kinase (predicted) 363602 mug58 2543381 mug58 Schizosaccharomyces pombe 972h- glycerate kinase (predicted) NP_592905.1 362769 R 284812 CDS SPAC630.10 19113818 2543414 365550..366362 1 NC_003424.3 conserved fungal protein 366362 2543414 SPAC630.10 Schizosaccharomyces pombe 972h- conserved fungal protein NP_592906.1 365550 D 284812 CDS SPAC630.11 295442926 2543247 join(366801..366817,366873..366891,366968..367040,367105..367189,367293..367348,367395..367531) 1 NC_003424.3 vacuolar sorting protein Vps55 (predicted) 367531 vps55 2543247 vps55 Schizosaccharomyces pombe 972h- vacuolar sorting protein Vps55 (predicted) NP_592907.2 366801 D 284812 CDS SPAC630.12 19113820 2543429 368572..369840 1 NC_003424.3 phosphoprotein phosphatase (predicted) 369840 2543429 SPAC630.12 Schizosaccharomyces pombe 972h- phosphoprotein phosphatase (predicted) NP_592908.1 368572 D 284812 CDS SPAC630.13c 19113821 2543339 complement(369945..373964) 1 NC_003424.3 tuberin 373964 tsc2 2543339 tsc2 Schizosaccharomyces pombe 972h- tuberin NP_592909.1 369945 R 284812 CDS SPAC630.14c 19113822 2543402 complement(join(374683..375830,376094..376446,376844..376931,376993..377164)) 1 NC_003424.3 a number of genes are differentially affected by mutations in tup11 and tup 12 in response to cation stress (PMID 15632072); transcriptional corepressor Tup12 377164 tup12 2543402 tup12 Schizosaccharomyces pombe 972h- transcriptional corepressor Tup12 NP_592910.1 374683 R 284812 CDS SPAC1751.01c 19113823 2542344 complement(378192..380354) 1 NC_003424.3 gluconate transporter inducer Gti1 380354 gti1 2542344 gti1 Schizosaccharomyces pombe 972h- gluconate transporter inducer Gti1 NP_592911.1 378192 R 284812 CDS SPAC1751.04 67989553 3361540 join(384627..384750,384812..384888,384986..385060,385125..385220) 1 NC_003424.3 sequence orphan 385220 3361540 SPAC1751.04 Schizosaccharomyces pombe 972h- sequence orphan NP_001018183.1 384627 D 284812 CDS SPAC1751.02c 295442928 2542342 complement(join(385755..385887,385938..386043,386107..386149)) 1 NC_003424.3 initiation is possibly at second Met, and upstream splicing possiply in 5' UTR; mitochondrial ribosomal protein subunit S19 (predicted) 386149 rsm19 2542342 rsm19 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit S19 (predicted) NP_592912.2 385755 R 284812 CDS SPAC1751.03 63054479 2542347 join(386344..386394,386458..386614,386786..387786) 1 NC_003424.3 was incorrectly annotated as COP9/signalosome complex, updated 8 Sept 2000, (PMID:15904532); translation initiation factor eIF3m 387786 2542347 SPAC1751.03 Schizosaccharomyces pombe 972h- translation initiation factor eIF3m NP_592913.2 386344 D 284812 CDS SPAC31A2.02 19113826 2541708 join(388400..388415,388452..388621,388721..388813,388859..388960) 1 NC_003424.3 tRNA (guanine-N2-)-methyltransferase regulatory subunit Trm112 (predicted) 388960 trm112 2541708 trm112 Schizosaccharomyces pombe 972h- tRNA (guanine-N2-)-methyltransferase regulatory subunit Trm112 (predicted) NP_592914.1 388400 D 284812 CDS SPAC31A2.03 19113827 2542402 join(389543..389564,389617..390245) 1 NC_003424.3 mitochondrial ribosomal protein subunit L11 (predicted) 390245 mrpl11 2542402 mrpl11 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit L11 (predicted) NP_592915.1 389543 D 284812 CDS SPAC31A2.04c 19113828 2543122 complement(390589..391173) 1 NC_003424.3 20S proteasome component beta 4 (predicted) 391173 2543122 SPAC31A2.04c Schizosaccharomyces pombe 972h- 20S proteasome component beta 4 (predicted) NP_592916.1 390589 R 284812 CDS SPAC31A2.05c 19113829 2542657 complement(join(391838..391915,391956..392612,392652..392787,392828..394611,394656..395123,395167..396502,396546..396741,396781..396877)) 1 NC_003424.3 cohesin loading factor Mis4 396877 mis4 2542657 mis4 Schizosaccharomyces pombe 972h- cohesin loading factor Mis4 NP_592917.1 391838 R 284812 CDS SPAC31A2.06 19113830 2542929 397709..399337 1 NC_003424.3 mitochobndrial ATP synthase complex assembly protien Atp25 (predicted) 399337 atp25 2542929 atp25 Schizosaccharomyces pombe 972h- mitochobndrial ATP synthase complex assembly protien Atp25 (predicted) NP_592918.1 397709 D 284812 CDS SPAC31A2.07c 19113831 2543197 complement(join(399548..401871,401972..402194)) 1 NC_003424.3 ATP-dependent RNA helicase Dbp10 (predicted) 402194 dbp10 2543197 dbp10 Schizosaccharomyces pombe 972h- ATP-dependent RNA helicase Dbp10 (predicted) NP_592919.1 399548 R 284812 CDS SPAC31A2.08 19113832 2543038 403060..403545 1 NC_003424.3 mitochondrial ribosomal protein subunit L23 (predicted) 403545 mrp20 2543038 mrp20 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit L23 (predicted) NP_592920.1 403060 D 284812 CDS SPAC31A2.09c 19113833 2541527 complement(join(403813..405079,405138..405202,405241..405249)) 1 NC_003424.3 AP-2 adaptor complex subunit Apm4 (predicted) 405249 apm4 2541527 apm4 Schizosaccharomyces pombe 972h- AP-2 adaptor complex subunit Apm4 (predicted) NP_592921.1 403813 R 284812 CDS SPAC31A2.10 19113834 2543083 join(405802..405924,405964..406032,406134..406168,406268..406460,406503..407465) 1 NC_003424.3 Ran GTP-binding protein (predicted) 407465 2543083 SPAC31A2.10 Schizosaccharomyces pombe 972h- Ran GTP-binding protein (predicted) NP_592922.1 405802 D 284812 CDS SPAC31A2.11c 19113835 2543198 complement(408030..409265) 1 NC_003424.3 Cu metalloregulatory transcription factor Cuf1 409265 cuf1 2543198 cuf1 Schizosaccharomyces pombe 972h- Cu metalloregulatory transcription factor Cuf1 NP_592923.1 408030 R 284812 CDS SPAC31A2.12 19113836 2542940 412084..413874 1 NC_003424.3 arrestin/PY protein 1 413874 2542940 SPAC31A2.12 Schizosaccharomyces pombe 972h- arrestin/PY protein 1 NP_592924.1 412084 D 284812 CDS SPAC31A2.13c 19113837 2542585 complement(join(414471..414629,414684..414800)) 1 NC_003424.3 SNARE Sft1 (predicted) 414800 sft1 2542585 sft1 Schizosaccharomyces pombe 972h- SNARE Sft1 (predicted) NP_592925.1 414471 R 284812 CDS SPAC31A2.14 19113838 2543160 join(415406..415685,415763..418371) 1 NC_003424.3 WD repeat protein, human WDR48 family 418371 2543160 SPAC31A2.14 Schizosaccharomyces pombe 972h- WD repeat protein, human WDR48 family NP_592926.1 415406 D 284812 CDS SPAC31A2.15c 19113839 2543078 complement(join(418537..419220,419268..419502,419602..419732)) 1 NC_003424.3 S. cerevisiae YCL016C reciprocal best hit, conserved residues from PMID 12766176; DNA replication factor C complex subunit Dcc1 (predicted) 419732 dcc1 2543078 dcc1 Schizosaccharomyces pombe 972h- DNA replication factor C complex subunit Dcc1 (predicted) NP_592927.1 418537 R 284812 CDS SPAC31A2.16 19113840 2543168 join(420466..422887,422926..423153,423199..423307,423357..423903) 1 NC_003424.3 RhoGEF Gef2 423903 gef2 2543168 gef2 Schizosaccharomyces pombe 972h- RhoGEF Gef2 NP_592928.1 420466 D 284812 CDS SPAC13C5.01c 162312364 3361518 complement(424477..425223) 1 NC_003424.3 20S proteasome component alpha 3 (predicted) 425223 3361518 SPAC13C5.01c Schizosaccharomyces pombe 972h- 20S proteasome component alpha 3 (predicted) XP_001713040.1 424477 R 284812 CDS SPAC13C5.02 19113842 2542176 join(426030..426069,426106..426322,426364..427342) 1 NC_003424.3 Defect in REreplication 4 (PMID:15466421); DNA replication protein Dre4 427342 dre4 2542176 dre4 Schizosaccharomyces pombe 972h- DNA replication protein Dre4 NP_592930.1 426030 D 284812 CDS SPAC13C5.03 19113843 2542365 join(427583..427943,427986..428590,428653..429318) 1 NC_003424.3 nuclear membrane protein involved in karyogamy Tht1 429318 tht1 2542365 tht1 Schizosaccharomyces pombe 972h- nuclear membrane protein involved in karyogamy Tht1 NP_592931.1 427583 D 284812 CDS SPAC13C5.04 19113844 2542450 430130..430876 1 NC_003424.3 amidotransferase (predicted) 430876 2542450 SPAC13C5.04 Schizosaccharomyces pombe 972h- amidotransferase (predicted) NP_592932.1 430130 D 284812 CDS SPAC13C5.05c 19113845 2542320 complement(join(431562..432982,433028..433113,433154..433203)) 1 NC_003424.3 N-acetylglucosamine-phosphate mutase (predicted) 433203 2542320 SPAC13C5.05c Schizosaccharomyces pombe 972h- N-acetylglucosamine-phosphate mutase (predicted) NP_592933.1 431562 R 284812 CDS SPAC13C5.06c 19113846 2542798 complement(join(434524..434831,434876..435101)) 1 NC_003424.3 sequence orphan 435101 mug121 2542798 mug121 Schizosaccharomyces pombe 972h- sequence orphan NP_592934.1 434524 R 284812 CDS SPAC13C5.07 19113847 2542757 join(436214..436381,436430..436935,437006..437580,437624..437807,437853..438369) 1 NC_003424.3 Rad32 nuclease 438369 rad32 2542757 rad32 Schizosaccharomyces pombe 972h- Rad32 nuclease NP_592935.1 436214 D 284812 CDS SPAC23E2.01 19113848 2541522 443569..445263 1 NC_003424.3 iron-sensing transcription factor Fep1 445263 fep1 2541522 fep1 Schizosaccharomyces pombe 972h- iron-sensing transcription factor Fep1 NP_592936.1 443569 D 284812 CDS SPAC23E2.02 19113849 2541832 join(446491..446513,446679..449241,449295..450530) 1 NC_003424.3 S. pombe SPBC146.09C has no HMG box; histone demethylase SWIRM2 (predicted) 450530 lsd2 2541832 lsd2 Schizosaccharomyces pombe 972h- histone demethylase SWIRM2 (predicted) NP_592937.1 446491 D 284812 CDS SPAC23E2.03c 19113850 2541518 complement(451210..452919) 1 NC_003424.3 meiotic suppressor protein Ste7 452919 ste7 2541518 ste7 Schizosaccharomyces pombe 972h- meiotic suppressor protein Ste7 NP_592938.1 451210 R 284812 CDS SPAC24H6.13 19113851 2541670 complement(457061..459676) 1 NC_003424.3 DUF221 family protein 459676 2541670 SPAC24H6.13 Schizosaccharomyces pombe 972h- DUF221 family protein NP_592939.1 457061 R 284812 CDS SPAC24H6.12c 19113852 2542099 461939..463273 1 NC_003424.3 NEDD8 activating enzyme 463273 uba3 2542099 uba3 Schizosaccharomyces pombe 972h- NEDD8 activating enzyme NP_592940.1 461939 D 284812 CDS SPAC24H6.11c 19113853 2542625 465299..468175 1 NC_003424.3 sulfate transporter (predicted) 468175 2542625 SPAC24H6.11c Schizosaccharomyces pombe 972h- sulfate transporter (predicted) NP_592941.1 465299 D 284812 CDS SPAC24H6.10c 19113854 2542631 468720..469826 1 NC_003424.3 phospho-2-dehydro-3-deoxyheptonate aldolase (predicted) 469826 2542631 SPAC24H6.10c Schizosaccharomyces pombe 972h- phospho-2-dehydro-3-deoxyheptonate aldolase (predicted) NP_592942.1 468720 D 284812 CDS SPAC24H6.09 19113855 2542635 complement(join(470583..472802,472858..472899)) 1 NC_003424.3 RhoGEF Gef1 472899 gef1 2542635 gef1 Schizosaccharomyces pombe 972h- RhoGEF Gef1 NP_592943.1 470583 R 284812 CDS SPAC24H6.08 19113856 2542626 complement(474035..474697) 1 NC_003424.3 sequence orphan 474697 2542626 SPAC24H6.08 Schizosaccharomyces pombe 972h- sequence orphan NP_592944.1 474035 R 284812 CDS SPAC24H6.07 19113857 2542629 complement(join(475493..476053,476099..476113)) 1 NC_003424.3 40S ribosomal protein S9 476113 rps901 2542629 rps901 Schizosaccharomyces pombe 972h- 40S ribosomal protein S9 NP_592945.1 475493 R 284812 CDS SPAC24H6.06 19113858 2542628 complement(join(476549..477542,477636..478606,478655..478696)) 1 NC_003424.3 DNA replication pre-initiation complex subunit Sld3 478696 sld3 2542628 sld3 Schizosaccharomyces pombe 972h- DNA replication pre-initiation complex subunit Sld3 NP_592946.1 476549 R 284812 CDS SPAC24H6.05 19113859 2542632 complement(479750..481540) 1 NC_003424.3 serine/threonine protein phosphatase Cdc25 481540 cdc25 2542632 cdc25 Schizosaccharomyces pombe 972h- serine/threonine protein phosphatase Cdc25 NP_592947.1 479750 R 284812 CDS SPAC24H6.04 19113860 2542634 complement(483447..484901) 1 NC_003424.3 hexokinase 1 484901 hxk1 2542634 hxk1 Schizosaccharomyces pombe 972h- hexokinase 1 NP_592948.1 483447 R 284812 CDS SPAC24H6.03 19113861 2542637 complement(join(485960..486131,486188..486597,486649..486822,486867..486931,486984..487093,487133..488517,488574..488615)) 1 NC_003424.3 cullin 3 488615 cul3 2542637 cul3 Schizosaccharomyces pombe 972h- cullin 3 NP_592949.1 485960 R 284812 CDS SPAC24H6.02c 19113862 2542642 join(488779..489029,489074..489350) 1 NC_003424.3 TIM23 translocase complex subunit Tim15 (predicted) 489350 2542642 SPAC24H6.02c Schizosaccharomyces pombe 972h- TIM23 translocase complex subunit Tim15 (predicted) NP_592950.1 488779 D 284812 CDS SPAC24H6.01c 295442930 2541508 join(490016..490262,490338..490771,490812..490931,490979..491149,491186..491858,491905..492011) 1 NC_003424.3 NAS from PMID:16597698, not yet amnnotated at SGD; membrane bound O-acyltransferase, MBOAT (predicted) 492011 2541508 SPAC24H6.01c Schizosaccharomyces pombe 972h- membrane bound O-acyltransferase, MBOAT (predicted) NP_592951.3 490016 D 284812 CDS SPAPB21F2.02 19113865 2543220 join(492461..492476,492512..492630,492673..494385,494423..494615,494667..497689) 1 NC_003424.3 Dopey family protein 497689 2543220 SPAPB21F2.02 Schizosaccharomyces pombe 972h- Dopey family protein NP_592953.1 492461 D 284812 CDS SPAPB21F2.03 19113866 2543463 join(498171..498173,498215..498730) 1 NC_003424.3 confirmed intron; ribosome biogenesis protein (predicted) 498730 2543463 SPAPB21F2.03 Schizosaccharomyces pombe 972h- ribosome biogenesis protein (predicted) NP_592954.1 498171 D 284812 CDS SPAC227.01c 63054482 2541909 complement(499284..500405) 1 NC_003424.3 Erd1 homolog 500405 2541909 SPAC227.01c Schizosaccharomyces pombe 972h- Erd1 homolog NP_592955.2 499284 R 284812 CDS SPAC227.19c 295442932 9407191 complement(join(501117..501248,501366..501485)) 1 NC_003424.3 some fungal orthologs seem to be longer, but this small C-terminal region is conserved; hypothetical protein 501485 9407191 SPAC227.19c Schizosaccharomyces pombe 972h- hypothetical protein XP_002742499.1 501117 R 284812 CDS SPAC227.02c 19113868 2541919 complement(501767..502384) 1 NC_003424.3 rRNA processing protein Rrp15 (predicted) 502384 2541919 SPAC227.02c Schizosaccharomyces pombe 972h- rRNA processing protein Rrp15 (predicted) NP_592956.1 501767 R 284812 CDS SPAC227.03c 19113869 2541928 complement(502978..504093) 1 NC_003424.3 NAS from PMID:16291748; mitochondrial NAD+ transporter (predicted) 504093 2541928 SPAC227.03c Schizosaccharomyces pombe 972h- mitochondrial NAD+ transporter (predicted) NP_592957.1 502978 R 284812 CDS SPAC227.04 19113870 2541913 505053..505592 1 NC_003424.3 autophagy C terminal domain family protein 505592 2541913 SPAC227.04 Schizosaccharomyces pombe 972h- autophagy C terminal domain family protein NP_592958.1 505053 D 284812 CDS SPAC227.05 19113871 2542066 505984..506355 1 NC_003424.3 prefoldin subunit 4 (predicted) 506355 2542066 SPAC227.05 Schizosaccharomyces pombe 972h- prefoldin subunit 4 (predicted) NP_592959.1 505984 D 284812 CDS SPAC227.06 19113872 2541426 506543..507292 1 NC_003424.3 Rab GTPase binding (predicted) 507292 2541426 SPAC227.06 Schizosaccharomyces pombe 972h- Rab GTPase binding (predicted) NP_592960.1 506543 D 284812 CDS SPAC227.07c 19113873 2541519 complement(join(508136..508159,508203..509485,509563..509603,509648..509691)) 1 NC_003424.3 protein phosphatase regulatory subunit Pab1 509691 pab1 2541519 pab1 Schizosaccharomyces pombe 972h- protein phosphatase regulatory subunit Pab1 NP_592961.1 508136 R 284812 CDS SPAC227.08c 19113874 2541506 complement(join(510669..510720,510780..511070,511167..511336)) 1 NC_003424.3 zinc finger protein Yth1 511336 yth1 2541506 yth1 Schizosaccharomyces pombe 972h- zinc finger protein Yth1 NP_592962.1 510669 R 284812 CDS SPAC227.09 19113875 2541481 511807..513060 1 NC_003424.3 folylpolyglutamate synthase (predicted) 513060 2541481 SPAC227.09 Schizosaccharomyces pombe 972h- folylpolyglutamate synthase (predicted) NP_592963.1 511807 D 284812 CDS SPAC227.10 19113876 2541498 join(513831..513858,513908..513998,514046..514169,514244..514345) 1 NC_003424.3 prefoldin subunit 2 (predicted) 514345 2541498 SPAC227.10 Schizosaccharomyces pombe 972h- prefoldin subunit 2 (predicted) NP_592964.1 513831 D 284812 CDS SPAC227.11c 295442934 2541459 complement(join(514552..515082,515222..515482,515534..515659)) 1 NC_003424.3 sensor for misfolded ER glycoproteins Yos9 (predicted) 515659 2541459 SPAC227.11c Schizosaccharomyces pombe 972h- sensor for misfolded ER glycoproteins Yos9 (predicted) NP_592965.2 514552 R 284812 CDS SPAC227.12 19113878 2541477 join(515797..515833,515896..517247) 1 NC_003424.3 U4/U6 x U5 tri-snRNP complex subunit Prp4 family (predicted) 517247 2541477 SPAC227.12 Schizosaccharomyces pombe 972h- U4/U6 x U5 tri-snRNP complex subunit Prp4 family (predicted) NP_592966.1 515797 D 284812 CDS SPAC227.13c 19113879 2541513 complement(517865..518443) 1 NC_003424.3 mitochondrial iron-sulfur cluster assembly scaffold protein Isu1 518443 isu1 2541513 isu1 Schizosaccharomyces pombe 972h- mitochondrial iron-sulfur cluster assembly scaffold protein Isu1 NP_592967.1 517865 R 284812 CDS SPAC227.14 19113880 2541483 join(520933..521133,521215..521721) 1 NC_003424.3 uridine kinase PRINTS false positive; nicotinamide riboside kinase (predicted) 521721 2541483 SPAC227.14 Schizosaccharomyces pombe 972h- nicotinamide riboside kinase (predicted) NP_592968.1 520933 D 284812 CDS SPAC227.15 19113881 2541494 523246..525867 1 NC_003424.3 protein phosphatase regulatory subunit Reg1 (predicted) 525867 2541494 SPAC227.15 Schizosaccharomyces pombe 972h- protein phosphatase regulatory subunit Reg1 (predicted) NP_592969.1 523246 D 284812 CDS SPAC227.16c 19113882 2541474 complement(join(528003..528064,528124..528269,528326..528460,528567..528625,528673..528771)) 1 NC_003424.3 GINS complex subunit Psf3 (predicted) 528771 2541474 SPAC227.16c Schizosaccharomyces pombe 972h- GINS complex subunit Psf3 (predicted) NP_592970.1 528003 R 284812 CDS SPAC227.17c 19113883 2541488 complement(529801..530166) 1 NC_003424.3 conserved protein (fungal and plant) 530166 2541488 SPAC227.17c Schizosaccharomyces pombe 972h- conserved protein (fungal and plant) NP_592971.1 529801 R 284812 CDS SPAC227.18 19113884 2541500 530522..531628 1 NC_003424.3 saccharopine dehydrogenase Lys3 531628 lys3 2541500 lys3 Schizosaccharomyces pombe 972h- saccharopine dehydrogenase Lys3 NP_592972.1 530522 D 284812 CDS SPAC2F7.02c 19113885 2541901 complement(532432..533409) 1 NC_003424.3 NLI interacting factor family phosphatase (predicted) 533409 2541901 SPAC2F7.02c Schizosaccharomyces pombe 972h- NLI interacting factor family phosphatase (predicted) NP_592973.1 532432 R 284812 CDS SPAC2F7.03c 19113886 2541889 complement(534462..537725) 1 NC_003424.3 DYRK family protein kinase Pom1 537725 pom1 2541889 pom1 Schizosaccharomyces pombe 972h- DYRK family protein kinase Pom1 NP_592974.1 534462 R 284812 CDS SPAC2F7.04 19113887 2542516 join(538395..538628,538675..539322,539365..539847) 1 NC_003424.3 mediator complex subunit Pmc2/Med1 539847 pmc2 2542516 pmc2 Schizosaccharomyces pombe 972h- mediator complex subunit Pmc2/Med1 NP_592975.1 538395 D 284812 CDS SPAC2F7.05c 19113888 2541629 complement(540125..541312) 1 NC_003424.3 translation initiation factor eIF5 (predicted) 541312 2541629 SPAC2F7.05c Schizosaccharomyces pombe 972h- translation initiation factor eIF5 (predicted) NP_592976.1 540125 R 284812 CDS SPAC2F7.06c 19113889 2541638 complement(542037..543557) 1 NC_003424.3 A template-instructed polymerase with preference for purines which combines properties of mammalian DNA polymerase beta, mu and lambda (PMID 16120966); DNA polymerase X family 543557 pol4 2541638 pol4 Schizosaccharomyces pombe 972h- DNA polymerase X family NP_592977.1 542037 R 284812 CDS SPAC2F7.07c 19113890 2541422 complement(544417..546240) 1 NC_003424.3 Clr6 histone deacetylase associated PHD protein-2 Cph2 546240 cph2 2541422 cph2 Schizosaccharomyces pombe 972h- Clr6 histone deacetylase associated PHD protein-2 Cph2 NP_592978.1 544417 R 284812 CDS SPAC2F7.08c 19113891 2541801 complement(546664..548562) 1 NC_003424.3 SWI/SNF complex subunit Snf5 548562 snf5 2541801 snf5 Schizosaccharomyces pombe 972h- SWI/SNF complex subunit Snf5 NP_592979.1 546664 R 284812 CDS SPAC2F7.09c 19113892 2541882 complement(548768..550243) 1 NC_003424.3 mitochondrial GTPase related protein (prediected) 550243 2541882 SPAC2F7.09c Schizosaccharomyces pombe 972h- mitochondrial GTPase related protein (prediected) NP_592980.1 548768 R 284812 CDS SPAC2F7.10 19113893 2541757 551011..552939 1 NC_003424.3 palmitoyltransferase (predicted) 552939 2541757 SPAC2F7.10 Schizosaccharomyces pombe 972h- palmitoyltransferase (predicted) NP_592981.1 551011 D 284812 CDS SPAC2F7.11 19113894 2541755 556631..558220 1 NC_003424.3 RNA-binding protein Nrd1 558220 nrd1 2541755 nrd1 Schizosaccharomyces pombe 972h- RNA-binding protein Nrd1 NP_592982.1 556631 D 284812 CDS SPAC2F7.13c 19113895 2541841 complement(559317..560504) 1 NC_003424.3 tryptophan-tRNA ligase Wrs1 (predicted) 560504 wrs1 2541841 wrs1 Schizosaccharomyces pombe 972h- tryptophan-tRNA ligase Wrs1 (predicted) NP_592983.1 559317 R 284812 CDS SPAC2F7.14c 19113896 2541813 complement(560978..561967) 1 NC_003424.3 exosome subunit Rrp4 (predicted) 561967 2541813 SPAC2F7.14c Schizosaccharomyces pombe 972h- exosome subunit Rrp4 (predicted) NP_592984.1 560978 R 284812 CDS SPAC2F7.15 19113897 2541429 join(564170..564464,564553..565034) 1 NC_003424.3 mitochondrial ribosomal protein subunit S24 (predicted) 565034 rsm24 2541429 rsm24 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit S24 (predicted) NP_592985.1 564170 D 284812 CDS SPAC2F7.16c 19113898 2542065 complement(565168..569277) 1 NC_003424.3 phospholipase D, Pld1 (predicted) 569277 2542065 SPAC2F7.16c Schizosaccharomyces pombe 972h- phospholipase D, Pld1 (predicted) NP_592986.1 565168 R 284812 CDS SPAC2F7.17 19113899 2541478 join(570236..570406,570549..570647,570885..571805) 1 NC_003424.3 mitochondrial peptide chain release factor (predicted) 571805 2541478 SPAC2F7.17 Schizosaccharomyces pombe 972h- mitochondrial peptide chain release factor (predicted) NP_592987.1 570236 D 284812 CDS SPAC13A11.01c 63054483 2542617 complement(join(571994..574224,574269..574371)) 1 NC_003424.3 Rho-type GTPase activating protein Rga8 574371 rga8 2542617 rga8 Schizosaccharomyces pombe 972h- Rho-type GTPase activating protein Rga8 NP_592988.2 571994 R 284812 CDS SPAC13A11.02c 19113902 2542599 complement(575135..576622) 1 NC_003424.3 source of the name cyp51 unknown; sterol 14-demethylase 576622 erg11 2542599 erg11 Schizosaccharomyces pombe 972h- sterol 14-demethylase NP_592990.1 575135 R 284812 CDS SPAC13A11.03 19113903 2542548 join(578521..578586,578681..579247) 1 NC_003424.3 meiotically upregulated gene Mug32; meiosis specific coiled-coil protein Mcp7 579247 mcp7 2542548 mcp7 Schizosaccharomyces pombe 972h- meiosis specific coiled-coil protein Mcp7 NP_592991.1 578521 D 284812 CDS SPAC13A11.04c 19113904 2542135 complement(join(579720..579789,579835..579899,579953..580250,580296..580983,581084..581216,581295..581390)) 1 NC_003424.3 ubiquitin C-terminal hydrolase Ubp8 (predicted) 581390 ubp8 2542135 ubp8 Schizosaccharomyces pombe 972h- ubiquitin C-terminal hydrolase Ubp8 (predicted) NP_592992.1 579720 R 284812 CDS SPAC13A11.05 19113905 2542130 582492..584033 1 NC_003424.3 peptidase family M17 584033 2542130 SPAC13A11.05 Schizosaccharomyces pombe 972h- peptidase family M17 NP_592993.1 582492 D 284812 CDS SPAC13A11.06 162312366 3361478 585597..587312 1 NC_003424.3 pyruvate decarboxylase (predicted) 587312 3361478 SPAC13A11.06 Schizosaccharomyces pombe 972h- pyruvate decarboxylase (predicted) XP_001713041.1 585597 D 284812 CDS SPAC3H8.02 19113907 2543637 588925..590259 1 NC_003424.3 sec14 cytosolic factor family 590259 2543637 SPAC3H8.02 Schizosaccharomyces pombe 972h- sec14 cytosolic factor family NP_592995.1 588925 D 284812 CDS SPAC3H8.03 19113908 2543635 join(591067..591246,591418..591555) 1 NC_003424.3 mitochondrial ribosomal protein subunit Img2 (predicted) 591555 2543635 SPAC3H8.03 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit Img2 (predicted) NP_592996.1 591067 D 284812 CDS SPAC3H8.04 19113909 2543634 592743..593759 1 NC_003424.3 chromosome segregation protein 593759 2543634 SPAC3H8.04 Schizosaccharomyces pombe 972h- chromosome segregation protein NP_592997.1 592743 D 284812 CDS SPAC3H8.05c 19113910 2543633 complement(join(593977..594731,594771..594859,594900..597277)) 1 NC_003424.3 conserved fungal protein 597277 2543633 SPAC3H8.05c Schizosaccharomyces pombe 972h- conserved fungal protein NP_592998.1 593977 R 284812 CDS SPAC3H8.06 19113911 2543632 598916..600184 1 NC_003424.3 inositol phosphorylceramide synthase (predicted) 600184 aur1 2543632 aur1 Schizosaccharomyces pombe 972h- inositol phosphorylceramide synthase (predicted) NP_592999.1 598916 D 284812 CDS SPAC3H8.07c 19113912 2543378 complement(join(600883..601282,601327..601425,601475..601485)) 1 NC_003424.3 prefoldin subunit 3 (predicted) 601485 2543378 SPAC3H8.07c Schizosaccharomyces pombe 972h- prefoldin subunit 3 (predicted) NP_593000.1 600883 R 284812 CDS SPAC3H8.08c 19113913 2543636 complement(602060..603751) 1 NC_003424.3 transcription factor (predicted) 603751 2543636 SPAC3H8.08c Schizosaccharomyces pombe 972h- transcription factor (predicted) NP_593001.1 602060 R 284812 CDS SPAC3H8.09c 19113914 2543638 complement(join(604496..604959,605015..605355,605438..606849)) 1 NC_003424.3 poly(A) binding protein Nab3 (predicted) 606849 nab3 2543638 nab3 Schizosaccharomyces pombe 972h- poly(A) binding protein Nab3 (predicted) NP_593002.1 604496 R 284812 CDS SPAC3H8.10 19113915 2543628 join(608992..609150,609199..609501,609698..609820,609884..610159) 1 NC_003424.3 sec14 cytosolic factor family Sec14 610159 spo20 2543628 spo20 Schizosaccharomyces pombe 972h- sec14 cytosolic factor family Sec14 NP_593003.1 608992 D 284812 CDS SPAC1F3.01 63054485 2543630 join(610886..611152,611211..613277) 1 NC_003424.3 exosome subunit Rrp6 (predicted) 613277 rrp6 2543630 rrp6 Schizosaccharomyces pombe 972h- exosome subunit Rrp6 (predicted) NP_593004.2 610886 D 284812 CDS SPAC1F3.02c 19113917 2542175 complement(613498..616848) 1 NC_003424.3 MEK kinase (MEKK) Mkh1 616848 mkh1 2542175 mkh1 Schizosaccharomyces pombe 972h- MEK kinase (MEKK) Mkh1 NP_593005.1 613498 R 284812 CDS SPAC1F3.03 19113918 2542372 join(617844..617945,617993..618422,618471..620376,620420..620996) 1 NC_003424.3 Lgl family protein 620996 2542372 SPAC1F3.03 Schizosaccharomyces pombe 972h- Lgl family protein NP_593006.1 617844 D 284812 CDS SPAC1F3.04c 19113919 2542142 complement(join(621189..621852,621989..622191)) 1 NC_003424.3 DUF367 family protein 622191 2542142 SPAC1F3.04c Schizosaccharomyces pombe 972h- DUF367 family protein NP_593007.1 621189 R 284812 CDS SPAC1F3.05 19113920 2541469 join(623272..623305,623375..623462,623518..623593,623752..625086) 1 NC_003424.3 adaptin (predicted) 625086 2541469 SPAC1F3.05 Schizosaccharomyces pombe 972h- adaptin (predicted) NP_593008.1 623272 D 284812 CDS SPAC1F3.06c 19113921 2541649 complement(625430..631303) 1 NC_003424.3 possible ortholog of S. cerevisiae SPO21; sporulation protein Spo15 631303 spo15 2541649 spo15 Schizosaccharomyces pombe 972h- sporulation protein Spo15 NP_593009.1 625430 R 284812 CDS SPAC1F3.07c 19113922 2541419 complement(join(631556..632424,632499..632841)) 1 NC_003424.3 RSC complex subunit Rsc58 632841 rsc58 2541419 rsc58 Schizosaccharomyces pombe 972h- RSC complex subunit Rsc58 NP_593010.1 631556 R 284812 CDS SPAC1F3.08c 19113923 2541431 complement(633148..633474) 1 NC_003424.3 dubious 633474 2541431 SPAC1F3.08c Schizosaccharomyces pombe 972h- dubious NP_593011.1 633148 R 284812 CDS SPAC1F3.09 19113924 2541461 join(634937..634971,635069..635235,635349..636176,636234..636314,636385..636959) 1 NC_003424.3 NOTE:corresponding transcript SPD244 is framshifted w.r.t this sequence; it also does not use the two final predicted splice sites; however this prediction shows reasonable homology to yeast YGR093W in this region and hence has been kept; it is possible this locus displays alternative splicing, or SPD244 is incompletely spliced; CwfJ family protein 636959 mug161 2541461 mug161 Schizosaccharomyces pombe 972h- CwfJ family protein NP_593012.1 634937 D 284812 CDS SPAC1F3.10c 19113925 2541640 complement(637023..639311) 1 NC_003424.3 mitochondrial intermediate peptidase Oct1 (predicted) 639311 oct1 2541640 oct1 Schizosaccharomyces pombe 972h- mitochondrial intermediate peptidase Oct1 (predicted) NP_593013.1 637023 R 284812 CDS SPAC1D4.01 162312368 5802861 639318..640175 1 NC_003424.3 sequence orphan 640175 5802861 SPAC1D4.01 Schizosaccharomyces pombe 972h- sequence orphan XP_001713042.1 639318 D 284812 CDS SPAC1D4.02c 19113927 2542452 complement(join(640399..640947,640997..641184,641281..641401,641448..641627)) 1 NC_003424.3 human GRASP protein homolog (predicted) 641627 2542452 SPAC1D4.02c Schizosaccharomyces pombe 972h- human GRASP protein homolog (predicted) NP_593015.1 640399 R 284812 CDS SPAC1D4.03c 19113928 2542459 complement(join(641885..642131,642218..643512)) 1 NC_003424.3 autophagy associated protein Aut12 (predicted) 643512 aut12 2542459 aut12 Schizosaccharomyces pombe 972h- autophagy associated protein Aut12 (predicted) NP_593016.1 641885 R 284812 CDS SPAC1D4.04 19113929 2542212 join(644711..644713,644750..644881,644929..646377) 1 NC_003424.3 chaperonin-containing T-complex beta subunit Cct2 646377 cct2 2542212 cct2 Schizosaccharomyces pombe 972h- chaperonin-containing T-complex beta subunit Cct2 NP_593017.1 644711 D 284812 CDS SPAC1D4.05c 19113930 2542527 complement(join(646593..647677,647730..647808)) 1 NC_003424.3 Erd1 homolog 647808 2542527 SPAC1D4.05c Schizosaccharomyces pombe 972h- Erd1 homolog NP_593018.1 646593 R 284812 CDS SPAC1D4.06c 19113931 2543327 complement(join(648301..648501,648614..648829,648890..649393)) 1 NC_003424.3 cyclin-dependent kinase activating kinase Csk1 649393 csk1 2543327 csk1 Schizosaccharomyces pombe 972h- cyclin-dependent kinase activating kinase Csk1 NP_593019.1 648301 R 284812 CDS SPAC1D4.07c 19113932 2542589 complement(649449..649889) 1 NC_003424.3 dubious 649889 2542589 SPAC1D4.07c Schizosaccharomyces pombe 972h- dubious NP_593020.1 649449 R 284812 CDS SPAC1D4.08 19113933 2542487 join(650814..650893,651173..651848) 1 NC_003424.3 CDP-diacylglycerol--inositol 3-phosphatidyltransferase Pis1 (predicted) 651848 pis1 2542487 pis1 Schizosaccharomyces pombe 972h- CDP-diacylglycerol--inositol 3-phosphatidyltransferase Pis1 (predicted) NP_593021.1 650814 D 284812 CDS SPAC1D4.09c 19113934 2542468 complement(join(652359..652529,652576..652698,652763..653178,653222..653234)) 1 NC_003424.3 replication termination factor Rtf2 653234 rtf2 2542468 rtf2 Schizosaccharomyces pombe 972h- replication termination factor Rtf2 NP_593022.1 652359 R 284812 CDS SPAC1D4.10 19113935 2542457 join(653774..654158,654196..656240) 1 NC_003424.3 tRNA endonuclease Trz2 (predicted) 656240 trz2 2542457 trz2 Schizosaccharomyces pombe 972h- tRNA endonuclease Trz2 (predicted) NP_593023.1 653774 D 284812 CDS SPAC1D4.11c 162312370 3361532 complement(656760..658832) 1 NC_003424.3 dual specificity protein kinase Lkh1 658832 lkh1 3361532 lkh1 Schizosaccharomyces pombe 972h- dual specificity protein kinase Lkh1 NP_001018187.2 656760 R 284812 CDS SPAC1D4.12 19113937 2542203 664782..667100 1 NC_003424.3 transcription factor TFIIH complex subunit Rad15 667100 rad15 2542203 rad15 Schizosaccharomyces pombe 972h- transcription factor TFIIH complex subunit Rad15 NP_593025.1 664782 D 284812 CDS SPAC1D4.13 19113938 2542137 668153..669175 1 NC_003424.3 MAP kinase kinase Byr1 669175 byr1 2542137 byr1 Schizosaccharomyces pombe 972h- MAP kinase kinase Byr1 NP_593026.1 668153 D 284812 CDS SPAC1D4.14 162312372 3361454 join(670379..670427,670483..675320) 1 NC_003424.3 THO complex subunit Tho2 (predicted) 675320 tho2 3361454 tho2 Schizosaccharomyces pombe 972h- THO complex subunit Tho2 (predicted) XP_001713043.1 670379 D 284812 CDS SPAC22F3.13 19113940 2541869 complement(675539..678238) 1 NC_003424.3 deletion mutant defective in conjugation (PMID 12136010); hamartin 678238 tsc1 2541869 tsc1 Schizosaccharomyces pombe 972h- hamartin NP_593028.1 675539 R 284812 CDS SPAC22F3.12c 19113941 2541764 680176..681621 1 NC_003424.3 regulator of G-protein signaling Rgs1 681621 rgs1 2541764 rgs1 Schizosaccharomyces pombe 972h- regulator of G-protein signaling Rgs1 NP_593029.1 680176 D 284812 CDS SPAC22F3.11c 295442936 2541763 join(682874..682994,682996..683109,683160..683446) 1 NC_003424.3 possibly missing N-terminal exons; term=frameshifted; date=20090202; PMID:16823372 predict a frameshift at base 124; U4/U6 x U5 tri-snRNP complex subunit Snu23 (predicted) 683446 snu23 2541763 snu23 Schizosaccharomyces pombe 972h- U4/U6 x U5 tri-snRNP complex subunit Snu23 (predicted) NP_593030.2 682874 D 284812 CDS SPAC22F3.10c 19113943 2541881 join(684010..684093,684345..686270) 1 NC_003424.3 glutamate-cysteine ligase Gcs1 686270 gcs1 2541881 gcs1 Schizosaccharomyces pombe 972h- glutamate-cysteine ligase Gcs1 NP_593031.1 684010 D 284812 CDS SPAC22F3.09c 19113944 2541871 join(686593..686824,686989..688730) 1 NC_003424.3 MBF transcription factor complex subunit Res2 688730 res2 2541871 res2 Schizosaccharomyces pombe 972h- MBF transcription factor complex subunit Res2 NP_593032.1 686593 D 284812 CDS SPAC22F3.08c 19113945 2541786 689483..690928 1 NC_003424.3 ATP-dependent RNA helicase Rok1 (predicted) 690928 rok1 2541786 rok1 Schizosaccharomyces pombe 972h- ATP-dependent RNA helicase Rok1 (predicted) NP_593033.1 689483 D 284812 CDS SPAC22F3.07c 19113946 2541878 join(691530..691656,691706..691803,691853..691984) 1 NC_003424.3 F0-ATPase subunit G (predicted) 691984 atp20 2541878 atp20 Schizosaccharomyces pombe 972h- F0-ATPase subunit G (predicted) NP_593034.1 691530 D 284812 CDS SPAC22F3.15 295442938 9407311 join(692567..692725,692849..693061) 1 NC_003424.3 GatB/YqeY domain protein 693061 9407311 SPAC22F3.15 Schizosaccharomyces pombe 972h- GatB/YqeY domain protein XP_002742500.1 692567 D 284812 CDS SPAC22F3.06c 19113947 2541875 693831..697034 1 NC_003424.3 Lon protease homolog Lon1 697034 lon1 2541875 lon1 Schizosaccharomyces pombe 972h- Lon protease homolog Lon1 NP_593035.1 693831 D 284812 CDS SPAC22F3.05c 19113948 2541769 join(697291..697355,697401..697455,697496..697568,697621..697766,697805..697885,697928..698068) 1 NC_003424.3 ADP-ribosylation factor Alp41 698068 alp41 2541769 alp41 Schizosaccharomyces pombe 972h- ADP-ribosylation factor Alp41 NP_593036.1 697291 D 284812 CDS SPAC22F3.04 19113949 2541797 complement(join(698033..698177,698223..698441,698480..698841,698884..699104,699148..699363,699410..702533)) 1 NC_003424.3 AMP binding enzyme (predicted) 702533 mug62 2541797 mug62 Schizosaccharomyces pombe 972h- AMP binding enzyme (predicted) NP_593037.1 698033 R 284812 CDS SPAC22F3.03c 63054489 2541798 join(703789..703967,704015..704113,704205..704280,704322..704536,704573..704763,704816..704889,704925..705056,705095..705158,705195..705293,705333..705490,705529..705601,705637..706252,706292..706361,706404..706652,706688..706828) 1 NC_003424.3 09.05.03 4th exon extended by altering intron 3 acceptor (cosmid coordiantes 34092->33923) (PMID 14551247); double mutant with rhp54 does not sporulate (PMID 14551247); double mutant with rhp54 does not arrest meiotic progression (PMID 14551247); ATP-dependent DNA helicase Rdh54 706828 rdh54 2541798 rdh54 Schizosaccharomyces pombe 972h- ATP-dependent DNA helicase Rdh54 NP_593038.2 703789 D 284812 CDS SPAC22F3.02 19113951 2541860 complement(706844..707473) 1 NC_003424.3 transcription factor Atf31 707473 atf31 2541860 atf31 Schizosaccharomyces pombe 972h- transcription factor Atf31 NP_593039.1 706844 R 284812 CDS SPAC1296.01c 162312374 3361436 complement(join(708055..708127,708168..708931,708979..709339,709428..709644,709745..709830,709896..710023)) 1 NC_003424.3 phosphoacetylglucosamine mutase (predicted) 710023 3361436 SPAC1296.01c Schizosaccharomyces pombe 972h- phosphoacetylglucosamine mutase (predicted) NP_593040.2 708055 R 284812 CDS SPAC1296.02 19113954 2543025 join(711301..711412,711768..712150) 1 NC_003424.3 cytochrome c oxidase subunit IV (predicted) 712150 cox4 2543025 cox4 Schizosaccharomyces pombe 972h- cytochrome c oxidase subunit IV (predicted) NP_593042.1 711301 D 284812 CDS SPAC1296.03c 19113955 2541701 complement(712491..714014) 1 NC_003424.3 serine carboxypeptidase Sxa2 714014 sxa2 2541701 sxa2 Schizosaccharomyces pombe 972h- serine carboxypeptidase Sxa2 NP_593043.1 712491 R 284812 CDS SPAC1296.04 63054491 2543049 join(715480..715535,715583..715721,715994..716146,716223..716621) 1 NC_003424.3 2 N-terminal exons added 28-5-2002; similarity is *very low* but they are reciprocal best hits, also both seem to contain novel dysferlin-C terminal domain; spore wall assembly protein (predicted) 716621 mug65 2543049 mug65 Schizosaccharomyces pombe 972h- spore wall assembly protein (predicted) NP_593044.2 715480 D 284812 CDS SPAC1296.05c 19113957 2542980 complement(join(716940..717585,717674..717804)) 1 NC_003424.3 cyclin L family cyclin 717804 2542980 SPAC1296.05c Schizosaccharomyces pombe 972h- cyclin L family cyclin NP_593045.1 716940 R 284812 CDS SPAC1296.06 19113958 2542966 join(719447..719581,719663..719740,719906..720024,720066..721410) 1 NC_003424.3 NADPH-dependent diflavin oxidoreductase (predicted) 721410 2542966 SPAC1296.06 Schizosaccharomyces pombe 972h- NADPH-dependent diflavin oxidoreductase (predicted) NP_593046.1 719447 D 284812 CDS SPAPJ696.01c 19113959 2543324 complement(join(721617..722243,722288..722493,722542..722995,723063..723425)) 1 NC_003424.3 retromer complex subunit Vps17 723425 vps17 2543324 vps17 Schizosaccharomyces pombe 972h- retromer complex subunit Vps17 NP_593047.1 721617 R 284812 CDS SPAPJ696.02 19113960 2543305 join(724289..724325,724378..724418,724506..725720) 1 NC_003424.3 actin cortical patch component Lsb4 (predicted) 725720 2543305 SPAPJ696.02 Schizosaccharomyces pombe 972h- actin cortical patch component Lsb4 (predicted) NP_593048.1 724289 D 284812 CDS SPAC22G7.01c 162312376 2541673 complement(join(726081..727731,727846..727901,727987..728076)) 1 NC_003424.3 aminopeptidase (predicted) 728076 2541673 SPAC22G7.01c Schizosaccharomyces pombe 972h- aminopeptidase (predicted) XP_001713044.1 726081 R 284812 CDS SPAC22G7.02 19113963 2541467 join(728420..728452,728494..728619,728664..730685,730726..730963,731004..731188,731227..731322,731369..731550,731616..731706) 1 NC_003424.3 karyopherin Kap111 731706 kap111 2541467 kap111 Schizosaccharomyces pombe 972h- karyopherin Kap111 NP_593051.1 728420 D 284812 CDS SPAC22G7.03 19113964 2541683 731938..732648 1 NC_003424.3 sequence orphan 732648 2541683 SPAC22G7.03 Schizosaccharomyces pombe 972h- sequence orphan NP_593052.1 731938 D 284812 CDS SPAC22G7.04 19113965 2541684 join(732880..732897,732942..733040,733085..733251,733288..733495,733536..734113,734151..735457,735495..736465) 1 NC_003424.3 ubiquitin C-terminal hydrolase, poly(A)-specific ribonuclease complex subunit Pan2 (predicted) 736465 ubp13 2541684 ubp13 Schizosaccharomyces pombe 972h- ubiquitin C-terminal hydrolase, poly(A)-specific ribonuclease complex subunit Pan2 (predicted) NP_593053.1 732880 D 284812 CDS SPAC22G7.05 19113966 2541654 join(736797..737037,737165..738720) 1 NC_003424.3 krr family protein 738720 2541654 SPAC22G7.05 Schizosaccharomyces pombe 972h- krr family protein NP_593054.1 736797 D 284812 CDS SPAC22G7.06c 19113967 2541544 complement(739300..746034) 1 NC_003424.3 carbamoyl-phosphate synthase (glutamine hydrolyzing), aspartate carbamoyltransferase Ura1 746034 ura1 2541544 ura1 Schizosaccharomyces pombe 972h- carbamoyl-phosphate synthase (glutamine hydrolyzing), aspartate carbamoyltransferase Ura1 NP_593055.1 739300 R 284812 CDS SPAC22G7.07c 19113968 2541669 complement(747143..748384) 1 NC_003424.3 mRNA (N6-adenosine)-methyltransferase (predicted) 748384 2541669 SPAC22G7.07c Schizosaccharomyces pombe 972h- mRNA (N6-adenosine)-methyltransferase (predicted) NP_593056.1 747143 R 284812 CDS SPAC22G7.08 19113969 2541663 join(749930..749995,750113..751588) 1 NC_003424.3 serine/threonine protein kinase Ppk8 (predicted) 751588 ppk8 2541663 ppk8 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Ppk8 (predicted) NP_593057.1 749930 D 284812 CDS SPAC22G7.09c 19113970 2541890 complement(join(751673..751800,751840..752131,752188..752296,752343..752429,752473..753079,753156..753210)) 1 NC_003424.3 nucleoporin Nup45 753210 nup45 2541890 nup45 Schizosaccharomyces pombe 972h- nucleoporin Nup45 NP_593058.1 751673 R 284812 CDS SPAC22G7.10 19113971 2541873 join(753704..753841,753887..753939,753987..754830) 1 NC_003424.3 mRNA cleavage and polyadenylation specificity factor complex subunit, Fip1 homolog (predicted) 754830 2541873 SPAC22G7.10 Schizosaccharomyces pombe 972h- mRNA cleavage and polyadenylation specificity factor complex subunit, Fip1 homolog (predicted) NP_593059.1 753704 D 284812 CDS SPAC22G7.11c 63054493 2541751 complement(755080..755502) 1 NC_003424.3 conserved fungal protein 755502 2541751 SPAC22G7.11c Schizosaccharomyces pombe 972h- conserved fungal protein NP_593060.2 755080 R 284812 CDS SPAC4G8.02c 19113973 2543140 complement(join(756598..756610,756779..756881,756989..757085)) 1 NC_003424.3 translocon gamma subunit Sss1 (predicted) 757085 sss1 2543140 sss1 Schizosaccharomyces pombe 972h- translocon gamma subunit Sss1 (predicted) NP_593061.1 756598 R 284812 CDS SPAC4G8.03c 19113974 2543684 complement(758208..760550) 1 NC_003424.3 RNA-binding protein 760550 2543684 SPAC4G8.03c Schizosaccharomyces pombe 972h- RNA-binding protein NP_593062.1 758208 R 284812 CDS SPAC4G8.04 19113976 2543572 join(767709..769748,769812..770090) 1 NC_003424.3 GTPase activating protein (predicted) 770090 2543572 SPAC4G8.04 Schizosaccharomyces pombe 972h- GTPase activating protein (predicted) NP_593064.1 767709 D 284812 CDS SPAC4G8.05 19113977 2543432 770623..772323 1 NC_003424.3 serine/threonine protein kinase Ppk14 (predicted) 772323 ppk14 2543432 ppk14 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Ppk14 (predicted) NP_593065.1 770623 D 284812 CDS SPAC4G8.06c 19113978 2543551 complement(772673..773929) 1 NC_003424.3 tRNA methyltransferase Trm12 (predicted) 773929 trm12 2543551 trm12 Schizosaccharomyces pombe 972h- tRNA methyltransferase Trm12 (predicted) NP_593066.1 772673 R 284812 CDS SPAC4G8.07c 19113979 2543535 complement(join(774000..774023,774155..774403,774453..775290,775414..775513,775641..776013)) 1 NC_003424.3 tRNA (m5U54) methyltransferase Trm2 (predicted) 776013 2543535 SPAC4G8.07c Schizosaccharomyces pombe 972h- tRNA (m5U54) methyltransferase Trm2 (predicted) NP_593067.1 774000 R 284812 CDS SPAC4G8.08 19113980 2543493 join(777259..777287,777338..777731,777891..778283) 1 NC_003424.3 mitochondrial iron ion transporter (predicted) 778283 2543493 SPAC4G8.08 Schizosaccharomyces pombe 972h- mitochondrial iron ion transporter (predicted) NP_593068.1 777259 D 284812 CDS SPAC4G8.09 19113981 2543476 778532..781156 1 NC_003424.3 mitochondrial leucine-tRNA ligase (predicted) 781156 2543476 SPAC4G8.09 Schizosaccharomyces pombe 972h- mitochondrial leucine-tRNA ligase (predicted) NP_593069.1 778532 D 284812 CDS SPAC4G8.10 19113982 2542969 781487..782035 1 NC_003424.3 SNARE Gos1 (predicted) 782035 gos1 2542969 gos1 Schizosaccharomyces pombe 972h- SNARE Gos1 (predicted) NP_593070.1 781487 D 284812 CDS SPAC4G8.11c 19113983 2542816 complement(join(782142..782336,782438..782704,782803..783144)) 1 NC_003424.3 F1-F0 ATPase assembly protein (predicted) 783144 atp10 2542816 atp10 Schizosaccharomyces pombe 972h- F1-F0 ATPase assembly protein (predicted) NP_593071.1 782142 R 284812 CDS SPAC4G8.12c 19113984 2542832 complement(join(784675..785632,785698..785855,785896..786062,786161..786229,786274..786399,786440..786563)) 1 NC_003424.3 alpha-1,2-mannosyltransferase (predicted) 786563 2542832 SPAC4G8.12c Schizosaccharomyces pombe 972h- alpha-1,2-mannosyltransferase (predicted) NP_593072.1 784675 R 284812 CDS SPAC4G8.13c 19113985 2541806 complement(787119..789164) 1 NC_003424.3 calcineurin responsive transcription factor Prz1 789164 prz1 2541806 prz1 Schizosaccharomyces pombe 972h- calcineurin responsive transcription factor Prz1 NP_593073.1 787119 R 284812 CDS SPAC16C9.01c 63054494 2542315 complement(join(790884..791851,792014..792091,792129..792168)) 1 NC_003424.3 carbohydrate kinase (predicted) 792168 2542315 SPAC16C9.01c Schizosaccharomyces pombe 972h- carbohydrate kinase (predicted) NP_593074.2 790884 R 284812 CDS SPAC16C9.02c 19113988 2542316 complement(join(792689..792949,793049..793609,793659..793760)) 1 NC_003424.3 S-methyl-5-thioadenosine phosphorylase (predicted) 793760 2542316 SPAC16C9.02c Schizosaccharomyces pombe 972h- S-methyl-5-thioadenosine phosphorylase (predicted) NP_593076.1 792689 R 284812 CDS SPAC16C9.03 19113989 2542319 795084..796580 1 NC_003424.3 export adaptor Nmd3 (predicted) 796580 nmd3 2542319 nmd3 Schizosaccharomyces pombe 972h- export adaptor Nmd3 (predicted) NP_593077.1 795084 D 284812 CDS SPAC16C9.04c 19113990 2542325 complement(join(796993..798229,798318..798497,798548..798600)) 1 NC_003424.3 CCR4-Not complex subunit Mot2 (predicted) 798600 mot2 2542325 mot2 Schizosaccharomyces pombe 972h- CCR4-Not complex subunit Mot2 (predicted) NP_593078.1 796993 R 284812 CDS SPAC16C9.05 19113991 2542318 799550..800764 1 NC_003424.3 Clr6 histone deacetylase associated PHD protein-1 Cph1 800764 cph1 2542318 cph1 Schizosaccharomyces pombe 972h- Clr6 histone deacetylase associated PHD protein-1 Cph1 NP_593079.1 799550 D 284812 CDS SPAC16C9.06c 19113992 2542327 complement(801310..804087) 1 NC_003424.3 ATP-dependent RNA helicase Upf1 804087 upf1 2542327 upf1 Schizosaccharomyces pombe 972h- ATP-dependent RNA helicase Upf1 NP_593080.1 801310 R 284812 CDS SPAC16C9.07 63054495 2542326 804996..807506 1 NC_003424.3 serine/threonine protein kinase Ppk5 (predicted) 807506 ppk5 2542326 ppk5 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Ppk5 (predicted) NP_593081.2 804996 D 284812 CDS SPAC2G11.02 19113994 2541516 join(808028..808197,808256..812042) 1 NC_003424.3 ribosome biogenesis protein Urb2 (predicted) 812042 urb2 2541516 urb2 Schizosaccharomyces pombe 972h- ribosome biogenesis protein Urb2 (predicted) NP_593082.1 808028 D 284812 CDS SPAC2G11.03c 19113995 2541485 complement(join(812107..812139,812192..813472,813559..813766,813816..813970)) 1 NC_003424.3 vacuolar sorting protein Vps45 (predicted) 813970 vps45 2541485 vps45 Schizosaccharomyces pombe 972h- vacuolar sorting protein Vps45 (predicted) NP_593083.1 812107 R 284812 CDS SPAC2G11.04 19113996 2541946 814451..815356 1 NC_003424.3 RNA-binding protein, G-patch type (predicted) 815356 2541946 SPAC2G11.04 Schizosaccharomyces pombe 972h- RNA-binding protein, G-patch type (predicted) NP_593084.1 814451 D 284812 CDS SPAC2G11.05c 19113997 2541947 complement(815515..817620) 1 NC_003424.3 NAS to endosome inferred from PMID: 16407402; BRO1 domain protein 817620 2541947 SPAC2G11.05c Schizosaccharomyces pombe 972h- BRO1 domain protein NP_593085.1 815515 R 284812 CDS SPAC2G11.06 19113998 2542054 join(818117..818140,818207..818318,818429..818915,818975..819650) 1 NC_003424.3 AAA family ATPase Vps4 (predicted) 819650 vps4 2542054 vps4 Schizosaccharomyces pombe 972h- AAA family ATPase Vps4 (predicted) NP_593086.1 818117 D 284812 CDS SPAC2G11.07c 19113999 2542008 complement(join(820163..821005,821045..821118,821377..821704)) 1 NC_003424.3 protein phosphatase 2c homolog 3; protein phosphatase 2C Ptc3 821704 ptc3 2542008 ptc3 Schizosaccharomyces pombe 972h- protein phosphatase 2C Ptc3 NP_593087.1 820163 R 284812 CDS SPAC2G11.08c 19114000 2542002 complement(join(822332..822429,822489..822849)) 1 NC_003424.3 SMN family protein Smn1 822849 smn1 2542002 smn1 Schizosaccharomyces pombe 972h- SMN family protein Smn1 NP_593088.1 822332 R 284812 CDS SPAC2G11.09 19114001 2541980 join(823755..823784,823869..826229) 1 NC_003424.3 DUF221 family protein 826229 2541980 SPAC2G11.09 Schizosaccharomyces pombe 972h- DUF221 family protein NP_593089.1 823755 D 284812 CDS SPAC2G11.10c 19114002 2541739 complement(join(826538..827420,827465..827678,827903..828011)) 1 NC_003424.3 URM1 activating enzyme (predicted) 828011 2541739 SPAC2G11.10c Schizosaccharomyces pombe 972h- URM1 activating enzyme (predicted) NP_593090.1 826538 R 284812 CDS SPAC2G11.11c 19114003 2541750 complement(join(829214..829312,829356..829424,829508..831499)) 1 NC_003424.3 ATP-dependent RNA helicase Prh1 831499 prh1 2541750 prh1 Schizosaccharomyces pombe 972h- ATP-dependent RNA helicase Prh1 NP_593091.1 829214 R 284812 CDS SPAC2G11.12 19114004 2541620 832027..836013 1 NC_003424.3 RecQ type DNA helicase Rqh1 836013 rqh1 2541620 rqh1 Schizosaccharomyces pombe 972h- RecQ type DNA helicase Rqh1 NP_593092.1 832027 D 284812 CDS SPAC2G11.13 19114005 2541826 836383..837972 1 NC_003424.3 vacuolar amino acid efflux transporter Atg22 (predicted) 837972 atg22 2541826 atg22 Schizosaccharomyces pombe 972h- vacuolar amino acid efflux transporter Atg22 (predicted) NP_593093.1 836383 D 284812 CDS SPAC2G11.14 19114006 2541848 join(838320..838382,838425..838995,839044..839192,839231..841387) 1 NC_003424.3 transcription factor TFIID complex subunit Taf111 841387 taf111 2541848 taf111 Schizosaccharomyces pombe 972h- transcription factor TFIID complex subunit Taf111 NP_593094.1 838320 D 284812 CDS SPAC2G11.15c 162312378 2542015 complement(join(841572..841859,841908..842053,842126..842241,842321..842490)) 1 NC_003424.3 RNA methyltransferase Tgs1 (predicted) 842490 tgs1 2542015 tgs1 Schizosaccharomyces pombe 972h- RNA methyltransferase Tgs1 (predicted) NP_593095.3 841572 R 284812 CDS SPAC521.02 19114009 2543468 843233..844084 1 NC_003424.3 WLM domain protein 844084 2543468 SPAC521.02 Schizosaccharomyces pombe 972h- WLM domain protein NP_593097.1 843233 D 284812 CDS SPAC521.03 19114010 2543461 845145..845924 1 NC_003424.3 short chain dehydrogenase (predicted) 845924 2543461 SPAC521.03 Schizosaccharomyces pombe 972h- short chain dehydrogenase (predicted) NP_593098.1 845145 D 284812 CDS SPAC521.04c 19114011 2543342 complement(846331..848976) 1 NC_003424.3 calcium permease (predicted) 848976 2543342 SPAC521.04c Schizosaccharomyces pombe 972h- calcium permease (predicted) NP_593099.1 846331 R 284812 CDS SPAC521.05 19114012 2543354 849520..850122 1 NC_003424.3 40S ribosomal protein S8 850122 rps802 2543354 rps802 Schizosaccharomyces pombe 972h- 40S ribosomal protein S8 NP_593100.1 849520 D 284812 CDS SPAC23G3.01 63054498 2541446 join(850676..850691,850730..854346) 1 NC_003424.3 RNA polymerase II complex subunit Rpb2 854346 rpb2 2541446 rpb2 Schizosaccharomyces pombe 972h- RNA polymerase II complex subunit Rpb2 NP_593101.2 850676 D 284812 CDS SPAC23G3.02c 19114014 2541451 complement(join(854523..862924,863155..869527)) 1 NC_003424.3 possible FRAMESHIFT; base-check of problem region in progress; ferrichrome synthetase Sib1 869527 sib1 2541451 sib1 Schizosaccharomyces pombe 972h- ferrichrome synthetase Sib1 NP_593102.1 854523 R 284812 CDS SPAC23G3.03 19114015 2541831 871025..872320 1 NC_003424.3 ornithine N5 monooxygenase (predicted) 872320 sib2 2541831 sib2 Schizosaccharomyces pombe 972h- ornithine N5 monooxygenase (predicted) NP_593103.1 871025 D 284812 CDS SPAC23G3.04 19114016 2541424 873167..873751 1 NC_003424.3 Ino80 complex subunit Ies4 873751 ies4 2541424 ies4 Schizosaccharomyces pombe 972h- Ino80 complex subunit Ies4 NP_593104.1 873167 D 284812 CDS SPAC23G3.05c 19114017 2541778 complement(874532..875563) 1 NC_003424.3 regulator of G-protein signaling (RGS) domain (inferred from context) 875563 2541778 SPAC23G3.05c Schizosaccharomyces pombe 972h- regulator of G-protein signaling (RGS) domain (inferred from context) NP_593105.1 874532 R 284812 CDS SPAC23G3.06 19114018 2541814 join(876947..876962,877004..877106,877175..878582) 1 NC_003424.3 U3 snoRNP protein Nop58 (predicted) 878582 2541814 SPAC23G3.06 Schizosaccharomyces pombe 972h- U3 snoRNP protein Nop58 (predicted) NP_593106.1 876947 D 284812 CDS SPAC23G3.07c 19114019 2541781 complement(join(879214..879835,879987..880189)) 1 NC_003424.3 candidate ortholog for S. cerevisiae YDR073W (SNF11); SWI/SNF complex subunit Snf30 880189 snf30 2541781 snf30 Schizosaccharomyces pombe 972h- SWI/SNF complex subunit Snf30 NP_593107.1 879214 R 284812 CDS SPAC23G3.08c 19114020 2541845 complement(881023..883650) 1 NC_003424.3 ubiquitin C-terminal hydrolase Ubp7 (predicted) 883650 ubp7 2541845 ubp7 Schizosaccharomyces pombe 972h- ubiquitin C-terminal hydrolase Ubp7 (predicted) NP_593108.1 881023 R 284812 CDS SPAC23G3.09 19114021 2541721 884445..885542 1 NC_003424.3 transcription factor TFIID complex subunit Taf4 (predicted) 885542 taf4 2541721 taf4 Schizosaccharomyces pombe 972h- transcription factor TFIID complex subunit Taf4 (predicted) NP_593109.1 884445 D 284812 CDS SPAC23G3.10c 19114022 2541438 complement(885895..887172) 1 NC_003424.3 SWI/SNF and RSC complex subunit Ssr3 887172 ssr3 2541438 ssr3 Schizosaccharomyces pombe 972h- SWI/SNF and RSC complex subunit Ssr3 NP_593110.1 885895 R 284812 CDS SPAC23G3.11 19114023 2541807 join(887661..887836,887899..887981,888027..889033) 1 NC_003424.3 19S proteasome regulatory subunit Rpn6 (predicted) 889033 rpn6 2541807 rpn6 Schizosaccharomyces pombe 972h- 19S proteasome regulatory subunit Rpn6 (predicted) NP_593111.1 887661 D 284812 CDS SPAC23G3.12c 19114024 2541812 complement(889130..892120) 1 NC_003424.3 serine protease (predicted) 892120 2541812 SPAC23G3.12c Schizosaccharomyces pombe 972h- serine protease (predicted) NP_593112.1 889130 R 284812 CDS SPAC22H12.01c 63054499 2541723 complement(893719..894423) 1 NC_003424.3 sequence orphan 894423 mug35 2541723 mug35 Schizosaccharomyces pombe 972h- sequence orphan NP_593113.2 893719 R 284812 CDS SPAC22H12.02 19114026 2541729 join(895366..895407,895597..895765,895823..895974,896039..896401) 1 NC_003424.3 transcription factor TFIIF complex subunit Tfg3 896401 tfg3 2541729 tfg3 Schizosaccharomyces pombe 972h- transcription factor TFIIF complex subunit Tfg3 NP_593114.1 895366 D 284812 CDS SPAC22H12.03 19114027 2541745 join(896877..897163,897242..897767) 1 NC_003424.3 mitochondrial hydrolase (predicted) 897767 2541745 SPAC22H12.03 Schizosaccharomyces pombe 972h- mitochondrial hydrolase (predicted) NP_593115.1 896877 D 284812 CDS SPAC22H12.04c 19114028 2541737 complement(898191..898949) 1 NC_003424.3 40S ribosomal protein S3a (predicted) 898949 rps102 2541737 rps102 Schizosaccharomyces pombe 972h- 40S ribosomal protein S3a (predicted) NP_593116.1 898191 R 284812 CDS SPAC22H12.05c 19114029 2541828 complement(899567..901753) 1 NC_003424.3 fasciclin domain protein 901753 2541828 SPAC22H12.05c Schizosaccharomyces pombe 972h- fasciclin domain protein NP_593117.1 899567 R 284812 CDS SPAC1687.01 63054500 2542799 join(903101..903172,903246..903343,903392..903468,903546..903676) 1 NC_003424.3 DNA-directed RNA polymerase I and III subunit Rpc19 903676 rpc19 2542799 rpc19 Schizosaccharomyces pombe 972h- DNA-directed RNA polymerase I and III subunit Rpc19 NP_593118.2 903101 D 284812 CDS SPAC1687.02 19114032 2542754 join(904266..904628,904680..905132) 1 NC_003424.3 CAAX prenyl protease (predicted) 905132 2542754 SPAC1687.02 Schizosaccharomyces pombe 972h- CAAX prenyl protease (predicted) NP_593120.1 904266 D 284812 CDS SPAC1687.03c 19114033 2542790 complement(join(905129..905977,906033..906144,906288..906355)) 1 NC_003424.3 DNA replication factor C complex subunit Rfc4 (predicted) 906355 rfc4 2542790 rfc4 Schizosaccharomyces pombe 972h- DNA replication factor C complex subunit Rfc4 (predicted) NP_593121.1 905129 R 284812 CDS SPAC1687.04 19114034 2542796 join(906884..907045,907090..908433) 1 NC_003424.3 conserved eukaryotic protein 908433 2542796 SPAC1687.04 Schizosaccharomyces pombe 972h- conserved eukaryotic protein NP_593122.1 906884 D 284812 CDS SPAC1687.05 19114035 2541580 join(908839..908871,908924..911074) 1 NC_003424.3 SUMO E3 ligase Pli1 911074 pli1 2541580 pli1 Schizosaccharomyces pombe 972h- SUMO E3 ligase Pli1 NP_593123.1 908839 D 284812 CDS SPAC1687.06c 19114036 2542782 complement(911274..911678) 1 NC_003424.3 60S ribosomal protein L28/L44 (predicted) 911678 rpl44 2542782 rpl44 Schizosaccharomyces pombe 972h- 60S ribosomal protein L28/L44 (predicted) NP_593124.1 911274 R 284812 CDS SPAC1687.07 19114037 2542784 913657..914031 1 NC_003424.3 conserved fungal protein 914031 2542784 SPAC1687.07 Schizosaccharomyces pombe 972h- conserved fungal protein NP_593125.1 913657 D 284812 CDS SPAC1687.08 19114038 2542803 914328..914618 1 NC_003424.3 sequence orphan 914618 2542803 SPAC1687.08 Schizosaccharomyces pombe 972h- sequence orphan NP_593126.1 914328 D 284812 CDS SPAC1687.09 19114039 2542753 915092..919231 1 NC_003424.3 ENTH/VHS domain protein (predicted) 919231 2542753 SPAC1687.09 Schizosaccharomyces pombe 972h- ENTH/VHS domain protein (predicted) NP_593127.1 915092 D 284812 CDS SPAC1687.10 19114040 2542755 join(919973..920716,920769..922010) 1 NC_003424.3 sequence orphan 922010 mcp1 2542755 mcp1 Schizosaccharomyces pombe 972h- sequence orphan NP_593128.1 919973 D 284812 CDS SPAC1687.11 19114041 2542112 join(922314..922383,922425..922518,922571..922747,922893..924960) 1 NC_003424.3 rRNA methyltransferase Spb1 (predicted) 924960 spb1 2542112 spb1 Schizosaccharomyces pombe 972h- rRNA methyltransferase Spb1 (predicted) NP_593129.1 922314 D 284812 CDS SPAC1687.12c 19114042 2541625 complement(join(925212..925446,925503..925857,925962..926066,926122..926245)) 1 NC_003424.3 ubiquinone biosynthesis protein Coq4 (predicted) 926245 coq4 2541625 coq4 Schizosaccharomyces pombe 972h- ubiquinone biosynthesis protein Coq4 (predicted) NP_593130.1 925212 R 284812 CDS SPAC1687.13c 19114043 2541529 complement(join(926501..926671,926736..927381,927489..927571)) 1 NC_003424.3 COP9/signalosome complex subunit Csn5 927571 csn5 2541529 csn5 Schizosaccharomyces pombe 972h- COP9/signalosome complex subunit Csn5 NP_593131.1 926501 R 284812 CDS SPAC1687.14c 19114044 2542111 complement(928213..928443) 1 NC_003424.3 EF hand family protein, unknown role 928443 2542111 SPAC1687.14c Schizosaccharomyces pombe 972h- EF hand family protein, unknown role NP_593132.1 928213 R 284812 CDS SPAC1687.23c 19114045 2542302 complement(929159..929473) 1 NC_003424.3 sequence orphan 929473 2542302 SPAC1687.23c Schizosaccharomyces pombe 972h- sequence orphan NP_593133.1 929159 R 284812 CDS SPAC1687.15 19114046 2542652 join(929939..929957,930006..930196,930678..931631) 1 NC_003424.3 serine/threonine protein kinase Gsk3 931631 gsk3 2542652 gsk3 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Gsk3 NP_593134.1 929939 D 284812 CDS SPAC1687.16c 19114047 2542109 complement(933052..933954) 1 NC_003424.3 C-5 sterol desaturase Erg3 (predicted) 933954 erg3 2542109 erg3 Schizosaccharomyces pombe 972h- C-5 sterol desaturase Erg3 (predicted) NP_593135.1 933052 R 284812 CDS SPAC1687.17c 19114048 2542379 complement(join(935249..935668,935860..935899,935943..935989)) 1 NC_003424.3 Der1-like (degradation in the ER) family 935989 2542379 SPAC1687.17c Schizosaccharomyces pombe 972h- Der1-like (degradation in the ER) family NP_593136.1 935249 R 284812 CDS SPAC1687.18c 19114049 2542301 complement(join(936271..936371,936453..937719,937760..937891,937928..938107)) 1 NC_003424.3 cohesin loading factor Ssl3 938107 ssl3 2542301 ssl3 Schizosaccharomyces pombe 972h- cohesin loading factor Ssl3 NP_593137.1 936271 R 284812 CDS SPAC1687.19c 19114050 2542133 complement(join(938448..938958,939002..939575,939630..939759)) 1 NC_003424.3 queuine tRNA-ribosyltransferase (predicted) 939759 2542133 SPAC1687.19c Schizosaccharomyces pombe 972h- queuine tRNA-ribosyltransferase (predicted) NP_593138.1 938448 R 284812 CDS SPAC1687.20c 19114051 2542304 complement(939871..941889) 1 NC_003424.3 inner centromere protein Mis6 941889 mis6 2542304 mis6 Schizosaccharomyces pombe 972h- inner centromere protein Mis6 NP_593139.1 939871 R 284812 CDS SPAC1687.21 19114052 2542303 join(942240..942296,942451..942573,942615..942680,942727..942748,942805..943166) 1 NC_003424.3 phosphoglycerate mutase family 943166 2542303 SPAC1687.21 Schizosaccharomyces pombe 972h- phosphoglycerate mutase family NP_593140.1 942240 D 284812 CDS SPAC1687.22c 162312380 2542300 complement(join(943625..943692,943741..943904,943961..945927)) 1 NC_003424.3 RNA-binding protein Puf3 (predicted) 945927 puf3 2542300 puf3 Schizosaccharomyces pombe 972h- RNA-binding protein Puf3 (predicted) NP_593141.2 943625 R 284812 CDS SPAC222.03c 19114054 2541950 complement(join(947964..948132,948481..948581)) 1 NC_003424.3 Tim9-Tim10 complex subunit Tim10 (predicted) 948581 tim10 2541950 tim10 Schizosaccharomyces pombe 972h- Tim9-Tim10 complex subunit Tim10 (predicted) NP_593142.1 947964 R 284812 CDS SPAC222.04c 19114055 2541949 complement(950298..950651) 1 NC_003424.3 Ino80 complex subunit Ies6 950651 ies6 2541949 ies6 Schizosaccharomyces pombe 972h- Ino80 complex subunit Ies6 NP_593143.1 950298 R 284812 CDS SPAC222.05c 19114056 2541951 complement(join(951054..952394,952454..952603)) 1 NC_003424.3 mitochondrial GTPase (predicted) 952603 mss1 2541951 mss1 Schizosaccharomyces pombe 972h- mitochondrial GTPase (predicted) NP_593144.1 951054 R 284812 CDS SPAC222.06 19114057 2541944 join(953113..953174,953228..954074) 1 NC_003424.3 nuclear HMG-like acidic protein Mak16 (predicted) 954074 mak16 2541944 mak16 Schizosaccharomyces pombe 972h- nuclear HMG-like acidic protein Mak16 (predicted) NP_593145.1 953113 D 284812 CDS SPAC222.07c 19114058 2541943 complement(join(954355..955585,955650..956184,956234..956272,956360..956474)) 1 NC_003424.3 eIF2 alpha kinase Hri2 956474 hri2 2541943 hri2 Schizosaccharomyces pombe 972h- eIF2 alpha kinase Hri2 NP_593146.1 954355 R 284812 CDS SPAC222.08c 19114059 2541464 complement(957646..958350) 1 NC_003424.3 imidazoleglycerol-phosphate synthase (predicted) 958350 2541464 SPAC222.08c Schizosaccharomyces pombe 972h- imidazoleglycerol-phosphate synthase (predicted) NP_593147.1 957646 R 284812 CDS SPAC222.09 19114060 2541942 join(960061..960417,960608..962113) 1 NC_003424.3 SEven Binding; RNA-binding protein Seb1 962113 seb1 2541942 seb1 Schizosaccharomyces pombe 972h- RNA-binding protein Seb1 NP_593148.1 960061 D 284812 CDS SPAC222.10c 19114061 2541936 complement(962437..964434) 1 NC_003424.3 two-component GAP Byr4 964434 byr4 2541936 byr4 Schizosaccharomyces pombe 972h- two-component GAP Byr4 NP_593149.1 962437 R 284812 CDS SPAC222.11 19114062 2541934 966430..967368 1 NC_003424.3 coproporphyrinogen III oxidase (predicted) 967368 hem13 2541934 hem13 Schizosaccharomyces pombe 972h- coproporphyrinogen III oxidase (predicted) NP_593150.1 966430 D 284812 CDS SPAC222.17 295442940 9407196 complement(join(967865..967958,968030..968205)) 1 NC_003424.3 conserved fungal protein 968205 9407196 SPAC222.17 Schizosaccharomyces pombe 972h- conserved fungal protein XP_002742501.1 967865 R 284812 CDS SPAC222.12c 19114063 2541927 complement(968783..970360) 1 NC_003424.3 F1-ATPase beta subunit Atp2 970360 atp2 2541927 atp2 Schizosaccharomyces pombe 972h- F1-ATPase beta subunit Atp2 NP_593151.1 968783 R 284812 CDS SPAC222.13c 19114064 2541948 complement(join(971258..971404,971447..972268,972320..972644,972757..973241)) 1 NC_003424.3 6-phosphofructo-2-kinase (predicted) 973241 2541948 SPAC222.13c Schizosaccharomyces pombe 972h- 6-phosphofructo-2-kinase (predicted) NP_593152.1 971258 R 284812 CDS SPAC222.14c 19114065 2541926 complement(join(974167..976137,976245..976330,976389..976463,976577..976733)) 1 NC_003424.3 GTP binding protein Sey1 (predicted) 976733 2541926 SPAC222.14c Schizosaccharomyces pombe 972h- GTP binding protein Sey1 (predicted) NP_593153.1 974167 R 284812 CDS SPAC222.15 67989864 3361533 join(977709..977757,977804..977857,977905..978006,978049..978189,978333..978637) 1 NC_003424.3 originally annotated as a pseudogene because the third intron has a GAG acceptor, in 2 independently sequenced cosmids. But has Meiosis specific transcript disruption of which causes defect in meiosis (pers. comm. Y. Hiraoka); Tat binding protein 1(TBP-1)-interacting protein (TBPIP) homolog (predicted) 978637 meu13 3361533 meu13 Schizosaccharomyces pombe 972h- Tat binding protein 1(TBP-1)-interacting protein (TBPIP) homolog (predicted) NP_001018191.1 977709 D 284812 CDS SPAC222.18 295442942 9407033 join(978903..979021,979120..979176,979215..979374) 1 NC_003424.3 Srp1 family splicing factor 979374 9407033 SPAC222.18 Schizosaccharomyces pombe 972h- Srp1 family splicing factor XP_002742502.1 978903 D 284812 CDS SPAC222.16c 162312382 2541912 complement(join(979679..980026,980093..980239,980289..980378,980434..980532,980628..980774,980846..980898,980944..981064)) 1 NC_003424.3 COP9/signalosome complex subunit Csn3 (predicted) 981064 csn3 2541912 csn3 Schizosaccharomyces pombe 972h- COP9/signalosome complex subunit Csn3 (predicted) NP_593155.2 979679 R 284812 CDS SPAC821.03c 19114068 2543199 complement(981798..983255) 1 NC_003424.3 sequence orphan 983255 2543199 SPAC821.03c Schizosaccharomyces pombe 972h- sequence orphan NP_593156.1 981798 R 284812 CDS SPAC821.04c 19114069 2543204 complement(985011..986747) 1 NC_003424.3 poly(A) polymerase Cid13 986747 cid13 2543204 cid13 Schizosaccharomyces pombe 972h- poly(A) polymerase Cid13 NP_593157.1 985011 R 284812 CDS SPAC821.05 19114070 2543153 join(988397..988422,988462..988568,988748..989688) 1 NC_003424.3 translation initiation factor eIF3h (p40) 989688 2543153 SPAC821.05 Schizosaccharomyces pombe 972h- translation initiation factor eIF3h (p40) NP_593158.1 988397 D 284812 CDS SPAC821.06 19114071 2543513 join(990250..990289,990339..990413,990472..990600,990712..990793,990856..991525) 1 NC_003424.3 septin Spn2 991525 spn2 2543513 spn2 Schizosaccharomyces pombe 972h- septin Spn2 NP_593159.1 990250 D 284812 CDS SPAC821.07c 19114072 2543646 complement(991752..993245) 1 NC_003424.3 Multicopy suppressor of Overexpressed Cyr1; transcription factor Moc3 993245 moc3 2543646 moc3 Schizosaccharomyces pombe 972h- transcription factor Moc3 NP_593160.1 991752 R 284812 CDS SPAC821.08c 19114073 2543222 complement(995476..996942) 1 NC_003424.3 sleepy homolog Slp1 996942 slp1 2543222 slp1 Schizosaccharomyces pombe 972h- sleepy homolog Slp1 NP_593161.1 995476 R 284812 CDS SPAC821.09 19114074 2543379 998953..1002003 1 NC_003424.3 endo-1,3-beta-glucanase Eng1 1002003 eng1 2543379 eng1 Schizosaccharomyces pombe 972h- endo-1,3-beta-glucanase Eng1 NP_593162.1 998953 D 284812 CDS SPAC821.10c 19114075 2542128 complement(1002999..1003463) 1 NC_003424.3 superoxide dismutase Sod1 1003463 sod1 2542128 sod1 Schizosaccharomyces pombe 972h- superoxide dismutase Sod1 NP_593163.1 1002999 R 284812 CDS SPAC821.11 19114076 2543410 1006394..1007749 1 NC_003424.3 gamma-glutamyl phosphate reductase Pro1 (predicted) 1007749 pro1 2543410 pro1 Schizosaccharomyces pombe 972h- gamma-glutamyl phosphate reductase Pro1 (predicted) NP_593164.1 1006394 D 284812 CDS SPAC821.12 19114077 2543441 join(1008439..1008581,1008849..1009023,1009069..1010160) 1 NC_003424.3 serine/threonine protein kinase Orb6 1010160 orb6 2543441 orb6 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Orb6 NP_593165.1 1008439 D 284812 CDS SPAC821.13c 162312384 3361515 complement(1010640..1015328) 1 NC_003424.3 P-type ATPase (predicted) 1015328 3361515 SPAC821.13c Schizosaccharomyces pombe 972h- P-type ATPase (predicted) XP_001713045.1 1010640 R 284812 CDS SPAC139.01c 162312386 2541762 complement(join(1016366..1016669,1016730..1018827,1018869..1018875)) 1 NC_003424.3 nuclease, XP-G family 1018875 2541762 SPAC139.01c Schizosaccharomyces pombe 972h- nuclease, XP-G family XP_001713046.1 1016366 R 284812 CDS SPAC139.02c 19114081 2541790 complement(1019612..1020574) 1 NC_003424.3 mitochondrial anion transporter (predicted) 1020574 oac1 2541790 oac1 Schizosaccharomyces pombe 972h- mitochondrial anion transporter (predicted) NP_593169.1 1019612 R 284812 CDS SPAC139.03 19114082 2541956 join(1021917..1022807,1022847..1023794,1023836..1023874) 1 NC_003424.3 transcription factor, zf-fungal binuclear cluster type (predicted) 1023874 2541956 SPAC139.03 Schizosaccharomyces pombe 972h- transcription factor, zf-fungal binuclear cluster type (predicted) NP_593170.1 1021917 D 284812 CDS SPAC139.04c 19114083 2541766 complement(1024176..1025477) 1 NC_003424.3 L-saccharopine oxidase 1025477 fap2 2541766 fap2 Schizosaccharomyces pombe 972h- L-saccharopine oxidase NP_593171.1 1024176 R 284812 CDS SPAC139.05 19114084 2541647 1028316..1029797 1 NC_003424.3 succinate-semialdehyde dehydrogenase (predicted) 1029797 2541647 SPAC139.05 Schizosaccharomyces pombe 972h- succinate-semialdehyde dehydrogenase (predicted) NP_593172.1 1028316 D 284812 CDS SPAC139.06 63054506 2542502 join(1030230..1030287,1030338..1030441,1030503..1030721,1030811..1030926,1030998..1031361,1031418..1031693) 1 NC_003424.3 PMID:17052979 is pending curation; histone acetyltransferase Hat1 1031693 hat1 2542502 hat1 Schizosaccharomyces pombe 972h- histone acetyltransferase Hat1 NP_593173.2 1030230 D 284812 CDS SPAC23C4.02 19114087 2541961 join(1032182..1032215,1032258..1032310,1032359..1032586,1032628..1032716,1032766..1034167) 1 NC_003424.3 actin binding protein, coronin Crn1 1034167 crn1 2541961 crn1 Schizosaccharomyces pombe 972h- actin binding protein, coronin Crn1 NP_593175.1 1032182 D 284812 CDS SPAC23C4.03 19114088 2541959 1034296..1035762 1 NC_003424.3 haspin related kinase 1035762 2541959 SPAC23C4.03 Schizosaccharomyces pombe 972h- haspin related kinase NP_593176.1 1034296 D 284812 CDS SPAC23C4.04c 295442944 5802865 join(1036033..1036343,1036397..1036508) 1 NC_003424.3 intron confirmed by Solexa transread data; sequence orphan 1036508 5802865 SPAC23C4.04c Schizosaccharomyces pombe 972h- sequence orphan XP_001713047.2 1036033 D 284812 CDS SPAC23C4.05c 19114089 2541954 complement(join(1036833..1038061,1038116..1038182)) 1 NC_003424.3 LEA domain protein 1038182 2541954 SPAC23C4.05c Schizosaccharomyces pombe 972h- LEA domain protein NP_593177.1 1036833 R 284812 CDS SPAC23C4.06c 19114090 2541945 complement(1038666..1039649) 1 NC_003424.3 protein family submitted ISS to be added later; methyltransferase (predicted) 1039649 2541945 SPAC23C4.06c Schizosaccharomyces pombe 972h- methyltransferase (predicted) NP_593178.1 1038666 R 284812 CDS SPAC23C4.07 19114091 2541939 1040241..1040846 1 NC_003424.3 meiotically upregulated gene Mug22 1040846 tht2 2541939 tht2 Schizosaccharomyces pombe 972h- meiotically upregulated gene Mug22 NP_593179.1 1040241 D 284812 CDS SPAC23C4.08 67989891 3361511 join(1041535..1041598,1041673..1041745,1042070..1042550) 1 NC_003424.3 Rho family GTPase Rho3 1042550 rho3 3361511 rho3 Schizosaccharomyces pombe 972h- Rho family GTPase Rho3 NP_001018193.1 1041535 D 284812 CDS SPAC23C4.09c 19114093 2541923 complement(join(1043220..1043264,1043382..1043512,1043596..1043671,1043720..1043789,1044001..1044074)) 1 NC_003424.3 DNA-binding TFAR19-related protein 1044074 2541923 SPAC23C4.09c Schizosaccharomyces pombe 972h- DNA-binding TFAR19-related protein NP_593181.1 1043220 R 284812 CDS SPAC23C4.10 19114094 2541930 1044995..1046578 1 NC_003424.3 guanyl-nucleotide exchange factor Sec2 (predicted) 1046578 sec2 2541930 sec2 Schizosaccharomyces pombe 972h- guanyl-nucleotide exchange factor Sec2 (predicted) NP_593182.1 1044995 D 284812 CDS SPAC23C4.11 19114095 2541918 join(1047316..1047385,1047435..1047485,1047530..1047591) 1 NC_003424.3 F0-ATPase subunit J (predicted) 1047591 atp18 2541918 atp18 Schizosaccharomyces pombe 972h- F0-ATPase subunit J (predicted) NP_593183.1 1047316 D 284812 CDS SPAC23C4.12 19114096 2541929 join(1049035..1049198,1049365..1050088,1050175..1050489) 1 NC_003424.3 serine/threonine protein kinase Hhp2 1050489 hhp2 2541929 hhp2 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Hhp2 NP_593184.1 1049035 D 284812 CDS SPAC23C4.13 19114097 2542068 join(1051729..1051739,1051783..1051921,1051971..1052174) 1 NC_003424.3 SNARE Bet1 1052174 bet1 2542068 bet1 Schizosaccharomyces pombe 972h- SNARE Bet1 NP_593185.1 1051729 D 284812 CDS SPAC23C4.14 19114098 2541937 join(1052984..1053167,1053244..1053676,1053720..1054254,1054346..1054468) 1 NC_003424.3 mannosyltransferase complex subunit Alg1 (predicted) 1054468 alg1 2541937 alg1 Schizosaccharomyces pombe 972h- mannosyltransferase complex subunit Alg1 (predicted) NP_593186.1 1052984 D 284812 CDS SPAC23C4.15 19114099 2541910 join(1054735..1054809,1054874..1054956,1055168..1055642) 1 NC_003424.3 DNA-directed RNA polymerase I, II and III subunit Rpb5 1055642 rpb5 2541910 rpb5 Schizosaccharomyces pombe 972h- DNA-directed RNA polymerase I, II and III subunit Rpb5 NP_593187.1 1054735 D 284812 CDS SPAC23C4.16c 19114100 2541924 complement(1056141..1057415) 1 NC_003424.3 triacylglycerol lipase Atg15 (predicted) 1057415 atg15 2541924 atg15 Schizosaccharomyces pombe 972h- triacylglycerol lipase Atg15 (predicted) NP_593188.1 1056141 R 284812 CDS SPAC23C4.17 19114101 2541917 join(1058395..1058415,1058465..1058514,1058623..1059777,1059838..1060104,1060143..1060674) 1 NC_003424.3 tRNA (cytosine-5-)-methyltransferase (predicted) 1060674 2541917 SPAC23C4.17 Schizosaccharomyces pombe 972h- tRNA (cytosine-5-)-methyltransferase (predicted) NP_593189.1 1058395 D 284812 CDS SPAC23C4.18c 19114102 2543281 complement(join(1060792..1062564,1062631..1062738,1062796..1062861)) 1 NC_003424.3 Defect in REreplication 4 (PMID:15466421); BRCT domain protein Rad4 1062861 rad4 2543281 rad4 Schizosaccharomyces pombe 972h- BRCT domain protein Rad4 NP_593190.1 1060792 R 284812 CDS SPAC23C4.19 19114103 2541916 1063867..1066839 1 NC_003424.3 transcription elongation factor Spt5 1066839 spt5 2541916 spt5 Schizosaccharomyces pombe 972h- transcription elongation factor Spt5 NP_593191.1 1063867 D 284812 CDS SPAC1A6.01c 19114104 2542431 complement(join(1067031..1067718,1067773..1068452)) 1 NC_003424.3 human thyroid receptor interacting protein homolog 1068452 2542431 SPAC1A6.01c Schizosaccharomyces pombe 972h- human thyroid receptor interacting protein homolog NP_593192.1 1067031 R 284812 CDS SPAC1A6.02 162312390 3361484 1068731..1069816 1 NC_003424.3 WD repeat protein, human WDR55 family 1069816 3361484 SPAC1A6.02 Schizosaccharomyces pombe 972h- WD repeat protein, human WDR55 family XP_001713048.1 1068731 D 284812 CDS SPAC1A6.03c 295442946 2542220 complement(join(1070061..1070138,1070205..1072013)) 1 NC_003424.3 phospholipase (predicted) 1072013 2542220 SPAC1A6.03c Schizosaccharomyces pombe 972h- phospholipase (predicted) NP_593194.2 1070061 R 284812 CDS SPAC1A6.11 19114107 2542238 1073534..1073854 1 NC_003424.3 dubious 1073854 2542238 SPAC1A6.11 Schizosaccharomyces pombe 972h- dubious NP_593195.1 1073534 D 284812 CDS SPAC1A6.04c 19114108 2542497 complement(1074777..1076618) 1 NC_003424.3 phospholipase B homolog Plb1 1076618 plb1 2542497 plb1 Schizosaccharomyces pombe 972h- phospholipase B homolog Plb1 NP_593196.1 1074777 R 284812 CDS SPAC1A6.05c 19114109 2542205 complement(join(1080021..1080606,1080659..1081433,1081471..1081561)) 1 NC_003424.3 NAS from PMID:16135509; triacylglycerol lipase 1081561 2542205 SPAC1A6.05c Schizosaccharomyces pombe 972h- triacylglycerol lipase NP_593197.1 1080021 R 284812 CDS SPAC1A6.06c 19114110 2542280 complement(join(1082783..1083142,1083194..1083391)) 1 NC_003424.3 sequence orphan 1083391 meu31 2542280 meu31 Schizosaccharomyces pombe 972h- sequence orphan NP_593198.1 1082783 R 284812 CDS SPAC1A6.07 19114111 2542484 1084175..1086085 1 NC_003424.3 sequence orphan 1086085 2542484 SPAC1A6.07 Schizosaccharomyces pombe 972h- sequence orphan NP_593199.1 1084175 D 284812 CDS SPAC1A6.08c 19114112 2542601 complement(1086376..1087233) 1 NC_003424.3 sequence orphan 1087233 mug125 2542601 mug125 Schizosaccharomyces pombe 972h- sequence orphan NP_593200.1 1086376 R 284812 CDS SPAC1A6.09c 19114113 2542464 complement(1087819..1088991) 1 NC_003424.3 sphingosine N-acyltransferase Lag1 1088991 lag1 2542464 lag1 Schizosaccharomyces pombe 972h- sphingosine N-acyltransferase Lag1 NP_593201.1 1087819 R 284812 CDS SPAC1A6.10 19114114 2542532 1090678..1092135 1 NC_003424.3 Moeb/ThiF domain 1092135 2542532 SPAC1A6.10 Schizosaccharomyces pombe 972h- Moeb/ThiF domain NP_593202.1 1090678 D 284812 CDS SPAC30D11.14c 19114115 2542249 1092441..1094045 1 NC_003424.3 involved in mRNA splicing (pers. comm. J.A. Potashkin); RNA-binding protein 1094045 2542249 SPAC30D11.14c Schizosaccharomyces pombe 972h- RNA-binding protein NP_593203.1 1092441 D 284812 CDS SPAC30D11.13 19114116 2542196 complement(join(1094500..1094560,1094616..1094695,1094745..1094854,1094897..1094920,1095142..1095274,1095328..1095393)) 1 NC_003424.3 SUMO conjugating enzyme Hus5 1095393 hus5 2542196 hus5 Schizosaccharomyces pombe 972h- SUMO conjugating enzyme Hus5 NP_593204.1 1094500 R 284812 CDS SPAC30D11.12 19114117 2541705 complement(join(1096890..1096924,1097012..1097198,1097248..1097250)) 1 NC_003424.3 60S ribosomal protein L38 1097250 rpl3802 2541705 rpl3802 Schizosaccharomyces pombe 972h- 60S ribosomal protein L38 NP_593205.1 1096890 R 284812 CDS SPAC30D11.11 19114118 2542543 complement(1098036..1099364) 1 NC_003424.3 Haemolysin-III family protein 1099364 2542543 SPAC30D11.11 Schizosaccharomyces pombe 972h- Haemolysin-III family protein NP_593206.1 1098036 R 284812 CDS SPAC30D11.10 19114119 2543086 complement(1100128..1101537) 1 NC_003424.3 DNA recombination protein Rad22 1101537 rad22 2543086 rad22 Schizosaccharomyces pombe 972h- DNA recombination protein Rad22 NP_593207.1 1100128 R 284812 CDS SPAC30D11.09 19114120 2543189 complement(join(1101741..1101979,1102023..1102290,1102335..1103747)) 1 NC_003424.3 complexed with Cdc5 protein Cwf19 1103747 cwf19 2543189 cwf19 Schizosaccharomyces pombe 972h- complexed with Cdc5 protein Cwf19 NP_593208.1 1101741 R 284812 CDS SPAC30D11.08c 19114121 2542236 join(1104864..1106203,1106253..1106529) 1 NC_003424.3 PHD finger containing protein Phf2 1106529 phf2 2542236 phf2 Schizosaccharomyces pombe 972h- PHD finger containing protein Phf2 NP_593209.1 1104864 D 284812 CDS SPAC30D11.07 19114122 2543510 complement(1106773..1107840) 1 NC_003424.3 deletion mutant sensitive to MMS (PMID 12675805); DNA endonuclease III 1107840 nth1 2543510 nth1 Schizosaccharomyces pombe 972h- DNA endonuclease III NP_593210.1 1106773 R 284812 CDS SPAC30D11.06c 19114123 2543068 join(1108567..1108703,1108759..1108846,1109055..1110110) 1 NC_003424.3 DUF300 family protein 1110110 2543068 SPAC30D11.06c Schizosaccharomyces pombe 972h- DUF300 family protein NP_593211.1 1108567 D 284812 CDS SPAC30D11.05 19114124 2542114 complement(join(1110117..1110293,1110756..1110809,1110852..1111118)) 1 NC_003424.3 AP-3 adaptor complex subunit Aps3 (predicted) 1111118 aps3 2542114 aps3 Schizosaccharomyces pombe 972h- AP-3 adaptor complex subunit Aps3 (predicted) NP_593212.1 1110117 R 284812 CDS SPAC30D11.04c 19114125 2542254 join(1112214..1112464,1112508..1115736) 1 NC_003424.3 nucleoporin Nup124 1115736 nup124 2542254 nup124 Schizosaccharomyces pombe 972h- nucleoporin Nup124 NP_593213.1 1112214 D 284812 CDS SPAC30D11.03 19114126 2543155 complement(join(1116057..1116202,1116247..1116367,1116415..1118412)) 1 NC_003424.3 ATP-dependent RNA helicase Ddx27/Drs1 (predicted) 1118412 ddx27 2543155 ddx27 Schizosaccharomyces pombe 972h- ATP-dependent RNA helicase Ddx27/Drs1 (predicted) NP_593214.1 1116057 R 284812 CDS SPAC30D11.02c 63054509 2542490 join(1119378..1119620,1119749..1119763) 1 NC_003424.3 previously annotated as dubious, but has localization signal; under 100 amino acid threshold; sequence orphan 1119763 2542490 SPAC30D11.02c Schizosaccharomyces pombe 972h- sequence orphan NP_593215.2 1119378 D 284812 CDS SPAC30D11.01c 63054510 2542098 1120548..1123529 1 NC_003424.3 alpha-glucosidase (predicted) 1123529 2542098 SPAC30D11.01c Schizosaccharomyces pombe 972h- alpha-glucosidase (predicted) NP_593216.2 1120548 D 284812 CDS SPAC56F8.02 19114129 2543329 1124167..1128720 1 NC_003424.3 AMP binding enzyme (predicted) 1128720 2543329 SPAC56F8.02 Schizosaccharomyces pombe 972h- AMP binding enzyme (predicted) NP_593217.1 1124167 D 284812 CDS SPAC56F8.03 19114130 2543241 1129548..1132787 1 NC_003424.3 translation initiation factor IF2 (predicted) 1132787 2543241 SPAC56F8.03 Schizosaccharomyces pombe 972h- translation initiation factor IF2 (predicted) NP_593218.1 1129548 D 284812 CDS SPAC56F8.04c 295442948 2543235 complement(join(1133226..1134283,1134332..1134356)) 1 NC_003424.3 para-hydroxybenzoate--polyprenyltransferase Coq2 1134356 coq2 2543235 coq2 Schizosaccharomyces pombe 972h- para-hydroxybenzoate--polyprenyltransferase Coq2 NP_593219.2 1133226 R 284812 CDS SPAC56F8.05c 295442950 2543229 complement(join(1134697..1135061,1135195..1135402,1135517..1135684,1135729..1135776,1135932..1136003)) 1 NC_003424.3 BAR domain protein (predicted) 1136003 mug64 2543229 mug64 Schizosaccharomyces pombe 972h- BAR domain protein (predicted) NP_593220.2 1134697 R 284812 CDS SPAC56F8.06c 19114133 2543245 complement(join(1136352..1136754,1136797..1137731)) 1 NC_003424.3 dolichyl-phosphate-glucose-glycolipid alpha-glucosyltransferase Alg10 1137731 alg10 2543245 alg10 Schizosaccharomyces pombe 972h- dolichyl-phosphate-glucose-glycolipid alpha-glucosyltransferase Alg10 NP_593221.1 1136352 R 284812 CDS SPAC56F8.07 63054511 2543225 1138566..1139117 1 NC_003424.3 conserved eukaryotic ER membrane protein 1139117 2543225 SPAC56F8.07 Schizosaccharomyces pombe 972h- conserved eukaryotic ER membrane protein NP_593222.2 1138566 D 284812 CDS SPAC56F8.08 67989936 3361477 join(1139130..1139333,1139448..1140242) 1 NC_003424.3 N terminal exon possibly incorrect; possibly spliced upstream to SPAC56F8.11c; UBA domain protein Mud1 1140242 mud1 3361477 mud1 Schizosaccharomyces pombe 972h- UBA domain protein Mud1 NP_001018195.1 1139130 D 284812 CDS SPAC56F8.09 19114135 2543219 1140621..1141577 1 NC_003424.3 rRNA methyltransferase Rrp8 (predicted) 1141577 rrp8 2543219 rrp8 Schizosaccharomyces pombe 972h- rRNA methyltransferase Rrp8 (predicted) NP_593223.1 1140621 D 284812 CDS SPAC56F8.10 19114136 2542993 1143115..1144926 1 NC_003424.3 possibly allelic with met5 (correct map position but mutant not sequenced); methylenetetrahydrofolate reductase Met9 1144926 met9 2542993 met9 Schizosaccharomyces pombe 972h- methylenetetrahydrofolate reductase Met9 NP_593224.1 1143115 D 284812 CDS SPAC56F8.11 19114137 2543318 join(1145542..1145696,1145888..1146041,1146110..1146358) 1 NC_003424.3 signal peptidase subunit Spc3 (predicted) 1146358 spc3 2543318 spc3 Schizosaccharomyces pombe 972h- signal peptidase subunit Spc3 (predicted) NP_593225.1 1145542 D 284812 CDS SPAC56F8.12 19114138 2543326 1146833..1148017 1 NC_003424.3 conserved fungal protein 1148017 2543326 SPAC56F8.12 Schizosaccharomyces pombe 972h- conserved fungal protein NP_593226.1 1146833 D 284812 CDS SPAC56F8.13 19114139 2543322 1149911..1150216 1 NC_003424.3 dubious 1150216 2543322 SPAC56F8.13 Schizosaccharomyces pombe 972h- dubious NP_593227.1 1149911 D 284812 CDS SPAC56F8.14c 19114140 2543306 complement(1150855..1151250) 1 NC_003424.3 has expression profile on microarray in otherwise apparently gene free region; sequence orphan 1151250 mug115 2543306 mug115 Schizosaccharomyces pombe 972h- sequence orphan NP_593228.1 1150855 R 284812 CDS SPAC56F8.15 19114141 2543295 1152068..1152598 1 NC_003424.3 dubious 1152598 2543295 SPAC56F8.15 Schizosaccharomyces pombe 972h- dubious NP_593229.1 1152068 D 284812 CDS SPAC56F8.16 19114142 2543286 1154733..1155974 1 NC_003424.3 transcription factor Esc1 (predicted) 1155974 esc1 2543286 esc1 Schizosaccharomyces pombe 972h- transcription factor Esc1 (predicted) NP_593230.1 1154733 D 284812 CDS SPAC22A12.01c 63054513 2541503 complement(1157110..1158792) 1 NC_003424.3 DNA 5' exonuclease (predicted) 1158792 pso2 2541503 pso2 Schizosaccharomyces pombe 972h- DNA 5' exonuclease (predicted) NP_593231.2 1157110 R 284812 CDS SPAC22A12.02c 19114144 2541510 complement(1159626..1160000) 1 NC_003424.3 has transcript profile on microarray; sequence orphan 1160000 mug103 2541510 mug103 Schizosaccharomyces pombe 972h- sequence orphan NP_593232.1 1159626 R 284812 CDS SPAC22A12.03c 19114145 2541517 complement(1160219..1161352) 1 NC_003424.3 COP9/signalosome complex subunit Csn4 1161352 csn4 2541517 csn4 Schizosaccharomyces pombe 972h- COP9/signalosome complex subunit Csn4 NP_593233.1 1160219 R 284812 CDS SPAC22A12.04c 19114146 2541838 complement(1162244..1162636) 1 NC_003424.3 40S ribosomal protein S15a 1162636 rps2201 2541838 rps2201 Schizosaccharomyces pombe 972h- 40S ribosomal protein S15a NP_593234.1 1162244 R 284812 CDS SPAC22A12.05 19114147 2541521 1163123..1163452 1 NC_003424.3 DNA-directed RNA polymerase III complex subunit Rpc11 1163452 rpc11 2541521 rpc11 Schizosaccharomyces pombe 972h- DNA-directed RNA polymerase III complex subunit Rpc11 NP_593235.1 1163123 D 284812 CDS SPAC22A12.06c 19114148 2541420 complement(1163936..1165225) 1 NC_003424.3 serine hydrolase 1165225 2541420 SPAC22A12.06c Schizosaccharomyces pombe 972h- serine hydrolase NP_593236.1 1163936 R 284812 CDS SPAC22A12.07c 19114149 2541418 complement(1166822..1169503) 1 NC_003424.3 O-glycoside mannosyltransferase 1; protein O-mannosyltransferase Ogm1 1169503 ogm1 2541418 ogm1 Schizosaccharomyces pombe 972h- protein O-mannosyltransferase Ogm1 NP_593237.1 1166822 R 284812 CDS SPAC22A12.08c 19114150 2541442 complement(join(1170196..1170461,1170504..1171270,1171362..1171856,1171900..1171956,1171999..1172126)) 1 NC_003424.3 cardiolipin synthase/ hydrolase fusion protein (predicted) 1172126 2541442 SPAC22A12.08c Schizosaccharomyces pombe 972h- cardiolipin synthase/ hydrolase fusion protein (predicted) NP_593238.1 1170196 R 284812 CDS SPAC22A12.09c 19114151 2541437 complement(join(1172470..1172789,1172833..1173207,1173293..1173609,1173673..1173979,1174029..1174155)) 1 NC_003424.3 splicing factor Sap114 1174155 sap114 2541437 sap114 Schizosaccharomyces pombe 972h- splicing factor Sap114 NP_593239.1 1172470 R 284812 CDS SPAC22A12.10 19114152 2541829 join(1174571..1174707,1174758..1175781) 1 NC_003424.3 diacylglycerol cholinephosphotranferase/ diacylglycerol ethanolaminesphotranferase (predicted) 1175781 2541829 SPAC22A12.10 Schizosaccharomyces pombe 972h- diacylglycerol cholinephosphotranferase/ diacylglycerol ethanolaminesphotranferase (predicted) NP_593240.1 1174571 D 284812 CDS SPAC22A12.11 19114153 2541809 1177065..1178807 1 NC_003424.3 dihydroxyacetone kinase Dak1 1178807 dak1 2541809 dak1 Schizosaccharomyces pombe 972h- dihydroxyacetone kinase Dak1 NP_593241.1 1177065 D 284812 CDS SPAC22A12.12c 19114154 2541837 complement(1179209..1179931) 1 NC_003424.3 exosome subunit Rrp40 (predicted) 1179931 2541837 SPAC22A12.12c Schizosaccharomyces pombe 972h- exosome subunit Rrp40 (predicted) NP_593242.1 1179209 R 284812 CDS SPAC22A12.13 19114155 2541722 1180479..1180841 1 NC_003424.3 pig-P subunit (predicted) 1180841 mug84 2541722 mug84 Schizosaccharomyces pombe 972h- pig-P subunit (predicted) NP_593243.1 1180479 D 284812 CDS SPAC22A12.14c 19114156 2541808 complement(join(1181229..1182122,1182167..1182217,1182273..1182371)) 1 NC_003424.3 BSD domain protein, unknown biological role 1182371 2541808 SPAC22A12.14c Schizosaccharomyces pombe 972h- BSD domain protein, unknown biological role NP_593244.1 1181229 R 284812 CDS SPAC22A12.15c 19114157 2541815 complement(1183312..1185303) 1 NC_003424.3 BiP 1185303 bip1 2541815 bip1 Schizosaccharomyces pombe 972h- BiP NP_593245.1 1183312 R 284812 CDS SPAC22A12.16 19114158 2541811 join(1186314..1186337,1186397..1187851) 1 NC_003424.3 Direction of reaction forming acetyl-CoA and oxaloacetate (PMID:10794176); ATP-citrate synthase subunit 2 (predicted) 1187851 2541811 SPAC22A12.16 Schizosaccharomyces pombe 972h- ATP-citrate synthase subunit 2 (predicted) NP_593246.1 1186314 D 284812 CDS SPAC22A12.17c 19114159 2541844 complement(1188325..1189110) 1 NC_003424.3 short chain dehydrogenase (predicted) 1189110 2541844 SPAC22A12.17c Schizosaccharomyces pombe 972h- short chain dehydrogenase (predicted) NP_593247.1 1188325 R 284812 CDS SPAC4C5.01 295442952 2543527 join(1192545..1192592,1192662..1192704,1192779..1192841,1192916..1193010,1193062..1193145,1193197..1193613) 1 NC_003424.3 haloacid dehalogenase-like hydrolase 1193613 2543527 SPAC4C5.01 Schizosaccharomyces pombe 972h- haloacid dehalogenase-like hydrolase NP_593248.2 1192545 D 284812 CDS SPAC4C5.02c 19114161 2543529 complement(join(1194197..1194407,1194520..1194631,1194711..1194870,1194914..1195036)) 1 NC_003424.3 GTPase Ryh1 1195036 ryh1 2543529 ryh1 Schizosaccharomyces pombe 972h- GTPase Ryh1 NP_593249.1 1194197 R 284812 CDS SPAC4C5.03 19114162 2543590 1196995..1197903 1 NC_003424.3 CTNS domain protein (SMART) 1197903 2543590 SPAC4C5.03 Schizosaccharomyces pombe 972h- CTNS domain protein (SMART) NP_593250.1 1196995 D 284812 CDS SPAC4C5.04 19114163 2543606 join(1198459..1198541,1198592..1199020,1199074..1199219,1199298..1199397,1199454..1199619) 1 NC_003424.3 SUMO E1-like activator enzyme Rad31 1199619 rad31 2543606 rad31 Schizosaccharomyces pombe 972h- SUMO E1-like activator enzyme Rad31 NP_593251.1 1198459 D 284812 CDS SPAC10F6.01c 19114164 2542920 complement(1201077..1205498) 1 NC_003424.3 sulfite reductase Sir1 1205498 sir1 2542920 sir1 Schizosaccharomyces pombe 972h- sulfite reductase Sir1 NP_593252.1 1201077 R 284812 CDS SPAC10F6.02c 19114165 2542978 complement(join(1206925..1210358,1210412..1210484)) 1 NC_003424.3 ATP-dependent RNA helicase Prp22 1210484 prp22 2542978 prp22 Schizosaccharomyces pombe 972h- ATP-dependent RNA helicase Prp22 NP_593253.1 1206925 R 284812 CDS SPAC10F6.03c 19114166 2542937 complement(join(1211446..1211984,1212205..1213468)) 1 NC_003424.3 CTP synthase Cts1 (predicted) 1213468 cts1 2542937 cts1 Schizosaccharomyces pombe 972h- CTP synthase Cts1 (predicted) NP_593254.1 1211446 R 284812 CDS SPAC10F6.04 19114167 2542973 1213726..1214781 1 NC_003424.3 RCC domain protein Ats1 (predicted) 1214781 2542973 SPAC10F6.04 Schizosaccharomyces pombe 972h- RCC domain protein Ats1 (predicted) NP_593255.1 1213726 D 284812 CDS SPAC10F6.05c 19114168 2541642 complement(join(1215121..1215638,1215723..1215861,1215902..1215928)) 1 NC_003424.3 ubiquitin conjugating enzyme Ubc6 1215928 ubc6 2541642 ubc6 Schizosaccharomyces pombe 972h- ubiquitin conjugating enzyme Ubc6 NP_593256.1 1215121 R 284812 CDS SPAC10F6.06 19114169 2543009 1217171..1217944 1 NC_003424.3 RNA-binding protein Vip1 1217944 vip1 2543009 vip1 Schizosaccharomyces pombe 972h- RNA-binding protein Vip1 NP_593257.1 1217171 D 284812 CDS SPAC10F6.07c 19114170 2542934 complement(1218321..1218887) 1 NC_003424.3 sequence orphan 1218887 mug94 2542934 mug94 Schizosaccharomyces pombe 972h- sequence orphan NP_593258.1 1218321 R 284812 CDS SPAC10F6.08c 19114171 2542665 complement(join(1219667..1220440,1220495..1220703,1220755..1220797)) 1 NC_003424.3 Ino80 complex HMG box protein Nht1 1220797 nht1 2542665 nht1 Schizosaccharomyces pombe 972h- Ino80 complex HMG box protein Nht1 NP_593259.1 1219667 R 284812 CDS SPAC10F6.09c 19114172 2543010 complement(join(1221209..1224778,1224822..1224836)) 1 NC_003424.3 mitotic cohesin complex subunit Psm3 1224836 psm3 2543010 psm3 Schizosaccharomyces pombe 972h- mitotic cohesin complex subunit Psm3 NP_593260.1 1221209 R 284812 CDS SPAC10F6.10 19114173 2542923 join(1225599..1225725,1225811..1225936,1225967..1227279) 1 NC_003424.3 protein kinase, RIO family 1227279 2542923 SPAC10F6.10 Schizosaccharomyces pombe 972h- protein kinase, RIO family NP_593261.1 1225599 D 284812 CDS SPAC10F6.11c 19114174 2543011 complement(1227416..1228861) 1 NC_003424.3 autophagy associated kinase activator (predicted) 1228861 2543011 SPAC10F6.11c Schizosaccharomyces pombe 972h- autophagy associated kinase activator (predicted) NP_593262.1 1227416 R 284812 CDS SPAC10F6.12c 19114175 2542982 complement(1229360..1230070) 1 NC_003424.3 protein-S isoprenylcysteine O-methyltransferase Mam4 1230070 mam4 2542982 mam4 Schizosaccharomyces pombe 972h- protein-S isoprenylcysteine O-methyltransferase Mam4 NP_593263.1 1229360 R 284812 CDS SPAC10F6.13c 19114176 2543020 complement(1230788..1232017) 1 NC_003424.3 aspartate aminotransferase (predicted) 1232017 2543020 SPAC10F6.13c Schizosaccharomyces pombe 972h- aspartate aminotransferase (predicted) NP_593264.1 1230788 R 284812 CDS SPAC10F6.14c 19114177 2541671 complement(1232316..1233923) 1 NC_003424.3 ABC1 kinase family protein 1233923 2541671 SPAC10F6.14c Schizosaccharomyces pombe 972h- ABC1 kinase family protein NP_593265.1 1232316 R 284812 CDS SPAC10F6.15 19114178 2543053 1235667..1236965 1 NC_003424.3 S. pombe specific UPF0300 family protein 1 1236965 2543053 SPAC10F6.15 Schizosaccharomyces pombe 972h- S. pombe specific UPF0300 family protein 1 NP_593266.1 1235667 D 284812 CDS SPAC10F6.16 19114179 2542961 join(1238896..1238979,1239025..1239108,1239173..1239424) 1 NC_003424.3 endosulphine family protein 1239424 mug134 2542961 mug134 Schizosaccharomyces pombe 972h- endosulphine family protein NP_593267.1 1238896 D 284812 CDS SPAC10F6.17c 63054514 2543002 complement(1240321..1241655) 1 NC_003424.3 mitochondrial pyruvate dehydrogenase (lipoamide) phosphatase 1241655 2543002 SPAC10F6.17c Schizosaccharomyces pombe 972h- mitochondrial pyruvate dehydrogenase (lipoamide) phosphatase NP_593268.2 1240321 R 284812 CDS SPAC56E4.02c 19114181 2543352 complement(1242295..1242783) 1 NC_003424.3 N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase Alg13 (predicted) 1242783 alg13 2543352 alg13 Schizosaccharomyces pombe 972h- N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase Alg13 (predicted) NP_593269.1 1242295 R 284812 CDS SPAC56E4.03 19114182 2543350 1244051..1245475 1 NC_003424.3 aromatic aminotransferase (predicted) 1245475 2543350 SPAC56E4.03 Schizosaccharomyces pombe 972h- aromatic aminotransferase (predicted) NP_593270.1 1244051 D 284812 CDS SPAC56E4.04c 19114183 2543344 complement(join(1246095..1252807,1253430..1253559)) 1 NC_003424.3 due to absence of mitochondrial signal sequence found on S. cerevisiae YMR207C (PMID:14761959) this protein was only annotated to the cytosol; acetyl-CoA/biotin carboxylase 1253559 cut6 2543344 cut6 Schizosaccharomyces pombe 972h- acetyl-CoA/biotin carboxylase NP_593271.1 1246095 R 284812 CDS SPAC56E4.05 19114184 2543218 join(1255591..1255953,1256012..1256227) 1 NC_003424.3 NOTE:may not be spliced; DUF788 family protein 1256227 mug69 2543218 mug69 Schizosaccharomyces pombe 972h- DUF788 family protein NP_593272.1 1255591 D 284812 CDS SPAC56E4.06c 19114185 2543110 complement(1256566..1258401) 1 NC_003424.3 gamma-glutamyltranspeptidase Ggt2 1258401 ggt2 2543110 ggt2 Schizosaccharomyces pombe 972h- gamma-glutamyltranspeptidase Ggt2 NP_593273.1 1256566 R 284812 CDS SPAC56E4.07 19114186 2543331 1259365..1260072 1 NC_003424.3 N-acetyltransferase (predicted) 1260072 2543331 SPAC56E4.07 Schizosaccharomyces pombe 972h- N-acetyltransferase (predicted) NP_593274.1 1259365 D 284812 CDS SPAC1420.01c 162312392 2542847 complement(join(1260973..1262609,1262655..1262760)) 1 NC_003424.3 DUF1752 family protein, involved in regulation of transcription 1262760 2542847 SPAC1420.01c Schizosaccharomyces pombe 972h- DUF1752 family protein, involved in regulation of transcription XP_001713049.1 1260973 R 284812 CDS SPAC1420.02c 19114189 2542868 complement(1263902..1265542) 1 NC_003424.3 chaperonin-containing T-complex epsilon subunit Cct5 1265542 cct5 2542868 cct5 Schizosaccharomyces pombe 972h- chaperonin-containing T-complex epsilon subunit Cct5 NP_593277.1 1263902 R 284812 CDS SPAC1420.03 19114190 2542907 join(1266269..1266352,1266400..1267647) 1 NC_003424.3 expression level is tightly controlled so that deletion of either copy is compensated (PMID 12783882); 19S proteasome regulatory subunit Rpn501 1267647 rpn501 2542907 rpn501 Schizosaccharomyces pombe 972h- 19S proteasome regulatory subunit Rpn501 NP_593278.1 1266269 D 284812 CDS SPAC1420.04c 63054516 2542827 complement(1267905..1270166) 1 NC_003424.3 pre-rsm22-cox11; fusion cytochrome c oxidase assembly protein Cox1101, mitochondrial ribosomal protein Rsm22 1270166 cox1101 2542827 cox1101 Schizosaccharomyces pombe 972h- fusion cytochrome c oxidase assembly protein Cox1101, mitochondrial ribosomal protein Rsm22 NP_593279.2 1267905 R 284812 CDS SPAPB17E12.02 67992722 3361408 join(1270750..1270916,1271022..1271370,1271445..1271636) 1 NC_003424.3 SMN family protein Yip12 1271636 yip12 3361408 yip12 Schizosaccharomyces pombe 972h- SMN family protein Yip12 NP_001018218.1 1270750 D 284812 CDS SPAPB17E12.03 295442954 3361409 join(1271889..1271972,1272015..1272962) 1 NC_003424.3 ubiquitin-protein ligase E3 (predicted) 1272962 3361409 SPAPB17E12.03 Schizosaccharomyces pombe 972h- ubiquitin-protein ligase E3 (predicted) NP_001018219.2 1271889 D 284812 CDS SPAPB17E12.04c 67992726 3361420 complement(join(1273025..1274077,1274131..1274191,1274231..1274312,1274353..1274447,1274490..1274512)) 1 NC_003424.3 COP9/signalosome complex subunit Csn2 1274512 csn2 3361420 csn2 Schizosaccharomyces pombe 972h- COP9/signalosome complex subunit Csn2 NP_001018220.1 1273025 R 284812 CDS SPAPB17E12.05 67993591 3361407 join(1275535..1275769,1275837..1275871) 1 NC_003424.3 60S ribosomal protein L37 1275871 rpl3703 3361407 rpl3703 Schizosaccharomyces pombe 972h- 60S ribosomal protein L37 NP_001018221.1 1275535 D 284812 CDS SPAPB17E12.07c 67993595 3361398 complement(join(1277785..1278092,1278140..1278974)) 1 NC_003424.3 tRNA-splicing endonuclease subunit catalytic subunit Sen2 1278974 sen2 3361398 sen2 Schizosaccharomyces pombe 972h- tRNA-splicing endonuclease subunit catalytic subunit Sen2 NP_001018222.1 1277785 R 284812 CDS SPAPB17E12.08 295442956 3361399 join(1279573..1279779,1279820..1279869,1279953..1280325) 1 NC_003424.3 gene structure updated to improve homology 12/12/06; N-glycosylation protein (predicted) 1280325 3361399 SPAPB17E12.08 Schizosaccharomyces pombe 972h- N-glycosylation protein (predicted) NP_001018223.3 1279573 D 284812 CDS SPAPB17E12.09 67993601 3361395 join(1280701..1281060,1281107..1281358) 1 NC_003424.3 sequence orphan 1281358 3361395 SPAPB17E12.09 Schizosaccharomyces pombe 972h- sequence orphan NP_001018224.1 1280701 D 284812 CDS SPAPB17E12.10c 67993605 3361435 complement(join(1281414..1282073,1282117..1282167,1282341..1282535)) 1 NC_003424.3 SAM-dependent methyltransferase 1282535 3361435 SPAPB17E12.10c Schizosaccharomyces pombe 972h- SAM-dependent methyltransferase NP_001018225.1 1281414 R 284812 CDS SPAPB17E12.11 67993609 3361396 join(1283130..1283335,1283387..1283504,1283563..1283642,1283759..1284105,1284152..1284330) 1 NC_003424.3 N-oligosaccharyltransferase gamma subunit (predicted) 1284330 3361396 SPAPB17E12.11 Schizosaccharomyces pombe 972h- N-oligosaccharyltransferase gamma subunit (predicted) NP_001018226.1 1283130 D 284812 CDS SPAPB17E12.12c 67993611 3361393 complement(1284531..1285484) 1 NC_003424.3 mitochondrial transporter 1285484 3361393 SPAPB17E12.12c Schizosaccharomyces pombe 972h- mitochondrial transporter NP_001018227.1 1284531 R 284812 CDS SPAPB17E12.13 67993614 3361377 join(1285627..1285629,1285701..1286261) 1 NC_003424.3 60S ribosomal protein L18 1286261 rpl1802 3361377 rpl1802 Schizosaccharomyces pombe 972h- 60S ribosomal protein L18 NP_001018228.1 1285627 D 284812 CDS SPAPB17E12.14c 67993618 3361378 complement(1286916..1288340) 1 NC_003424.3 6-phosphofructo-2-kinase (predicted) 1288340 3361378 SPAPB17E12.14c Schizosaccharomyces pombe 972h- 6-phosphofructo-2-kinase (predicted) NP_001018229.1 1286916 R 284812 CDS SPAC1565.01 19114192 2541595 1291278..1292006 1 NC_003424.3 conserved fungal protein 1292006 2541595 SPAC1565.01 Schizosaccharomyces pombe 972h- conserved fungal protein NP_593280.1 1291278 D 284812 CDS SPAC1565.02c 19114193 2541571 complement(join(1292617..1293689,1293752..1293803)) 1 NC_003424.3 Rho-type GTPase activating protein 1293803 2541571 SPAC1565.02c Schizosaccharomyces pombe 972h- Rho-type GTPase activating protein NP_593281.1 1292617 R 284812 CDS SPAC1565.03 19114194 2541588 1294483..1294983 1 NC_003424.3 has transcript profile on microarray; sequence orphan 1294983 2541588 SPAC1565.03 Schizosaccharomyces pombe 972h- sequence orphan NP_593282.1 1294483 D 284812 CDS SPAC1565.04c 19114195 2541677 complement(join(1295558..1296255,1296414..1296510)) 1 NC_003424.3 adaptor protein Ste4 1296510 ste4 2541677 ste4 Schizosaccharomyces pombe 972h- adaptor protein Ste4 NP_593283.1 1295558 R 284812 CDS SPAC1565.05 19114196 2541440 1297390..1299711 1 NC_003424.3 sequence orphan 1299711 2541440 SPAC1565.05 Schizosaccharomyces pombe 972h- sequence orphan NP_593284.1 1297390 D 284812 CDS SPAC1565.06c 19114197 2542761 complement(join(1300144..1300242,1300282..1300356,1300397..1300480,1300634..1300842,1300889..1301018)) 1 NC_003424.3 GTPase Spg1 1301018 spg1 2542761 spg1 Schizosaccharomyces pombe 972h- GTPase Spg1 NP_593285.1 1300144 R 284812 CDS SPAC1565.07c 19114198 2542767 complement(join(1301917..1305542,1305581..1305617)) 1 NC_003424.3 human CAND1/TIP120 ortholog 1305617 2542767 SPAC1565.07c Schizosaccharomyces pombe 972h- human CAND1/TIP120 ortholog NP_593286.1 1301917 R 284812 CDS SPAC1565.08 63054529 2542744 join(1306439..1306512,1306569..1308942) 1 NC_003424.3 AAA family ATPase Cdc48 1308942 cdc48 2542744 cdc48 Schizosaccharomyces pombe 972h- AAA family ATPase Cdc48 NP_593287.2 1306439 D 284812 CDS SPAC6F12.02 19114200 2543031 1310980..1312683 1 NC_003424.3 transcription factor Rst2 1312683 rst2 2543031 rst2 Schizosaccharomyces pombe 972h- transcription factor Rst2 NP_593288.1 1310980 D 284812 CDS SPAC6F12.03c 19114201 2542946 complement(1313721..1314464) 1 NC_003424.3 fission yeast syntaxin homolog required for vacuolar sorting and fusion; SNARE Fsv1 1314464 fsv1 2542946 fsv1 Schizosaccharomyces pombe 972h- SNARE Fsv1 NP_593289.1 1313721 R 284812 CDS SPAC6F12.04 19114202 2542733 1316099..1316497 1 NC_003424.3 COPI-coated vesicle associated protein (predicted) 1316497 2542733 SPAC6F12.04 Schizosaccharomyces pombe 972h- COPI-coated vesicle associated protein (predicted) NP_593290.1 1316099 D 284812 CDS SPAC6F12.05c 19114203 2543032 complement(1317093..1318802) 1 NC_003424.3 thiamine diphosphokinase Tnr3 1318802 tnr3 2543032 tnr3 Schizosaccharomyces pombe 972h- thiamine diphosphokinase Tnr3 NP_593291.1 1317093 R 284812 CDS SPAC6F12.06 19114204 2543214 1319846..1320463 1 NC_003424.3 Rho GDP dissociation inhibitor Rdi1 (predicted) 1320463 2543214 SPAC6F12.06 Schizosaccharomyces pombe 972h- Rho GDP dissociation inhibitor Rdi1 (predicted) NP_593292.1 1319846 D 284812 CDS SPAC6F12.07 19114205 2542959 join(1321435..1321483,1321782..1321841,1321903..1322088,1322138..1322301) 1 NC_003424.3 mitochondrial TOM complex subunit Tom20 1322301 tom20 2542959 tom20 Schizosaccharomyces pombe 972h- mitochondrial TOM complex subunit Tom20 NP_593293.1 1321435 D 284812 CDS SPAC6F12.08c 295442958 2541515 complement(join(1322439..1323955,1323999..1324140,1324195..1324252,1324299..1324336)) 1 NC_003424.3 exocyst complex subunit Exo84 1324336 2541515 SPAC6F12.08c Schizosaccharomyces pombe 972h- exocyst complex subunit Exo84 NP_593294.2 1322439 R 284812 CDS SPAC6F12.09 19114207 2542198 1325253..1328900 1 NC_003424.3 RNA-directed RNA polymerase Rdp1 1328900 rdp1 2542198 rdp1 Schizosaccharomyces pombe 972h- RNA-directed RNA polymerase Rdp1 NP_593295.1 1325253 D 284812 CDS SPAC6F12.10c 19114208 2542871 complement(1329262..1333233) 1 NC_003424.3 inferred from map position; phosphoribosylformylglycinamidine synthase Ade3 (predicted) 1333233 ade3 2542871 ade3 Schizosaccharomyces pombe 972h- phosphoribosylformylglycinamidine synthase Ade3 (predicted) NP_593296.1 1329262 R 284812 CDS SPAC6F12.11c 19114209 2542856 complement(join(1333665..1334921,1335030..1335143)) 1 NC_003424.3 transcription factor TFIIIC complex A box associated subunit Sfc1 1335143 sfc1 2542856 sfc1 Schizosaccharomyces pombe 972h- transcription factor TFIIIC complex A box associated subunit Sfc1 NP_593297.1 1333665 R 284812 CDS SPAC6F12.12 19114210 2542891 join(1335928..1336320,1336389..1336632,1336705..1336901,1336952..1337346,1337402..1338056) 1 NC_003424.3 protein phosphatase regulatory subunit Par2 1338056 par2 2542891 par2 Schizosaccharomyces pombe 972h- protein phosphatase regulatory subunit Par2 NP_593298.1 1335928 D 284812 CDS SPAC6F12.13c 19114211 2542898 complement(join(1338452..1339375,1339581..1339700)) 1 NC_003424.3 Fps1 appears to have YJL167W has retained the functions YPL069C, Spo9 (Fps1 paralog) appears to have farnesyltransferase like S. cerevisiae BTS1 YPL069C which does not have a direct ortholog in fission yeast; geranyltranstransferase Fps1 1339700 fps1 2542898 fps1 Schizosaccharomyces pombe 972h- geranyltranstransferase Fps1 NP_593299.1 1338452 R 284812 CDS SPAC6F12.14 19114212 2542880 join(1340400..1340533,1340826..1341544,1341583..1342427) 1 NC_003424.3 mutant (cut23-194) is sterile; mutant (cut23-194) is blocked at metaphase; anaphase-promoting complex subunit Apc8 1342427 cut23 2542880 cut23 Schizosaccharomyces pombe 972h- anaphase-promoting complex subunit Apc8 NP_593300.1 1340400 D 284812 CDS SPAC6F12.15c 19114213 2541592 complement(join(1342632..1342922,1342979..1343114,1343168..1344756)) 1 NC_003424.3 Defect in REreplication 1 (PMID:15466421); anaphase-promoting complex subunit Cut9 1344756 cut9 2541592 cut9 Schizosaccharomyces pombe 972h- anaphase-promoting complex subunit Cut9 NP_593301.1 1342632 R 284812 CDS SPAC6F12.16c 19114214 2541639 complement(1345089..1348442) 1 NC_003424.3 ATP-dependent RNA helicase, TRAMP complex subunit Mtr4 1348442 mtr4 2541639 mtr4 Schizosaccharomyces pombe 972h- ATP-dependent RNA helicase, TRAMP complex subunit Mtr4 NP_593302.1 1345089 R 284812 CDS SPAC6F12.17 19114215 2541600 join(1348780..1350871,1350915..1351024) 1 NC_003424.3 mRNA cleavage and polyadenylation specificity factor complex subunit Rna14 1351024 rna14 2541600 rna14 Schizosaccharomyces pombe 972h- mRNA cleavage and polyadenylation specificity factor complex subunit Rna14 NP_593303.1 1348780 D 284812 CDS SPAC19E9.01c 19114216 2542466 complement(join(1352357..1353236,1353424..1353659)) 1 NC_003424.3 (NAS = pers comm Osami Niwa); nucleoporin Nup40 1353659 nup40 2542466 nup40 Schizosaccharomyces pombe 972h- nucleoporin Nup40 NP_593304.1 1352357 R 284812 CDS SPAC19E9.02 19114217 2542237 join(1354360..1354419,1354688..1354711,1354758..1356842) 1 NC_003424.3 serine/threonine protein kinase Fin1 1356842 fin1 2542237 fin1 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Fin1 NP_593305.1 1354360 D 284812 CDS SPAC19E9.03 162312396 3361406 1362571..1363806 1 NC_003424.3 cyclin Pas1 1363806 pas1 3361406 pas1 Schizosaccharomyces pombe 972h- cyclin Pas1 XP_001713050.1 1362571 D 284812 CDS SPAC57A10.02 19114219 2541590 1364846..1367173 1 NC_003424.3 GIN4 family protein kinase Cdr2 1367173 cdr2 2541590 cdr2 Schizosaccharomyces pombe 972h- GIN4 family protein kinase Cdr2 NP_593307.1 1364846 D 284812 CDS SPAC57A10.03 19114220 2543019 join(1368211..1368240,1368281..1368322,1368388..1368441,1368646..1368725,1368808..1368904,1368945..1369109) 1 NC_003424.3 cyclophilin family peptidyl-prolyl cis-trans isomerase Cyp1 1369109 cyp1 2543019 cyp1 Schizosaccharomyces pombe 972h- cyclophilin family peptidyl-prolyl cis-trans isomerase Cyp1 NP_593308.1 1368211 D 284812 CDS SPAC57A10.04 19114221 2541637 join(1370197..1370394,1370458..1371276) 1 NC_003424.3 Rho guanine nucleotide exchange factor (predicted) 1371276 mug10 2541637 mug10 Schizosaccharomyces pombe 972h- Rho guanine nucleotide exchange factor (predicted) NP_593309.1 1370197 D 284812 CDS SPAC57A10.14 67993729 3361397 complement(join(1371718..1372044,1372281..1372307)) 1 NC_003424.3 identified in targeted search for ortholog of S. cerevisiae SGF11, 23 jan 2005; SAGA complex subunit Sgf11 (predicted) 1372307 sgf11 3361397 sgf11 Schizosaccharomyces pombe 972h- SAGA complex subunit Sgf11 (predicted) NP_001018231.1 1371718 R 284812 CDS SPAC57A10.05c 19114222 2542914 complement(1373066..1374883) 1 NC_003424.3 F-box/WD repeat protein protein Pof1 1374883 pof1 2542914 pof1 Schizosaccharomyces pombe 972h- F-box/WD repeat protein protein Pof1 NP_593310.1 1373066 R 284812 CDS SPAC57A10.06 19114223 2542149 join(1376587..1376947,1377032..1377072) 1 NC_003424.3 has transcript profile on microarray; sequence orphan 1377072 mug15 2542149 mug15 Schizosaccharomyces pombe 972h- sequence orphan NP_593311.1 1376587 D 284812 CDS SPAC57A10.07 19114224 2542353 1377305..1378240 1 NC_003424.3 conserved protein (fungal and protazoan) 1378240 2542353 SPAC57A10.07 Schizosaccharomyces pombe 972h- conserved protein (fungal and protazoan) NP_593312.1 1377305 D 284812 CDS SPAC57A10.08c 19114225 2542830 complement(join(1378561..1378620,1378663..1378773,1378823..1379746)) 1 NC_003424.3 NOTE: C-term exons may not be real; carboxylic ester hydrolase activity (predicted) 1379746 2542830 SPAC57A10.08c Schizosaccharomyces pombe 972h- carboxylic ester hydrolase activity (predicted) NP_593313.1 1378561 R 284812 CDS SPAC57A10.09c 19114226 2542878 complement(join(1380838..1380975,1381268..1381326,1381407..1381536)) 1 NC_003424.3 High-mobility group non-histone chromatin protein 1381536 nhp6 2542878 nhp6 Schizosaccharomyces pombe 972h- High-mobility group non-histone chromatin protein NP_593314.1 1380838 R 284812 CDS SPAC57A10.10c 19114227 2541530 complement(join(1382542..1383224,1383300..1383513)) 1 NC_003424.3 La protein homolog 1383513 sla1 2541530 sla1 Schizosaccharomyces pombe 972h- La protein homolog NP_593315.1 1382542 R 284812 CDS SPAC57A10.11c 19114228 2542760 complement(join(1384077..1384723,1384792..1385086)) 1 NC_003424.3 TIM22 inner membrane protein import complex subunit Tim40 1385086 tim40 2542760 tim40 Schizosaccharomyces pombe 972h- TIM22 inner membrane protein import complex subunit Tim40 NP_593316.1 1384077 R 284812 CDS SPAC57A10.12c 19114229 2542781 complement(1385510..1386841) 1 NC_003424.3 S. cerevisiae ortholog is cytoplasmic PMID:1409592; dihydroorotate dehydrogenase Ura3 1386841 ura3 2542781 ura3 Schizosaccharomyces pombe 972h- dihydroorotate dehydrogenase Ura3 NP_593317.1 1385510 R 284812 CDS SPAC20G8.01 63054532 2541849 join(1387944..1388026,1388067..1388574,1388637..1390352) 1 NC_003424.3 nuclear form is initiated from codon 20 (PMID 14752051); ATP-dependent DNA ligase Cdc17 1390352 cdc17 2541849 cdc17 Schizosaccharomyces pombe 972h- ATP-dependent DNA ligase Cdc17 NP_593318.2 1387944 D 284812 CDS SPAC20G8.02 19114231 2541976 1390637..1392910 1 NC_003424.3 mitochondrial phospholipase (predicted) 1392910 2541976 SPAC20G8.02 Schizosaccharomyces pombe 972h- mitochondrial phospholipase (predicted) NP_593319.1 1390637 D 284812 CDS SPAC20G8.03 19114232 2541827 1393896..1395569 1 NC_003424.3 MFS myo-inositol transporter 1395569 itr2 2541827 itr2 Schizosaccharomyces pombe 972h- MFS myo-inositol transporter NP_593320.1 1393896 D 284812 CDS SPAC20G8.04c 19114233 2541985 complement(1396025..1397923) 1 NC_003424.3 mitochondrial electron transfer flavoprotein-ubiquinone oxidoreductase 1397923 2541985 SPAC20G8.04c Schizosaccharomyces pombe 972h- mitochondrial electron transfer flavoprotein-ubiquinone oxidoreductase NP_593321.1 1396025 R 284812 CDS SPAC20G8.05c 19114234 2541975 complement(join(1399798..1399970,1400027..1402464,1402656..1402747,1402806..1402886)) 1 NC_003424.3 cell division control protein Cdc15 1402886 cdc15 2541975 cdc15 Schizosaccharomyces pombe 972h- cell division control protein Cdc15 NP_593322.1 1399798 R 284812 CDS SPAC20G8.06 19114235 2542001 1403322..1409624 1 NC_003424.3 CCR4-Not complex subunit Not1 (predicted) 1409624 not1 2542001 not1 Schizosaccharomyces pombe 972h- CCR4-Not complex subunit Not1 (predicted) NP_593323.1 1403322 D 284812 CDS SPAC20G8.07c 19114236 2541992 complement(1410476..1411135) 1 NC_003424.3 C-8 sterol isomerase Erg2 (predicted) 1411135 erg2 2541992 erg2 Schizosaccharomyces pombe 972h- C-8 sterol isomerase Erg2 (predicted) NP_593324.1 1410476 R 284812 CDS SPAC20G8.08c 19114237 2541983 complement(join(1412062..1412214,1412262..1412792,1412836..1413237,1413276..1413410,1413449..1415062)) 1 NC_003424.3 fun thirty related protein Fft1 1415062 fft1 2541983 fft1 Schizosaccharomyces pombe 972h- fun thirty related protein Fft1 NP_593325.1 1412062 R 284812 CDS SPAC20G8.09c 19114238 2542520 complement(join(1415542..1418440,1418509..1418654,1418694..1418750)) 1 NC_003424.3 N-acetyltransferase Nat10 (predicted) 1418750 nat10 2542520 nat10 Schizosaccharomyces pombe 972h- N-acetyltransferase Nat10 (predicted) NP_593326.1 1415542 R 284812 CDS SPAC20G8.10c 162312398 3361548 complement(1419073..1420467) 1 NC_003424.3 beclin family protein 1420467 3361548 SPAC20G8.10c Schizosaccharomyces pombe 972h- beclin family protein XP_001713051.1 1419073 R 284812 CDS SPAC3A12.02 19114240 2542957 join(1421916..1422071,1422180..1422552,1422611..1422942) 1 NC_003424.3 mitochondrial inorganic diphosphatase (predicted) 1422942 2542957 SPAC3A12.02 Schizosaccharomyces pombe 972h- mitochondrial inorganic diphosphatase (predicted) NP_593328.1 1421916 D 284812 CDS SPAC3A12.03c 19114241 2543036 complement(1423240..1424169) 1 NC_003424.3 meiotic expression upregulated; ubiquitin-protein ligase E3 (predicted) 1424169 mug145 2543036 mug145 Schizosaccharomyces pombe 972h- ubiquitin-protein ligase E3 (predicted) NP_593329.1 1423240 R 284812 CDS SPAC3A12.04c 19114242 2543062 complement(join(1424697..1425161,1425231..1425329,1425372..1425430,1425478..1425562)) 1 NC_003424.3 RNase P and RNase MRP subunit p30 (predicted) 1425562 2543062 SPAC3A12.04c Schizosaccharomyces pombe 972h- RNase P and RNase MRP subunit p30 (predicted) NP_593330.1 1424697 R 284812 CDS SPAC3A12.05c 295442960 2543107 complement(join(1426213..1427148,1427189..1429617,1429709..1429830,1429882..1429913)) 1 NC_003424.3 TATA-binding protein associated factor Taf2 (predicted) 1429913 taf2 2543107 taf2 Schizosaccharomyces pombe 972h- TATA-binding protein associated factor Taf2 (predicted) NP_593331.2 1426213 R 284812 CDS SPAC3A12.06c 19114244 2543183 complement(1430424..1432655) 1 NC_003424.3 sodium/calcium exchanger (predicted) 1432655 2543183 SPAC3A12.06c Schizosaccharomyces pombe 972h- sodium/calcium exchanger (predicted) NP_593332.1 1430424 R 284812 CDS SPAC3A12.19 67993757 3361547 complement(join(1433049..1433153,1433199..1433375)) 1 NC_003424.3 identified in targetted search for YBR282W ortholog 25-09-04; mitochondrial ribosomal protein subunit L27 1433375 3361547 SPAC3A12.19 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit L27 NP_001018233.1 1433049 R 284812 CDS SPAC3A12.07 19114245 2543112 join(1433953..1434002,1434048..1434137,1434184..1434415) 1 NC_003424.3 RNA polymerase II complex subunit Rpb11 1434415 rpb11 2543112 rpb11 Schizosaccharomyces pombe 972h- RNA polymerase II complex subunit Rpb11 NP_593333.1 1433953 D 284812 CDS SPAC3A12.08 19114246 2543186 1435139..1435783 1 NC_003424.3 conserved fungal protein 1435783 2543186 SPAC3A12.08 Schizosaccharomyces pombe 972h- conserved fungal protein NP_593334.1 1435139 D 284812 CDS SPAC3A12.09c 19114247 2543072 complement(1436590..1437462) 1 NC_003424.3 urease accessory protein UreD (predicted) 1437462 2543072 SPAC3A12.09c Schizosaccharomyces pombe 972h- urease accessory protein UreD (predicted) NP_593335.1 1436590 R 284812 CDS SPAC3A12.10 19114248 2542725 1438375..1438905 1 NC_003424.3 60S ribosomal protein L20a 1438905 rpl2001 2542725 rpl2001 Schizosaccharomyces pombe 972h- 60S ribosomal protein L20a NP_593336.1 1438375 D 284812 CDS SPAC3A12.11c 19114249 2542531 complement(join(1439274..1440057,1440112..1440276,1440326..1440543)) 1 NC_003424.3 RNA-binding protein Cwf2 1440543 cwf2 2542531 cwf2 Schizosaccharomyces pombe 972h- RNA-binding protein Cwf2 NP_593337.1 1439274 R 284812 CDS SPAC3A12.12 19114250 2541713 1441109..1441969 1 NC_003424.3 F1-ATPase chaperone Atp11 (predicted) 1441969 atp11 2541713 atp11 Schizosaccharomyces pombe 972h- F1-ATPase chaperone Atp11 (predicted) NP_593338.1 1441109 D 284812 CDS SPAC3A12.13c 19114251 2543108 complement(join(1442261..1443072,1443116..1443128)) 1 NC_003424.3 translation initiation factor eIF3j (p35) 1443128 2543108 SPAC3A12.13c Schizosaccharomyces pombe 972h- translation initiation factor eIF3j (p35) NP_593339.1 1442261 R 284812 CDS SPAC3A12.14 19114252 2543039 join(1444930..1444932,1445059..1445508) 1 NC_003424.3 calmodulin Cam1 1445508 cam1 2543039 cam1 Schizosaccharomyces pombe 972h- calmodulin Cam1 NP_593340.1 1444930 D 284812 CDS SPAC3A12.15 19114253 2542930 1446703..1448973 1 NC_003424.3 GARP complex subunit Vps53 (predicted) 1448973 vps53 2542930 vps53 Schizosaccharomyces pombe 972h- GARP complex subunit Vps53 (predicted) NP_593341.1 1446703 D 284812 CDS SPAC3A12.16c 19114254 2543163 complement(join(1450642..1451004,1451079..1451210)) 1 NC_003424.3 TIM23 translocase complex subunit Tim17 1451210 tim17 2543163 tim17 Schizosaccharomyces pombe 972h- TIM23 translocase complex subunit Tim17 NP_593342.1 1450642 R 284812 CDS SPAC3A12.17c 19114255 2542583 complement(1451957..1453144) 1 NC_003424.3 cysteine synthase Cys12 1453144 cys12 2542583 cys12 Schizosaccharomyces pombe 972h- cysteine synthase Cys12 NP_593343.1 1451957 R 284812 CDS SPAC3A12.18 63054535 2543200 join(1454911..1454927,1455044..1456529) 1 NC_003424.3 glucose-6-phosphate 1-dehydrogenase (predicted) 1456529 zwf1 2543200 zwf1 Schizosaccharomyces pombe 972h- glucose-6-phosphate 1-dehydrogenase (predicted) NP_593344.2 1454911 D 284812 CDS SPAC9.02c 19114257 2543681 complement(join(1457143..1457541,1457639..1457737)) 1 NC_003424.3 N-acetyltransferase (predicted) 1457737 2543681 SPAC9.02c Schizosaccharomyces pombe 972h- N-acetyltransferase (predicted) NP_593345.1 1457143 R 284812 CDS SPAC9.03c 19114258 2543676 complement(1458729..1465259) 1 NC_003424.3 PMID: 16133344 is pending full curation; U5 snRNP complex subunit Brr2 (predicted) 1465259 brr2 2543676 brr2 Schizosaccharomyces pombe 972h- U5 snRNP complex subunit Brr2 (predicted) NP_593346.1 1458729 R 284812 CDS SPAC9.04 19114259 2543673 1465847..1469848 1 NC_003424.3 retrotransposable element 1469848 Tf2-1 2543673 Tf2-1 Schizosaccharomyces pombe 972h- retrotransposable element NP_593347.1 1465847 D 284812 CDS SPAC9.05 162312400 2543668 join(1471060..1472508,1472554..1473383,1473440..1473665) 1 NC_003424.3 ATP-dependent DNA helicase (predicted) 1473665 mfh1 2543668 mfh1 Schizosaccharomyces pombe 972h- ATP-dependent DNA helicase (predicted) NP_593348.2 1471060 D 284812 CDS SPAC9.06c 295442962 2543665 complement(join(1473692..1473885,1473939..1474105,1474153..1474212,1474264..1474341,1474381..1474404,1474460..1474539)) 1 NC_003424.3 adducin 1474539 2543665 SPAC9.06c Schizosaccharomyces pombe 972h- adducin NP_593349.2 1473692 R 284812 CDS SPAC9.07c 19114262 2543662 complement(join(1474909..1475049,1475100..1475899,1475948..1476107)) 1 NC_003424.3 GTPase Rbg1 (predicted) 1476107 2543662 SPAC9.07c Schizosaccharomyces pombe 972h- GTPase Rbg1 (predicted) NP_593350.1 1474909 R 284812 CDS SPAC9.08c 19114263 2543655 complement(1477214..1478062) 1 NC_003424.3 steroid reductase (predicted) 1478062 2543655 SPAC9.08c Schizosaccharomyces pombe 972h- steroid reductase (predicted) NP_593351.1 1477214 R 284812 CDS SPAC9.09 19114264 2543585 1478627..1480921 1 NC_003424.3 accummulation of homocysteine causes a defect in purine biosynthesis (PMID 16436428); homocysteine methyltransferase 1480921 met26 2543585 met26 Schizosaccharomyces pombe 972h- homocysteine methyltransferase NP_593352.1 1478627 D 284812 CDS SPAC9.10 19114265 2543578 1482834..1484609 1 NC_003424.3 the functionally complementing transporters are not orthologous; thiamine transporter Thi9 1484609 thi9 2543578 thi9 Schizosaccharomyces pombe 972h- thiamine transporter Thi9 NP_593353.1 1482834 D 284812 CDS SPAC9.11 19114266 2543579 join(1485818..1485887,1485946..1486862) 1 NC_003424.3 sequence orphan 1486862 2543579 SPAC9.11 Schizosaccharomyces pombe 972h- sequence orphan NP_593354.1 1485818 D 284812 CDS SPAC9.12c 19114267 2543406 complement(join(1487131..1487225,1487287..1488055)) 1 NC_003424.3 F1-ATPase chaperone Atp12 (predicted) 1488055 atp12 2543406 atp12 Schizosaccharomyces pombe 972h- F1-ATPase chaperone Atp12 (predicted) NP_593355.1 1487131 R 284812 CDS SPAC9.13c 162312402 3361543 complement(1488770..1489582) 1 NC_003424.3 splicing factor (predicted) 1489582 cwf16 3361543 cwf16 Schizosaccharomyces pombe 972h- splicing factor (predicted) XP_001713052.1 1488770 R 284812 CDS SPAC5D6.13 162312404 3361544 complement(1490741..1491754) 1 NC_003424.3 Golgi phosphoprotein 3 family 1491754 3361544 SPAC5D6.13 Schizosaccharomyces pombe 972h- Golgi phosphoprotein 3 family XP_001713053.1 1490741 R 284812 CDS SPAC5D6.12 19114270 2541966 complement(1492880..1493824) 1 NC_003424.3 mitochondrial translation protein (predicted) 1493824 2541966 SPAC5D6.12 Schizosaccharomyces pombe 972h- mitochondrial translation protein (predicted) NP_593358.1 1492880 R 284812 CDS SPAC5D6.10c 19114271 2542043 1494670..1495077 1 NC_003424.3 sequence orphan 1495077 mug116 2542043 mug116 Schizosaccharomyces pombe 972h- sequence orphan NP_593359.1 1494670 D 284812 CDS SPAC5D6.09c 19114272 2542020 1497147..1498061 1 NC_003424.3 acetate transporter (predicted) 1498061 mug86 2542020 mug86 Schizosaccharomyces pombe 972h- acetate transporter (predicted) NP_593360.1 1497147 D 284812 CDS SPAC5D6.08c 19114273 2541861 join(1499185..1499358,1499434..1499565) 1 NC_003424.3 meiosis II protein Mes1 1499565 mes1 2541861 mes1 Schizosaccharomyces pombe 972h- meiosis II protein Mes1 NP_593361.1 1499185 D 284812 CDS SPAC5D6.07c 19114274 2541884 1500925..1502412 1 NC_003424.3 PXA domain protein Pxa1 1502412 pxa1 2541884 pxa1 Schizosaccharomyces pombe 972h- PXA domain protein Pxa1 NP_593362.1 1500925 D 284812 CDS SPAC5D6.06c 19114275 2541499 join(1502909..1503373,1503420..1503587) 1 NC_003424.3 UDP-GlcNAc transferase associated protein Alg14 1503587 2541499 SPAC5D6.06c Schizosaccharomyces pombe 972h- UDP-GlcNAc transferase associated protein Alg14 NP_593363.1 1502909 D 284812 CDS SPAC5D6.05 19114276 2541925 complement(join(1503907..1504174,1504228..1504350,1504404..1504509,1504612..1504738)) 1 NC_003424.3 mediator complex subunit Pmc6 1504738 sep11 2541925 sep11 Schizosaccharomyces pombe 972h- mediator complex subunit Pmc6 NP_593364.1 1503907 R 284812 CDS SPAC5D6.04 19114277 2541955 complement(join(1505591..1506583,1506641..1506731,1506768..1506898,1507028..1507171)) 1 NC_003424.3 auxin family transmembrane transporter (predicted) 1507171 2541955 SPAC5D6.04 Schizosaccharomyces pombe 972h- auxin family transmembrane transporter (predicted) NP_593365.1 1505591 R 284812 CDS SPAC5D6.02c 19114278 2541995 1510376..1511278 1 NC_003424.3 chromatin association inferred from composition, localization and low similarity to transcriptional regulators; sequence orphan 1511278 mug165 2541995 mug165 Schizosaccharomyces pombe 972h- sequence orphan NP_593366.1 1510376 D 284812 CDS SPAC5D6.01 19114279 2541977 complement(1511797..1512189) 1 NC_003424.3 40S ribosomal protein S15a 1512189 rps2202 2541977 rps2202 Schizosaccharomyces pombe 972h- 40S ribosomal protein S15a NP_593367.1 1511797 R 284812 CDS SPAC57A7.13 19114280 2542526 complement(join(1512764..1513366,1513409..1514014,1514086..1514316,1514371..1514628)) 1 NC_003424.3 RNA-binding protein, involved in splicing (predicted) 1514628 2542526 SPAC57A7.13 Schizosaccharomyces pombe 972h- RNA-binding protein, involved in splicing (predicted) NP_593368.1 1512764 R 284812 CDS SPAC57A7.12 19114281 2542131 complement(join(1515089..1516663,1516789..1516914)) 1 NC_003424.3 heat shock protein Pdr13 (predicted) 1516914 2542131 SPAC57A7.12 Schizosaccharomyces pombe 972h- heat shock protein Pdr13 (predicted) NP_593369.1 1515089 R 284812 CDS SPAC57A7.11 19114282 2542404 complement(1517349..1521290) 1 NC_003424.3 WD repeat protein, Raptor homolog Mip1 1521290 mip1 2542404 mip1 Schizosaccharomyces pombe 972h- WD repeat protein, Raptor homolog Mip1 NP_593370.1 1517349 R 284812 CDS SPAC57A7.10c 19114283 2542247 join(1521712..1521742,1521787..1523837,1523897..1524532) 1 NC_003424.3 coatomer gamma subunit Sec21 (predicted) 1524532 sec21 2542247 sec21 Schizosaccharomyces pombe 972h- coatomer gamma subunit Sec21 (predicted) NP_593371.1 1521712 D 284812 CDS SPAC57A7.09 19114284 2542187 complement(1525031..1526149) 1 NC_003424.3 human r31343_1 has the same domain combiantion; human RNF family homolog 1526149 2542187 SPAC57A7.09 Schizosaccharomyces pombe 972h- human RNF family homolog NP_593372.1 1525031 R 284812 CDS SPAC57A7.08 19114285 2542255 complement(1527964..1529511) 1 NC_003424.3 serine/threonine protein phosphatase Pzh1 1529511 pzh1 2542255 pzh1 Schizosaccharomyces pombe 972h- serine/threonine protein phosphatase Pzh1 NP_593373.1 1527964 R 284812 CDS SPAC57A7.07c 19114286 2542156 1530189..1531115 1 NC_003424.3 homocysteine methyltransferase (predicted) 1531115 2542156 SPAC57A7.07c Schizosaccharomyces pombe 972h- homocysteine methyltransferase (predicted) NP_593374.1 1530189 D 284812 CDS SPAC57A7.06 19114287 2542351 complement(join(1531313..1533838,1533885..1534148)) 1 NC_003424.3 U3 snoRNP protein Utp14 (predicted) 1534148 2542351 SPAC57A7.06 Schizosaccharomyces pombe 972h- U3 snoRNP protein Utp14 (predicted) NP_593375.1 1531313 R 284812 CDS SPAC57A7.05 19114288 2542893 complement(1534588..1538601) 1 NC_003424.3 conserved protein (fungal and plant) 1538601 2542893 SPAC57A7.05 Schizosaccharomyces pombe 972h- conserved protein (fungal and plant) NP_593376.1 1534588 R 284812 CDS SPAC57A7.04c 19114289 2541505 1542865..1544826 1 NC_003424.3 pab1 used previously by SPAC227.07c; mRNA export shuttling protein 1544826 pabp 2541505 pabp Schizosaccharomyces pombe 972h- mRNA export shuttling protein NP_593377.1 1542865 D 284812 CDS SPAC57A7.15c 295442964 9406917 complement(join(1545348..1545608,1545661..1545813)) 1 NC_003424.3 sequence orphan 1545813 9406917 SPAC57A7.15c Schizosaccharomyces pombe 972h- sequence orphan XP_002742503.1 1545348 R 284812 CDS SPAC167.07c 19114290 2542770 join(1546504..1549487,1549546..1549602,1549647..1549695) 1 NC_003424.3 ubiquitin-protein ligase E3 (predicted) 1549695 2542770 SPAC167.07c Schizosaccharomyces pombe 972h- ubiquitin-protein ligase E3 (predicted) NP_593378.1 1546504 D 284812 CDS SPAC167.06c 19114291 2542762 1550133..1550498 1 NC_003424.3 sequence orphan 1550498 mug143 2542762 mug143 Schizosaccharomyces pombe 972h- sequence orphan NP_593379.1 1550133 D 284812 CDS SPAC167.05 162312406 3361541 complement(1551408..1553213) 1 NC_003424.3 Usp (universal stress protein) family protein, implicated in meiotic chromosome segregation 1553213 3361541 SPAC167.05 Schizosaccharomyces pombe 972h- Usp (universal stress protein) family protein, implicated in meiotic chromosome segregation XP_001713054.1 1551408 R 284812 CDS SPAC167.04 19114293 2542791 complement(join(1554001..1554072,1554135..1554166,1554214..1554292,1554381..1554791)) 1 NC_003424.3 TIM23 translocase complex-associated motor subunit Pam17 (predicted) 1554791 pam17 2542791 pam17 Schizosaccharomyces pombe 972h- TIM23 translocase complex-associated motor subunit Pam17 (predicted) NP_593381.1 1554001 R 284812 CDS SPAC167.03c 19114294 2542774 1555134..1557083 1 NC_003424.3 U4/U6 x U5 tri-snRNP complex subunit Snu66 (predicted) 1557083 snu66 2542774 snu66 Schizosaccharomyces pombe 972h- U4/U6 x U5 tri-snRNP complex subunit Snu66 (predicted) NP_593382.1 1555134 D 284812 CDS SPAC167.02 19114295 2543284 complement(join(1557147..1557410,1557456..1557589,1557628..1557843,1557898..1558014,1558070..1558220,1558268..1558321)) 1 NC_003424.3 geranylgeranyltransferase II beta subunit Ptb1 1558321 ptb1 2543284 ptb1 Schizosaccharomyces pombe 972h- geranylgeranyltransferase II beta subunit Ptb1 NP_593383.1 1557147 R 284812 CDS SPAC167.09 295442966 9407188 join(1558670..1558957,1559007..1559147) 1 NC_003424.3 sequence orphan 1559147 9407188 SPAC167.09 Schizosaccharomyces pombe 972h- sequence orphan XP_002742504.1 1558670 D 284812 CDS SPAC167.01 19114296 2542776 complement(join(1559466..1559639,1559690..1562734)) 1 NC_003424.3 serine/threonine protein kinase Ppk4/ sensor for unfolded proteins in the ER (predicted) 1562734 ire1 2542776 ire1 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Ppk4/ sensor for unfolded proteins in the ER (predicted) NP_593384.1 1559466 R 284812 CDS SPAC167.08 63054539 2542797 complement(1564216..1568217) 1 NC_003424.3 retrotransposable element 1568217 Tf2-2 2542797 Tf2-2 Schizosaccharomyces pombe 972h- retrotransposable element NP_593385.2 1564216 R 284812 CDS SPAC1705.02 19114298 2542345 join(1568863..1568869,1569064..1569160,1569216..1569303) 1 NC_003424.3 human 4F5S homolog 1569303 2542345 SPAC1705.02 Schizosaccharomyces pombe 972h- human 4F5S homolog NP_593386.1 1568863 D 284812 CDS SPAC1705.03c 162312408 3361538 complement(1569995..1571260) 1 NC_003424.3 cell wall protein Ecm33 1571260 ecm33 3361538 ecm33 Schizosaccharomyces pombe 972h- cell wall protein Ecm33 XP_001713055.1 1569995 R 284812 CDS SPAC23H4.18c 19114300 2541897 join(1575410..1575484,1575673..1575822,1575886..1575976,1576021..1576028) 1 NC_003424.3 pop-interacting protein 1; RING-box protein 1 1576028 rbx1 2541897 rbx1 Schizosaccharomyces pombe 972h- RING-box protein 1 NP_593388.1 1575410 D 284812 CDS SPAC23H4.17c 19114301 2541900 1576854..1577912 1 NC_003424.3 cyclin-dependent protein Srb mediator subunit kinase Srb10 1577912 srb10 2541900 srb10 Schizosaccharomyces pombe 972h- cyclin-dependent protein Srb mediator subunit kinase Srb10 NP_593389.1 1576854 D 284812 CDS SPAC23H4.16c 19114302 2541896 join(1578314..1578445,1578492..1578656,1578793..1578984,1579043..1579540) 1 NC_003424.3 possibly broadly conserved (to human), possible conserved motif QAFCI at C term; sequence orphan 1579540 2541896 SPAC23H4.16c Schizosaccharomyces pombe 972h- sequence orphan NP_593390.1 1578314 D 284812 CDS SPAC23H4.15 19114303 2541779 complement(1579756..1582107) 1 NC_003424.3 ribosome biogenesis protein Tsr1 (predicted) 1582107 2541779 SPAC23H4.15 Schizosaccharomyces pombe 972h- ribosome biogenesis protein Tsr1 (predicted) NP_593391.1 1579756 R 284812 CDS SPAC23H4.14 19114304 2541859 complement(join(1582525..1582597,1582657..1585045,1585092..1585196,1585248..1585325,1585371..1585443)) 1 NC_003424.3 guanyl-nucleotide exchange factor, HOPS complex subunit Vam6 (predicted) 1585443 vam6 2541859 vam6 Schizosaccharomyces pombe 972h- guanyl-nucleotide exchange factor, HOPS complex subunit Vam6 (predicted) NP_593392.1 1582525 R 284812 CDS SPAC23H4.21 295442968 9406912 complement(join(1586013..1586096,1586189..1586473)) 1 NC_003424.3 hypothetical protein 1586473 9406912 SPAC23H4.21 Schizosaccharomyces pombe 972h- hypothetical protein XP_002742505.1 1586013 R 284812 CDS SPAC23H4.13c 19114305 2541893 join(1586693..1586863,1586944..1587327) 1 NC_003424.3 nonconsensus branch; dubious 1587327 2541893 SPAC23H4.13c Schizosaccharomyces pombe 972h- dubious NP_593393.1 1586693 D 284812 CDS SPAC23H4.12 19114306 2541858 complement(join(1587489..1587573,1587623..1588551)) 1 NC_003424.3 Clr6 histone deacetylase complex subunit Alp13 1588551 alp13 2541858 alp13 Schizosaccharomyces pombe 972h- Clr6 histone deacetylase complex subunit Alp13 NP_593394.1 1587489 R 284812 CDS SPAC23H4.11c 19114307 2541788 join(1588955..1589391,1589463..1589592) 1 NC_003424.3 centromere localized protein Cnl2 1589592 cnl2 2541788 cnl2 Schizosaccharomyces pombe 972h- centromere localized protein Cnl2 NP_593395.1 1588955 D 284812 CDS SPAC23H4.10c 19114308 2541872 1590100..1591656 1 NC_003424.3 thiamine-phosphate dipyrophosphorylase/hydroxyethylthiazole kinase 1591656 thi4 2541872 thi4 Schizosaccharomyces pombe 972h- thiamine-phosphate dipyrophosphorylase/hydroxyethylthiazole kinase NP_593396.1 1590100 D 284812 CDS SPAC23H4.09 19114309 2541817 complement(1591938..1593083) 1 NC_003424.3 curved DNA-binding protein Cdb4 1593083 cdb4 2541817 cdb4 Schizosaccharomyces pombe 972h- curved DNA-binding protein Cdb4 NP_593397.1 1591938 R 284812 CDS SPAC23H4.08 19114310 2541789 complement(join(1593390..1593780,1593870..1594182,1594272..1594340,1594394..1594454)) 1 NC_003424.3 confirmed intron; 4 predicted exons; RNA polymerase II associated protein (predicted) 1594454 2541789 SPAC23H4.08 Schizosaccharomyces pombe 972h- RNA polymerase II associated protein (predicted) NP_593398.1 1593390 R 284812 CDS SPAC23H4.07c 19114311 2541760 join(1595195..1595362,1595411..1595926) 1 NC_003424.3 signal recognition particle receptor beta subunit Srp102 (predicted) 1595926 srp102 2541760 srp102 Schizosaccharomyces pombe 972h- signal recognition particle receptor beta subunit Srp102 (predicted) NP_593399.1 1595195 D 284812 CDS SPAC23H4.06 19114312 2541752 complement(1596492..1597571) 1 NC_003424.3 glutamate-ammonia ligase Gln1 1597571 gln1 2541752 gln1 Schizosaccharomyces pombe 972h- glutamate-ammonia ligase Gln1 NP_593400.1 1596492 R 284812 CDS SPAC23H4.05c 19114313 2541883 1599331..1599624 1 NC_003424.3 dubious 1599624 2541883 SPAC23H4.05c Schizosaccharomyces pombe 972h- dubious NP_593401.1 1599331 D 284812 CDS SPAC23H4.04 19114314 2541868 complement(join(1601508..1602593,1602681..1602742,1602787..1602886)) 1 NC_003424.3 tRNA(5-methylaminomethyl-2-thiouridylate)- methylt ransferase 1602886 2541868 SPAC23H4.04 Schizosaccharomyces pombe 972h- tRNA(5-methylaminomethyl-2-thiouridylate)- methylt ransferase NP_593402.1 1601508 R 284812 CDS SPAC23H4.03c 19114315 2541782 join(1604075..1604396,1604530..1604858) 1 NC_003424.3 COPII-coated vesicle component Erv25 (predicted) 1604858 erv25 2541782 erv25 Schizosaccharomyces pombe 972h- COPII-coated vesicle component Erv25 (predicted) NP_593403.1 1604075 D 284812 CDS SPAC23H4.02 19114316 2541773 complement(join(1605320..1606803,1606975..1607089)) 1 NC_003424.3 serine/threonine protein kinase Ppk9 (predicted) 1607089 ppk9 2541773 ppk9 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Ppk9 (predicted) NP_593404.1 1605320 R 284812 CDS SPAC23H4.01c 63054541 2541796 1608162..1610999 1 NC_003424.3 sterol binding ankyrin repeat protein 1610999 2541796 SPAC23H4.01c Schizosaccharomyces pombe 972h- sterol binding ankyrin repeat protein NP_593405.2 1608162 D 284812 CDS SPAP27G11.02 19114318 2541892 1611564..1612634 1 NC_003424.3 TPR repeat protein, unknown biological role 1612634 2541892 SPAP27G11.02 Schizosaccharomyces pombe 972h- TPR repeat protein, unknown biological role NP_593406.1 1611564 D 284812 CDS SPAP27G11.03 19114319 2541870 join(1613185..1613854,1613923..1614212) 1 NC_003424.3 D123 family 1614212 2541870 SPAP27G11.03 Schizosaccharomyces pombe 972h- D123 family NP_593407.1 1613185 D 284812 CDS SPAP27G11.04c 19114320 2541987 complement(join(1614501..1615336,1615380..1615491)) 1 NC_003424.3 tRNA specific adenosine deaminase subunit Tad3 (predicted) 1615491 2541987 SPAP27G11.04c Schizosaccharomyces pombe 972h- tRNA specific adenosine deaminase subunit Tad3 (predicted) NP_593408.1 1614501 R 284812 CDS SPAP27G11.05c 19114321 2542058 complement(join(1615930..1618127,1618191..1618349,1618391..1618532,1618583..1618744)) 1 NC_003424.3 vacuolar protein sorting-associated protein Vps41 1618744 vps41 2542058 vps41 Schizosaccharomyces pombe 972h- vacuolar protein sorting-associated protein Vps41 NP_593409.1 1615930 R 284812 CDS SPAP27G11.06c 19114322 2542885 complement(join(1619533..1619727,1619785..1619915,1619969..1620131)) 1 NC_003424.3 AP-1 adaptor complex subunit (predicted) 1620131 2542885 SPAP27G11.06c Schizosaccharomyces pombe 972h- AP-1 adaptor complex subunit (predicted) NP_593410.1 1619533 R 284812 CDS SPAP27G11.07c 19114323 2541953 complement(join(1620498..1620608,1620657..1621262)) 1 NC_003424.3 serine/threonine protein kinase (predicted) 1621262 2541953 SPAP27G11.07c Schizosaccharomyces pombe 972h- serine/threonine protein kinase (predicted) NP_593411.1 1620498 R 284812 CDS SPAP27G11.08c 19114324 2541921 complement(join(1621639..1622195,1622246..1622867)) 1 NC_003424.3 sequence orphan 1622867 meu32 2541921 meu32 Schizosaccharomyces pombe 972h- sequence orphan NP_593412.1 1621639 R 284812 CDS SPAP27G11.09c 19114325 2541490 complement(1623438..1624418) 1 NC_003424.3 GTP cyclohydrolase (predicted) 1624418 2541490 SPAP27G11.09c Schizosaccharomyces pombe 972h- GTP cyclohydrolase (predicted) NP_593413.1 1623438 R 284812 CDS SPAP27G11.10c 19114326 2541770 complement(join(1625076..1629753,1629825..1629841)) 1 NC_003424.3 Sequence differs at C-term to Q9Y8G4, EM:AF055035; nucleoporin Nup184 1629841 nup184 2541770 nup184 Schizosaccharomyces pombe 972h- nucleoporin Nup184 NP_593414.1 1625076 R 284812 CDS SPAP27G11.11c 19114327 2541876 complement(join(1630900..1631098,1631181..1631203)) 1 NC_003424.3 dubious 1631203 2541876 SPAP27G11.11c Schizosaccharomyces pombe 972h- dubious NP_593415.1 1630900 R 284812 CDS SPAP27G11.16 19114328 2541665 1631283..1631597 1 NC_003424.3 previously annotated as dubious, but has localization signal; sequence orphan 1631597 2541665 SPAP27G11.16 Schizosaccharomyces pombe 972h- sequence orphan NP_593416.1 1631283 D 284812 CDS SPAP27G11.12 19114329 2541539 join(1632068..1632087,1632167..1632209,1632362..1632394,1632445..1634742) 1 NC_003424.3 human down-regulated in multiple cancers-1 homolog 1 1634742 2541539 SPAP27G11.12 Schizosaccharomyces pombe 972h- human down-regulated in multiple cancers-1 homolog 1 NP_593417.1 1632068 D 284812 CDS SPAP27G11.13c 19114330 2542636 complement(join(1635258..1635274,1635327..1635504)) 1 NC_003424.3 small nucleolar ribonucleoprotein Nop10 1635504 nop10 2542636 nop10 Schizosaccharomyces pombe 972h- small nucleolar ribonucleoprotein Nop10 NP_593418.1 1635258 R 284812 CDS SPAP27G11.14c 19114331 2542633 complement(1636062..1638131) 1 NC_003424.3 sequence orphan 1638131 2542633 SPAP27G11.14c Schizosaccharomyces pombe 972h- sequence orphan NP_593419.1 1636062 R 284812 CDS SPAP27G11.15 19114332 2541657 join(1638643..1638741,1638783..1639499) 1 NC_003424.3 structure-specific endonuclease catalytic subunit 1639499 slx1 2541657 slx1 Schizosaccharomyces pombe 972h- structure-specific endonuclease catalytic subunit NP_593420.1 1638643 D 284812 CDS SPAC343.01c 162312410 2543184 complement(join(1639539..1640811,1640878..1640885)) 1 NC_003424.3 phosphomevalonate kinase (predicted) 1640885 erg8 2543184 erg8 Schizosaccharomyces pombe 972h- phosphomevalonate kinase (predicted) NP_593421.3 1639539 R 284812 CDS SPAC343.02 19114334 2543125 1641755..1642303 1 NC_003424.3 mitochondrial ribosomal protein subunit L19 1642303 img1 2543125 img1 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit L19 NP_593422.1 1641755 D 284812 CDS SPAC343.03 19114335 2543187 join(1643108..1643126,1643170..1643292,1643510..1643652) 1 NC_003424.3 anaphase-promoting complex subunit Apc11 1643652 apc11 2543187 apc11 Schizosaccharomyces pombe 972h- anaphase-promoting complex subunit Apc11 NP_593423.1 1643108 D 284812 CDS SPAC343.04c 19114336 2543079 complement(join(1643933..1645231,1645356..1645506,1645561..1645634)) 1 NC_003424.3 was incorrectly annotated as gnr1; WD repeat protein, human WDR26 family 1645634 2543079 SPAC343.04c Schizosaccharomyces pombe 972h- WD repeat protein, human WDR26 family NP_593424.1 1643933 R 284812 CDS SPAC343.05 19114337 2541660 join(1647259..1647261,1647317..1647416,1647459..1649215) 1 NC_003424.3 V-type ATPase subunit A 1649215 vma1 2541660 vma1 Schizosaccharomyces pombe 972h- V-type ATPase subunit A NP_593425.1 1647259 D 284812 CDS SPAC343.06c 19114338 2543151 complement(1649612..1650757) 1 NC_003424.3 phospholipid scramblase 1650757 2543151 SPAC343.06c Schizosaccharomyces pombe 972h- phospholipid scramblase NP_593426.1 1649612 R 284812 CDS SPAC343.07 19114339 2543165 join(1651012..1651141,1651185..1651341,1651389..1652076,1652127..1652981) 1 NC_003424.3 RNA-binding protein Mug28 1652981 mug28 2543165 mug28 Schizosaccharomyces pombe 972h- RNA-binding protein Mug28 NP_593427.1 1651012 D 284812 CDS SPAC343.08c 19114340 2542478 complement(join(1653288..1653306,1653356..1653606,1653724..1653783)) 1 NC_003424.3 mitochondrial ribosomal protein subunit Mrp17 1653783 mrp17 2542478 mrp17 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit Mrp17 NP_593428.1 1653288 R 284812 CDS SPAC343.09 19114341 2543170 1654284..1655516 1 NC_003424.3 UBX domain protein Ubx3 1655516 ubx3 2543170 ubx3 Schizosaccharomyces pombe 972h- UBX domain protein Ubx3 NP_593429.1 1654284 D 284812 CDS SPAC343.10 19114342 2543105 1656239..1658164 1 NC_003424.3 methylenetetrahydrofolate reductase Met11 1658164 met11 2543105 met11 Schizosaccharomyces pombe 972h- methylenetetrahydrofolate reductase Met11 NP_593430.1 1656239 D 284812 CDS SPAC343.11c 19114343 2541710 complement(1658475..1663241) 1 NC_003424.3 Multi-copy Suppressor of Chk1 PMID:15082762; multi-copy suppressor of Chk1 1663241 msc1 2541710 msc1 Schizosaccharomyces pombe 972h- multi-copy suppressor of Chk1 NP_593431.1 1658475 R 284812 CDS SPAC343.12 19114344 2543066 1668071..1669279 1 NC_003424.3 conserved fungal protein 1669279 rds1 2543066 rds1 Schizosaccharomyces pombe 972h- conserved fungal protein NP_593432.1 1668071 D 284812 CDS SPAC343.20 19114345 2543162 complement(1669623..1669964) 1 NC_003424.3 has transcript profile on microarray, but appears to be antisense RNA to SPAC343.12; dubious 1669964 2543162 SPAC343.20 Schizosaccharomyces pombe 972h- dubious NP_593433.1 1669623 R 284812 CDS SPAC343.13 19114346 2543074 join(1670355..1670510,1670577..1670813,1670884..1672071) 1 NC_003424.3 mitochondrial glutamyl-tRNA amidotransferase beta subunit (predicted) 1672071 2543074 SPAC343.13 Schizosaccharomyces pombe 972h- mitochondrial glutamyl-tRNA amidotransferase beta subunit (predicted) NP_593434.1 1670355 D 284812 CDS SPAC343.14c 19114347 2543035 complement(join(1672376..1672952,1672999..1673389,1673442..1673655)) 1 NC_003424.3 possibility of internal splice between 33743..33820 which improves homology in alignment; translation initiation factor eIF2B 1673655 2543035 SPAC343.14c Schizosaccharomyces pombe 972h- translation initiation factor eIF2B NP_593435.1 1672376 R 284812 CDS SPAC343.15 19114348 2543065 1673947..1675251 1 NC_003424.3 tRNA isopentenyltransferase 1675251 tit1 2543065 tit1 Schizosaccharomyces pombe 972h- tRNA isopentenyltransferase NP_593436.1 1673947 D 284812 CDS SPAC343.16 19114349 2542867 1675730..1677895 1 NC_003424.3 homoaconitate hydratase Lys2 1677895 lys2 2542867 lys2 Schizosaccharomyces pombe 972h- homoaconitate hydratase Lys2 NP_593437.1 1675730 D 284812 CDS SPAC343.17c 19114350 2543123 complement(join(1678182..1679642,1679699..1679968)) 1 NC_003424.3 WD repeat protein, human WDR70 family 1679968 2543123 SPAC343.17c Schizosaccharomyces pombe 972h- WD repeat protein, human WDR70 family NP_593438.1 1678182 R 284812 CDS SPAC343.18 19114351 2543192 join(1680414..1680435,1680489..1681084) 1 NC_003424.3 SUMO-targeted ubiquitin-protein ligase subunit Rfp2 1681084 rfp2 2543192 rfp2 Schizosaccharomyces pombe 972h- SUMO-targeted ubiquitin-protein ligase subunit Rfp2 NP_593439.1 1680414 D 284812 CDS SPAC343.19 162312412 3361531 1681953..1683827 1 NC_003424.3 phosphatidylinositol 4-kinase Lsb6 (predicted) 1683827 3361531 SPAC343.19 Schizosaccharomyces pombe 972h- phosphatidylinositol 4-kinase Lsb6 (predicted) XP_001713056.1 1681953 D 284812 CDS SPAC824.02 19114353 2542981 1685190..1688618 1 NC_003424.3 GPI inositol deacylase 1688618 2542981 SPAC824.02 Schizosaccharomyces pombe 972h- GPI inositol deacylase NP_593441.1 1685190 D 284812 CDS SPAC824.03c 19114354 2543094 complement(1688902..1689645) 1 NC_003424.3 conserved fungal protein 1689645 2543094 SPAC824.03c Schizosaccharomyces pombe 972h- conserved fungal protein NP_593442.1 1688902 R 284812 CDS SPAC824.04 19114355 2542845 1690362..1691387 1 NC_003424.3 swd2.2; S. pombe paralogues are functionally diverged, S. cerevisiae YKL018W is a member of both CPF and SET1 complex (PMID 14617822); WD repeat protein 1691387 2542845 SPAC824.04 Schizosaccharomyces pombe 972h- WD repeat protein NP_593443.1 1690362 D 284812 CDS SPAC824.05 19114356 2541533 join(1692007..1692037,1692078..1692112,1692161..1692242,1692297..1692406,1692472..1694721) 1 NC_003424.3 HOPS complex subunit Vps16 (predicted) 1694721 vps16 2541533 vps16 Schizosaccharomyces pombe 972h- HOPS complex subunit Vps16 (predicted) NP_593444.1 1692007 D 284812 CDS SPAC824.06 19114357 2542780 join(1695102..1695104,1695152..1695199,1695253..1695624) 1 NC_003424.3 TIM23 translocase complex subunit Tim14 1695624 tim14 2542780 tim14 Schizosaccharomyces pombe 972h- TIM23 translocase complex subunit Tim14 NP_593445.1 1695102 D 284812 CDS SPAC824.07 19114358 2542447 join(1696571..1696689,1696832..1697483) 1 NC_003424.3 hydroxyacylglutathione hydrolase (predicted) 1697483 2542447 SPAC824.07 Schizosaccharomyces pombe 972h- hydroxyacylglutathione hydrolase (predicted) NP_593446.1 1696571 D 284812 CDS SPAC824.08 19114359 2541834 1698038..1699708 1 NC_003424.3 guanosine-diphosphatase Gda1 1699708 gda1 2541834 gda1 Schizosaccharomyces pombe 972h- guanosine-diphosphatase Gda1 NP_593447.1 1698038 D 284812 CDS SPAC824.09c 19114360 2542671 complement(join(1700317..1700959,1701098..1701142,1701214..1701292,1701362..1701405,1701450..1701601)) 1 NC_003424.3 GTPase activating protein (predicted) 1701601 2542671 SPAC824.09c Schizosaccharomyces pombe 972h- GTPase activating protein (predicted) NP_593448.1 1700317 R 284812 CDS SPAC664.01c 19114361 2541633 complement(1703015..1704001) 1 NC_003424.3 chromodomain protein Swi6 1704001 swi6 2541633 swi6 Schizosaccharomyces pombe 972h- chromodomain protein Swi6 NP_593449.1 1703015 R 284812 CDS SPAC664.02c 19114362 2543563 complement(join(1704981..1706291,1706359..1706568,1706691..1706879,1706928..1707080)) 1 NC_003424.3 actin-like protein Arp8 1707080 arp8 2543563 arp8 Schizosaccharomyces pombe 972h- actin-like protein Arp8 NP_593450.1 1704981 R 284812 CDS SPAC664.03 19114363 2543560 join(1708822..1708824,1708859..1710229) 1 NC_003424.3 RNA polymerase II associated Paf1 complex (predicted) 1710229 2543560 SPAC664.03 Schizosaccharomyces pombe 972h- RNA polymerase II associated Paf1 complex (predicted) NP_593451.1 1708822 D 284812 CDS SPAC664.04c 19114364 2543559 complement(join(1710502..1710549,1710693..1711067)) 1 NC_003424.3 40S ribosomal protein S16 1711067 rps1602 2543559 rps1602 Schizosaccharomyces pombe 972h- 40S ribosomal protein S16 NP_593452.1 1710502 R 284812 CDS SPAC664.05 19114365 2543553 1711214..1711840 1 NC_003424.3 60S ribosomal protein L13 1711840 rpl13 2543553 rpl13 Schizosaccharomyces pombe 972h- 60S ribosomal protein L13 NP_593453.1 1711214 D 284812 CDS SPAC664.06 19114366 2543548 join(1712817..1712939,1713157..1713783) 1 NC_003424.3 60S ribosomal protein L7 1713783 rpl703 2543548 rpl703 Schizosaccharomyces pombe 972h- 60S ribosomal protein L7 NP_593454.1 1712817 D 284812 CDS SPAC664.07c 19114367 2543544 complement(join(1714090..1714317,1714374..1714987,1715045..1715378,1715432..1715536)) 1 NC_003424.3 checkpoint clamp complex protein Rad9 1715536 rad9 2543544 rad9 Schizosaccharomyces pombe 972h- checkpoint clamp complex protein Rad9 NP_593455.1 1714090 R 284812 CDS SPAC664.08c 19114368 2543540 complement(join(1716213..1717413,1717475..1717574,1717621..1717668,1717711..1717720)) 1 NC_003424.3 traub family protein (predicted) 1717720 2543540 SPAC664.08c Schizosaccharomyces pombe 972h- traub family protein (predicted) NP_593456.1 1716213 R 284812 CDS SPAC664.09 19114369 2543536 1719496..1721388 1 NC_003424.3 gamma-glutamyltranspeptidase Ggt1 1721388 ggt1 2543536 ggt1 Schizosaccharomyces pombe 972h- gamma-glutamyltranspeptidase Ggt1 NP_593457.1 1719496 D 284812 CDS SPAC664.10 19114370 2543360 join(1721995..1722024,1722070..1724493) 1 NC_003424.3 first exon possibly incorrect; may use MKLNFSNTLQYPHVFGEKEK as alternative first exon; kinesin-like protein Klp2 1724493 klp2 2543360 klp2 Schizosaccharomyces pombe 972h- kinesin-like protein Klp2 NP_593458.1 1721995 D 284812 CDS SPAC664.11 19114371 2543026 1726009..1728033 1 NC_003424.3 mitochondrial heat shock protein Hsp70 1728033 ssc1 2543026 ssc1 Schizosaccharomyces pombe 972h- mitochondrial heat shock protein Hsp70 NP_593459.1 1726009 D 284812 CDS SPAC664.12c 19114372 2543362 complement(join(1728569..1728730,1728817..1728894)) 1 NC_003424.3 LYR family protein 1728894 2543362 SPAC664.12c Schizosaccharomyces pombe 972h- LYR family protein NP_593460.1 1728569 R 284812 CDS SPAC664.13 19114373 2543365 1729505..1729858 1 NC_003424.3 previously annotated as dubious; sequence orphan 1729858 2543365 SPAC664.13 Schizosaccharomyces pombe 972h- sequence orphan NP_593461.1 1729505 D 284812 CDS SPAC664.14 19114374 2543501 1731627..1733165 1 NC_003424.3 ammonium transporter Amt2 1733165 amt2 2543501 amt2 Schizosaccharomyces pombe 972h- ammonium transporter Amt2 NP_593462.1 1731627 D 284812 CDS SPAC664.15 162312414 3361526 1734993..1736948 1 NC_003424.3 CCR4-Not complex subunit Caf4/Mdv1 (predicted) 1736948 caf4 3361526 caf4 Schizosaccharomyces pombe 972h- CCR4-Not complex subunit Caf4/Mdv1 (predicted) XP_001713057.1 1734993 D 284812 CDS SPACUNK12.02c 19114376 2542442 complement(join(1737832..1738198,1738261..1738591,1738664..1738754,1738822..1738876,1738924..1739087)) 1 NC_003424.3 calcium/calmodulin-dependent protein kinase Cmk1 1739087 cmk1 2542442 cmk1 Schizosaccharomyces pombe 972h- calcium/calmodulin-dependent protein kinase Cmk1 NP_593464.1 1737832 R 284812 CDS SPAC105.01c 19114377 2542995 complement(join(1740616..1743124,1743299..1743378,1743421..1743503,1743536..1743560)) 1 NC_003424.3 name from PMID 9428701; potassium ion/proton antiporter 1743560 2542995 SPAC105.01c Schizosaccharomyces pombe 972h- potassium ion/proton antiporter NP_593465.1 1740616 R 284812 CDS SPAC105.02c 19114378 2542971 complement(join(1744748..1744950,1745235..1745519,1745573..1745597)) 1 NC_003424.3 ankyrin repeat protein, unknown biological role 1745597 2542971 SPAC105.02c Schizosaccharomyces pombe 972h- ankyrin repeat protein, unknown biological role NP_593466.1 1744748 R 284812 CDS SPAC105.03c 19114379 2542985 complement(1746918..1749044) 1 NC_003424.3 transcription factor (predicted) 1749044 2542985 SPAC105.03c Schizosaccharomyces pombe 972h- transcription factor (predicted) NP_593467.1 1746918 R 284812 CDS SPAC17A5.01 19114380 2542437 join(1750093..1751448,1751503..1752993) 1 NC_003424.3 peroxin-6 (predicted) 1752993 pex6 2542437 pex6 Schizosaccharomyces pombe 972h- peroxin-6 (predicted) NP_593468.1 1750093 D 284812 CDS SPAC17A5.18c 19114381 2542389 complement(1753207..1753659) 1 NC_003424.3 meiotic recombination protein Rec25 1753659 rec25 2542389 rec25 Schizosaccharomyces pombe 972h- meiotic recombination protein Rec25 NP_593469.1 1753207 R 284812 CDS SPAC17A5.02c 295442971 2542277 complement(join(1754033..1754145,1754186..1754310,1754350..1755118,1755164..1755285,1755331..1755638)) 1 NC_003424.3 we predict different C-terminal; RNA lariat debranching enzyme Dbr1 1755638 dbr1 2542277 dbr1 Schizosaccharomyces pombe 972h- RNA lariat debranching enzyme Dbr1 NP_593470.2 1754033 R 284812 CDS SPAC17A5.03 19114383 2542265 1756109..1757275 1 NC_003424.3 60S ribosomal protein L3 1757275 rpl301 2542265 rpl301 Schizosaccharomyces pombe 972h- 60S ribosomal protein L3 NP_593471.1 1756109 D 284812 CDS SPAC17A5.04c 19114384 2542178 complement(join(1757593..1758185,1758257..1759202)) 1 NC_003424.3 spore wall assembly peptidase Mde10 1759202 mde10 2542178 mde10 Schizosaccharomyces pombe 972h- spore wall assembly peptidase Mde10 NP_593472.1 1757593 R 284812 CDS SPAC17A5.05c 19114385 2542444 complement(1759628..1760371) 1 NC_003424.3 conserved fungal protein 1760371 2542444 SPAC17A5.05c Schizosaccharomyces pombe 972h- conserved fungal protein NP_593473.1 1759628 R 284812 CDS SPAC17A5.06 19114386 2542174 1761787..1764201 1 NC_003424.3 transcription factor TFIIH complex ERCC-3 subunit 1764201 ptr8 2542174 ptr8 Schizosaccharomyces pombe 972h- transcription factor TFIIH complex ERCC-3 subunit NP_593474.1 1761787 D 284812 CDS SPAC17A5.07c 19114387 2542268 complement(join(1764336..1764792,1764877..1765113,1765168..1765272,1765342..1766188,1766337..1766644,1766691..1766695)) 1 NC_003424.3 SUMO deconjugating cysteine peptidase Ulp2 (predicted) 1766695 ulp2 2542268 ulp2 Schizosaccharomyces pombe 972h- SUMO deconjugating cysteine peptidase Ulp2 (predicted) NP_593475.1 1764336 R 284812 CDS SPAC17A5.08 19114388 2542439 1767787..1768419 1 NC_003424.3 COPII-coated vesicle component Erp2/3/4 (predicted) 1768419 2542439 SPAC17A5.08 Schizosaccharomyces pombe 972h- COPII-coated vesicle component Erp2/3/4 (predicted) NP_593476.1 1767787 D 284812 CDS SPAC17A5.09c 19114389 2542189 complement(1769088..1770020) 1 NC_003424.3 conserved WDE*N.*MK**EP*TP[FY]; protein phosphatase regulatory subunit Glc9 1770020 2542189 SPAC17A5.09c Schizosaccharomyces pombe 972h- protein phosphatase regulatory subunit Glc9 NP_593477.1 1769088 R 284812 CDS SPAC17A5.10 19114390 2542245 1770191..1770865 1 NC_003424.3 possily DNAJ needs checking**; conserved fungal protein 1770865 2542245 SPAC17A5.10 Schizosaccharomyces pombe 972h- conserved fungal protein NP_593478.1 1770191 D 284812 CDS SPAC17A5.11 19114391 2542150 join(1772925..1773205,1773264..1773372,1773423..1773500,1773565..1773693,1773763..1774203) 1 NC_003424.3 endonuclease Rec12 1774203 rec12 2542150 rec12 Schizosaccharomyces pombe 972h- endonuclease Rec12 NP_593479.1 1772925 D 284812 CDS SPAC17A5.12 19114392 2542191 1774258..1776351 1 NC_003424.3 possibly needs N-terminal truncating; UBA/TPR/DNAJ domain protein Ucp7 1776351 ucp7 2542191 ucp7 Schizosaccharomyces pombe 972h- UBA/TPR/DNAJ domain protein Ucp7 NP_593480.1 1774258 D 284812 CDS SPAC17A5.13 19114393 2542406 join(1776500..1776608,1776662..1776957,1777069..1777371) 1 NC_003424.3 GTP cyclohydrolase (predicted) 1777371 2542406 SPAC17A5.13 Schizosaccharomyces pombe 972h- GTP cyclohydrolase (predicted) NP_593481.1 1776500 D 284812 CDS SPAC17A5.14 19114394 2542204 join(1778549..1778563,1778602..1778669,1778720..1782623) 1 NC_003424.3 exonuclease II Exo2 1782623 exo2 2542204 exo2 Schizosaccharomyces pombe 972h- exonuclease II Exo2 NP_593482.1 1778549 D 284812 CDS SPAC17A5.15c 19114395 2542408 complement(1782935..1785085) 1 NC_003424.3 Probably cytoplasmic as the mitochondrial glutamate- tRNA ligase has been identified (SPAPB1A10.11C); glutamate-tRNA ligase (predicted) 1785085 2542408 SPAC17A5.15c Schizosaccharomyces pombe 972h- glutamate-tRNA ligase (predicted) NP_593483.1 1782935 R 284812 CDS SPAC17A5.16 19114396 2542168 join(1786438..1786457,1786500..1786542,1786605..1786637,1786706..1787352,1787451..1787658,1787715..1788092,1788192..1788446,1788499..1789692) 1 NC_003424.3 human down-regulated in multiple cancers-1 homolog 3 1789692 2542168 SPAC17A5.16 Schizosaccharomyces pombe 972h- human down-regulated in multiple cancers-1 homolog 3 NP_593484.1 1786438 D 284812 CDS SPAC1610.01 19114397 2542806 1790625..1791278 1 NC_003424.3 conserved fungal protein 1791278 2542806 SPAC1610.01 Schizosaccharomyces pombe 972h- conserved fungal protein NP_593485.1 1790625 D 284812 CDS SPAC1610.02c 162312416 3361520 complement(1791482..1792243) 1 NC_003424.3 mitochondrial ribosomal protein subunit L1 1792243 3361520 SPAC1610.02c Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit L1 NP_001018241.2 1791482 R 284812 CDS SPAC1610.03c 67999533 3361521 complement(join(1792593..1793951,1794023..1794497,1794589..1794766,1794852..1794972)) 1 NC_003424.3 prediction updated 24.1.2001, to change exon 3 start from 3828 to 3777 to comform with crp 79 submission, now has good branch site; poly(A) binding protein Crp79 1794972 crp79 3361521 crp79 Schizosaccharomyces pombe 972h- poly(A) binding protein Crp79 NP_001018242.1 1792593 R 284812 CDS SPAC1610.04 19114399 2542794 1796300..1797880 1 NC_003424.3 localization was additionally determined through the presence of CCCTCTC downstream sequence significantly overrepresented in mitochondrial proteins; meiotically upregulated gene Mug99 1797880 mug99 2542794 mug99 Schizosaccharomyces pombe 972h- meiotically upregulated gene Mug99 NP_593487.1 1796300 D 284812 CDS SPAC1002.01 162312418 3361519 join(1798347..1798830,1798960..1799015) 1 NC_003424.3 conserved fungal protein 1799015 3361519 SPAC1002.01 Schizosaccharomyces pombe 972h- conserved fungal protein XP_001713058.1 1798347 D 284812 CDS SPAC1002.02 19114401 2543270 1799128..1799817 1 NC_003424.3 nucleoporin Pom34 (predicted) 1799817 mug31 2543270 mug31 Schizosaccharomyces pombe 972h- nucleoporin Pom34 (predicted) NP_593489.1 1799128 D 284812 CDS SPAC1002.03c 19114402 2543277 complement(1800212..1802983) 1 NC_003424.3 GLucoSidase II; glucosidase II Gls2 1802983 gls2 2543277 gls2 Schizosaccharomyces pombe 972h- glucosidase II Gls2 NP_593490.1 1800212 R 284812 CDS SPAC1002.04c 19114403 2543276 complement(1803773..1804372) 1 NC_003424.3 transcription factor TFIID complex subunit Taf11 1804372 taf11 2543276 taf11 Schizosaccharomyces pombe 972h- transcription factor TFIID complex subunit Taf11 NP_593491.1 1803773 R 284812 CDS SPAC1002.05c 19114404 2543275 complement(1804650..1806797) 1 NC_003424.3 histone demethylase Jmj2 1806797 jmj2 2543275 jmj2 Schizosaccharomyces pombe 972h- histone demethylase Jmj2 NP_593492.1 1804650 R 284812 CDS SPAC1002.06c 19114405 2543273 complement(join(1807270..1807402,1807483..1807642,1807718..1807781)) 1 NC_003424.3 bouquet formation protein Bqt2 1807781 bqt2 2543273 bqt2 Schizosaccharomyces pombe 972h- bouquet formation protein Bqt2 NP_593493.1 1807270 R 284812 CDS SPAC1002.07c 19114406 2543272 complement(join(1808242..1808376,1808428..1808538,1808630..1808660,1808707..1808741,1808800..1808918,1809166..1809241)) 1 NC_003424.3 human homolog SAT is a Spermidine/spermine N1-acetyltransferase which catalyzes rate-limiting step in polyamine catabolism; N-acetyltransferase Ats1 (predicted) 1809241 ats1 2543272 ats1 Schizosaccharomyces pombe 972h- N-acetyltransferase Ats1 (predicted) NP_593494.1 1808242 R 284812 CDS SPAC1002.08c 19114407 2543271 complement(1810023..1811123) 1 NC_003424.3 mitochondrial RNA polymerase specificity factor 1811123 mtf1 2543271 mtf1 Schizosaccharomyces pombe 972h- mitochondrial RNA polymerase specificity factor NP_593495.1 1810023 R 284812 CDS SPAC1002.09c 19114408 2543269 complement(1812133..1813668) 1 NC_003424.3 dihydrolipoamide dehydrogenase Dld1 1813668 dld1 2543269 dld1 Schizosaccharomyces pombe 972h- dihydrolipoamide dehydrogenase Dld1 NP_593496.1 1812133 R 284812 CDS SPAC1002.10c 19114409 2543266 complement(1813855..1815627) 1 NC_003424.3 SGT1 family transcriptional regulator Sgt1 1815627 sgt1 2543266 sgt1 Schizosaccharomyces pombe 972h- SGT1 family transcriptional regulator Sgt1 NP_593497.1 1813855 R 284812 CDS SPAC1002.11 19114410 2543268 1816653..1818398 1 NC_003424.3 GPI-anchor transamidase complex subunit Gaa1 (predicted) 1818398 gaa1 2543268 gaa1 Schizosaccharomyces pombe 972h- GPI-anchor transamidase complex subunit Gaa1 (predicted) NP_593498.1 1816653 D 284812 CDS SPAC1002.12c 19114411 2543267 complement(1818695..1820191) 1 NC_003424.3 succinate-semialdehyde dehydrogenase (predicted) 1820191 2543267 SPAC1002.12c Schizosaccharomyces pombe 972h- succinate-semialdehyde dehydrogenase (predicted) NP_593499.1 1818695 R 284812 CDS SPAC1002.13c 19114412 2543265 complement(1821936..1823189) 1 NC_003424.3 cell wall protein Psu1, beta-glucosidase (predicted) 1823189 psu1 2543265 psu1 Schizosaccharomyces pombe 972h- cell wall protein Psu1, beta-glucosidase (predicted) NP_593500.1 1821936 R 284812 CDS SPAC1002.20 19114413 2543258 1823972..1824277 1 NC_003424.3 sequence orphan 1824277 2543258 SPAC1002.20 Schizosaccharomyces pombe 972h- sequence orphan NP_593501.1 1823972 D 284812 CDS SPAC1002.14 19114414 2543264 1824785..1826092 1 NC_003424.3 ubiquitin-protein ligase E3 (predicted) 1826092 itt1 2543264 itt1 Schizosaccharomyces pombe 972h- ubiquitin-protein ligase E3 (predicted) NP_593502.1 1824785 D 284812 CDS SPAC1002.15c 19114415 2543263 complement(join(1826160..1826423,1826465..1826547,1826603..1826809,1826965..1827061)) 1 NC_003424.3 mediator complex subunit Pmc5 1827061 pmc5 2543263 pmc5 Schizosaccharomyces pombe 972h- mediator complex subunit Pmc5 NP_593503.1 1826160 R 284812 CDS SPAC1002.16c 19114416 2543262 complement(1827871..1829370) 1 NC_003424.3 nicotinic acid plasma membrane transporter (predicted) 1829370 2543262 SPAC1002.16c Schizosaccharomyces pombe 972h- nicotinic acid plasma membrane transporter (predicted) NP_593504.1 1827871 R 284812 CDS SPAC1002.17c 19114417 2543260 complement(1831012..1831581) 1 NC_003424.3 uracil phosphoribosyltransferase (predicted) 1831581 urg2 2543260 urg2 Schizosaccharomyces pombe 972h- uracil phosphoribosyltransferase (predicted) NP_593505.1 1831012 R 284812 CDS SPAC1002.18 19114418 2543261 1832457..1833656 1 NC_003424.3 DUF1688 family protein 1833656 urg3 2543261 urg3 Schizosaccharomyces pombe 972h- DUF1688 family protein NP_593506.1 1832457 D 284812 CDS SPAC1002.19 19114420 2543259 1835469..1836788 1 NC_003424.3 GTP cyclohydrolase II (predicted) 1836788 urg1 2543259 urg1 Schizosaccharomyces pombe 972h- GTP cyclohydrolase II (predicted) NP_593508.1 1835469 D 284812 CDS SPAC1399.05c 19114421 2542546 join(1838587..1838852,1838970..1840293) 1 NC_003424.3 transcription factor, zf-fungal binuclear cluster type (predicted) 1840293 2542546 SPAC1399.05c Schizosaccharomyces pombe 972h- transcription factor, zf-fungal binuclear cluster type (predicted) NP_593509.1 1838587 D 284812 CDS SPAC1399.04c 19114422 2542614 1840621..1841283 1 NC_003424.3 uracil phosphoribosyltransferase (predicted) 1841283 2542614 SPAC1399.04c Schizosaccharomyces pombe 972h- uracil phosphoribosyltransferase (predicted) NP_593510.1 1840621 D 284812 CDS SPAC1399.03 19114423 2542586 complement(1841936..1843681) 1 NC_003424.3 uracil permease 1843681 fur4 2542586 fur4 Schizosaccharomyces pombe 972h- uracil permease NP_593511.1 1841936 R 284812 CDS SPAC1399.02 19114424 2542530 complement(1846121..1847890) 1 NC_003424.3 membrane transporter 1847890 2542530 SPAC1399.02 Schizosaccharomyces pombe 972h- membrane transporter NP_593512.1 1846121 R 284812 CDS SPAC1399.01c 19114425 2542454 1852627..1854432 1 NC_003424.3 membrane transporter (predicted) 1854432 2542454 SPAC1399.01c Schizosaccharomyces pombe 972h- membrane transporter (predicted) NP_593513.1 1852627 D 284812 CDS SPAP11E10.01 19114426 2541644 1855806..1856798 1 NC_003424.3 ornithine cyclodeaminase family (predicted) 1856798 2541644 SPAP11E10.01 Schizosaccharomyces pombe 972h- ornithine cyclodeaminase family (predicted) NP_593514.1 1855806 D 284812 CDS SPAP11E10.02c 162312420 3361517 complement(1856893..1860141) 1 NC_003424.3 cell agglutination protein Mam3 1860141 mam3 3361517 mam3 Schizosaccharomyces pombe 972h- cell agglutination protein Mam3 XP_001713059.1 1856893 R 284812 CDS SPAPB1A10.02 19114428 2543449 1861934..1862944 1 NC_003424.3 CENP-A chaperone Scm3 1862944 scm3 2543449 scm3 Schizosaccharomyces pombe 972h- CENP-A chaperone Scm3 NP_593516.1 1861934 D 284812 CDS SPAPB1A10.03 295442973 2543644 join(1863363..1863381,1863434..1863762) 1 NC_003424.3 this gene structure was altered based on Solexa transcript data. This resulted in a gene split with the final exon creating a new CDS SPAPB1A10.16; mRNA export receptor Nxt1 1863762 nxt1 2543644 nxt1 Schizosaccharomyces pombe 972h- mRNA export receptor Nxt1 NP_593517.2 1863363 D 284812 CDS SPAPB1A10.16 295442975 9407052 join(1863972..1864360,1864415..1864457) 1 NC_003424.3 this CDS feature was created from what was previouly the C-term exon of SPAPB1A10.03/Nxt1; conserved fungal protein 1864457 9407052 SPAPB1A10.16 Schizosaccharomyces pombe 972h- conserved fungal protein XP_002742506.1 1863972 D 284812 CDS SPAPB1A10.04c 19114430 2543143 complement(join(1864673..1864880,1864932..1865608)) 1 NC_003424.3 geranylgeranyltransferase I alpha subunit Cwp1 1865608 cwp1 2543143 cwp1 Schizosaccharomyces pombe 972h- geranylgeranyltransferase I alpha subunit Cwp1 NP_593518.1 1864673 R 284812 CDS SPAPB1A10.05 19114431 2543600 1867162..1868019 1 NC_003424.3 sequence orphan 1868019 2543600 SPAPB1A10.05 Schizosaccharomyces pombe 972h- sequence orphan NP_593519.1 1867162 D 284812 CDS SPAPB1A10.06c 19114432 2543371 complement(join(1868252..1871515,1871563..1871850)) 1 NC_003424.3 ATP-dependent RNA helicase Dhr1 (predicted) 1871850 2543371 SPAPB1A10.06c Schizosaccharomyces pombe 972h- ATP-dependent RNA helicase Dhr1 (predicted) NP_593520.1 1868252 R 284812 CDS SPAPB1A10.07c 19114433 2543369 complement(join(1872423..1872472,1872522..1873797)) 1 NC_003424.3 sphingolipid biosynthesis protein 1873797 2543369 SPAPB1A10.07c Schizosaccharomyces pombe 972h- sphingolipid biosynthesis protein NP_593521.1 1872423 R 284812 CDS SPAPB1A10.08 19114434 2543374 join(1876271..1876886,1876959..1877581) 1 NC_003424.3 sequence orphan 1877581 2543374 SPAPB1A10.08 Schizosaccharomyces pombe 972h- sequence orphan NP_593522.1 1876271 D 284812 CDS SPAPB1A10.09 19114435 2543372 join(1878362..1878785,1878833..1880604) 1 NC_003424.3 antiparallel microtubule cross-linking factor Ase1 1880604 ase1 2543372 ase1 Schizosaccharomyces pombe 972h- antiparallel microtubule cross-linking factor Ase1 NP_593523.1 1878362 D 284812 CDS SPAPB1A10.10c 19114436 2543411 complement(join(1880879..1881325,1881380..1881478,1881830..1881910)) 1 NC_003424.3 GTPase Ypt71 1881910 ypt71 2543411 ypt71 Schizosaccharomyces pombe 972h- GTPase Ypt71 NP_593524.1 1880879 R 284812 CDS SPAPB1A10.11c 19114437 2543394 complement(1882471..1884051) 1 NC_003424.3 mitochondrial glutamyl-tRNA synthetase 1884051 2543394 SPAPB1A10.11c Schizosaccharomyces pombe 972h- mitochondrial glutamyl-tRNA synthetase NP_593525.1 1882471 R 284812 CDS SPAPB1A10.12c 19114438 2543430 complement(join(1884617..1885876,1886078..1886203)) 1 NC_003424.3 D-arabinono-1,4-lactone oxidase 1886203 alo1 2543430 alo1 Schizosaccharomyces pombe 972h- D-arabinono-1,4-lactone oxidase NP_593526.1 1884617 R 284812 CDS SPAPB1A10.13 19114439 2543439 1887685..1889274 1 NC_003424.3 sequence orphan 1889274 2543439 SPAPB1A10.13 Schizosaccharomyces pombe 972h- sequence orphan NP_593527.1 1887685 D 284812 CDS SPAPB1A10.14 19114440 2543437 1890920..1891651 1 NC_003424.3 F-box protein 1891651 2543437 SPAPB1A10.14 Schizosaccharomyces pombe 972h- F-box protein NP_593528.1 1890920 D 284812 CDS SPAPB1A10.15 295442977 2543427 join(1892554..1892640,1892926..1893060,1893098..1893694) 1 NC_003424.3 Arv1-like family protein 1893694 2543427 SPAPB1A10.15 Schizosaccharomyces pombe 972h- Arv1-like family protein NP_593529.2 1892554 D 284812 CDS SPAC140.01 19114442 2542842 1895533..1896291 1 NC_003424.3 succinate dehydrogenase (ubiquinone) iron-sulfur protein subunit 1896291 sdh2 2542842 sdh2 Schizosaccharomyces pombe 972h- succinate dehydrogenase (ubiquinone) iron-sulfur protein subunit NP_593530.1 1895533 D 284812 CDS SPAC140.02 19114443 2542869 1897523..1899025 1 NC_003424.3 nucleolar protein required for rRNA processing 1899025 gar2 2542869 gar2 Schizosaccharomyces pombe 972h- nucleolar protein required for rRNA processing NP_593531.1 1897523 D 284812 CDS SPAC140.03 19114444 2542862 join(1900052..1900165,1900207..1900289,1900329..1900346,1900386..1900637,1900699..1901431) 1 NC_003424.3 argonaute binding protein 1 1901431 arb1 2542862 arb1 Schizosaccharomyces pombe 972h- argonaute binding protein 1 NP_593532.1 1900052 D 284812 CDS SPAC140.04 19114445 2542837 1902319..1903206 1 NC_003424.3 conserved fungal protein 1903206 2542837 SPAC140.04 Schizosaccharomyces pombe 972h- conserved fungal protein NP_593533.1 1902319 D 284812 CDS SPAC110.01 63054549 2541715 1908268..1911339 1 NC_003424.3 serine/threonine protein kinase Ppk1 (predicted) 1911339 ppk1 2541715 ppk1 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Ppk1 (predicted) NP_593534.2 1908268 D 284812 CDS SPAC110.02 19114447 2541628 1912042..1915659 1 NC_003424.3 cohesin-associated protein Pds5 1915659 pds5 2541628 pds5 Schizosaccharomyces pombe 972h- cohesin-associated protein Pds5 NP_593535.1 1912042 D 284812 CDS SPAC110.03 19114448 2543027 join(1916108..1916155,1916319..1916387,1916818..1917279) 1 NC_003424.3 Rho family GTPase Cdc42 1917279 cdc42 2543027 cdc42 Schizosaccharomyces pombe 972h- Rho family GTPase Cdc42 NP_593536.1 1916108 D 284812 CDS SPAC110.04c 162312422 3361514 complement(1917998..1920160) 1 NC_003424.3 heat shock protein Pss1 1920160 pss1 3361514 pss1 Schizosaccharomyces pombe 972h- heat shock protein Pss1 XP_001713060.1 1917998 R 284812 CDS SPAP14E8.02 19114450 2542021 join(1922956..1923085,1923193..1924763) 1 NC_003424.3 homolog of S. cerevisiae Tos4 1924763 2542021 SPAP14E8.02 Schizosaccharomyces pombe 972h- homolog of S. cerevisiae Tos4 NP_593538.1 1922956 D 284812 CDS SPAP14E8.03 19114451 2541965 join(1925102..1925125,1925177..1925273,1925346..1925932) 1 NC_003424.3 SNARE Bos1 1925932 bos1 2541965 bos1 Schizosaccharomyces pombe 972h- SNARE Bos1 NP_593539.1 1925102 D 284812 CDS SPAP14E8.04 19114452 2541915 1926739..1927752 1 NC_003424.3 metallopeptidase Oma1 (predicted) 1927752 oma1 2541915 oma1 Schizosaccharomyces pombe 972h- metallopeptidase Oma1 (predicted) NP_593540.1 1926739 D 284812 CDS SPAP14E8.05c 19114453 2541802 complement(1928018..1928323) 1 NC_003424.3 UPF0136 family protein 1928323 2541802 SPAP14E8.05c Schizosaccharomyces pombe 972h- UPF0136 family protein NP_593541.1 1928018 R 284812 CDS SPAC3H1.01c 162312424 2543248 complement(join(1929048..1931084,1931129..1931164)) 1 NC_003424.3 origin recognition complex subunit Orp3 1931164 orp3 2543248 orp3 Schizosaccharomyces pombe 972h- origin recognition complex subunit Orp3 XP_001713061.1 1929048 R 284812 CDS SPAC3H1.02c 19114456 2543450 complement(1931588..1934698) 1 NC_003424.3 metallopeptidase 1934698 2543450 SPAC3H1.02c Schizosaccharomyces pombe 972h- metallopeptidase NP_593544.1 1931588 R 284812 CDS SPAC3H1.03 19114457 2543457 1935357..1935797 1 NC_003424.3 mouse transcriptional regulator, HCNGP-like (predicted) 1935797 mug151 2543457 mug151 Schizosaccharomyces pombe 972h- mouse transcriptional regulator, HCNGP-like (predicted) NP_593545.1 1935357 D 284812 CDS SPAC3H1.04c 19114458 2543420 complement(join(1936076..1936234,1936336..1937982)) 1 NC_003424.3 PMID:16823372 predict a frameshift at base 1684, unconfirmed; mitochondrial inner membrane protein Mdm31 1937982 mdm31 2543420 mdm31 Schizosaccharomyces pombe 972h- mitochondrial inner membrane protein Mdm31 NP_593546.1 1936076 R 284812 CDS SPAC3H1.05 19114459 2543456 join(1938900..1939004,1939075..1940394) 1 NC_003424.3 CAAX prenyl protease (predicted) 1940394 2543456 SPAC3H1.05 Schizosaccharomyces pombe 972h- CAAX prenyl protease (predicted) NP_593547.1 1938900 D 284812 CDS SPAC3H1.06c 19114460 2543376 complement(1941017..1942786) 1 NC_003424.3 membrane transporter (predicted) 1942786 2543376 SPAC3H1.06c Schizosaccharomyces pombe 972h- membrane transporter (predicted) NP_593548.1 1941017 R 284812 CDS SPAC3H1.07 19114461 2543377 1944231..1945202 1 NC_003424.3 arginase (predicted) 1945202 2543377 SPAC3H1.07 Schizosaccharomyces pombe 972h- arginase (predicted) NP_593549.1 1944231 D 284812 CDS SPAC3H1.08c 19114462 2543375 complement(join(1945426..1945852,1945893..1946101)) 1 NC_003424.3 DUF1640 family protein 1946101 2543375 SPAC3H1.08c Schizosaccharomyces pombe 972h- DUF1640 family protein NP_593550.1 1945426 R 284812 CDS SPAC3H1.09c 19114463 2543612 complement(join(1946819..1947011,1947060..1947754,1947795..1947981,1948046..1948941)) 1 NC_003424.3 vacuolar amino acid transporter (predicted) 1948941 2543612 SPAC3H1.09c Schizosaccharomyces pombe 972h- vacuolar amino acid transporter (predicted) NP_593551.1 1946819 R 284812 CDS SPAC3H1.10 19114464 2543367 1949756..1951000 1 NC_003424.3 phytochelatin synthetase 1951000 2543367 SPAC3H1.10 Schizosaccharomyces pombe 972h- phytochelatin synthetase NP_593552.1 1949756 D 284812 CDS SPAC3H1.11 19114465 2543251 1959311..1961059 1 NC_003424.3 transcription factor Hsr1 1961059 hsr1 2543251 hsr1 Schizosaccharomyces pombe 972h- transcription factor Hsr1 NP_593553.1 1959311 D 284812 CDS SPAC3H1.12c 19114466 2543443 complement(1961710..1965105) 1 NC_003424.3 Lid2 complex subunit Snt2 1965105 snt2 2543443 snt2 Schizosaccharomyces pombe 972h- Lid2 complex subunit Snt2 NP_593554.1 1961710 R 284812 CDS SPAC3H1.13 19114467 2543440 join(1965173..1965294,1965334..1965803,1965845..1966050,1966102..1966338) 1 NC_003424.3 serine/threonine protein kinase Ppk13 (predicted) 1966338 ppk13 2543440 ppk13 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Ppk13 (predicted) NP_593555.1 1965173 D 284812 CDS SPAC3H1.14 63054552 2543442 1967022..1967609 1 NC_003424.3 cytoplasmic vesicle protein, Vid24 family 1967609 2543442 SPAC3H1.14 Schizosaccharomyces pombe 972h- cytoplasmic vesicle protein, Vid24 family NP_593556.2 1967022 D 284812 CDS SPAC9G1.02 19114469 2542873 1969118..1973323 1 NC_003424.3 MAP kinase kinase kinase Wis4 1973323 wis4 2542873 wis4 Schizosaccharomyces pombe 972h- MAP kinase kinase kinase Wis4 NP_593557.1 1969118 D 284812 CDS SPAC9G1.03c 19114470 2542848 complement(join(1973666..1973756,1973816..1974054)) 1 NC_003424.3 60S ribosomal protein L30 1974054 rpl3001 2542848 rpl3001 Schizosaccharomyces pombe 972h- 60S ribosomal protein L30 NP_593558.1 1973666 R 284812 CDS SPAC9G1.04 19114471 2542876 join(1975285..1975313,1975379..1976129,1976206..1976550) 1 NC_003424.3 mitochondrial inner membrane translocase Oxa101 1976550 oxa101 2542876 oxa101 Schizosaccharomyces pombe 972h- mitochondrial inner membrane translocase Oxa101 NP_593559.1 1975285 D 284812 CDS SPAC9G1.05 19114472 2542795 join(1976902..1977006,1977068..1977191,1977262..1977363,1977404..1977449,1977556..1977601,1977651..1978592,1978639..1979061) 1 NC_003424.3 actin cortical patch component Aip1 (predicted) 1979061 2542795 SPAC9G1.05 Schizosaccharomyces pombe 972h- actin cortical patch component Aip1 (predicted) NP_593560.1 1976902 D 284812 CDS SPAC9G1.06c 19114473 2542740 complement(join(1979364..1981957,1982041..1982107)) 1 NC_003424.3 NAS annotation pers. comm. Matthew Lord and Thomas D. Pollard; cytokinesis protein Cyk3 1982107 cyk3 2542740 cyk3 Schizosaccharomyces pombe 972h- cytokinesis protein Cyk3 NP_593561.1 1979364 R 284812 CDS SPAC9G1.07 19114474 2542759 1983182..1984438 1 NC_003424.3 sequence orphan 1984438 2542759 SPAC9G1.07 Schizosaccharomyces pombe 972h- sequence orphan NP_593562.1 1983182 D 284812 CDS SPAC9G1.08c 19114475 2542787 complement(1984568..1985293) 1 NC_003424.3 phospholipase (predicted) 1985293 2542787 SPAC9G1.08c Schizosaccharomyces pombe 972h- phospholipase (predicted) NP_593563.1 1984568 R 284812 CDS SPAC9G1.09 19114476 2542746 join(1985757..1985873,1985930..1987228) 1 NC_003424.3 Septum Initiation Defective; PAK-related kinase Sid1 1987228 sid1 2542746 sid1 Schizosaccharomyces pombe 972h- PAK-related kinase Sid1 NP_593564.1 1985757 D 284812 CDS SPAC9G1.10c 19114477 2542329 complement(join(1987363..1987471,1987509..1990975)) 1 NC_003424.3 inositol polyphosphate phosphatase (predicted) 1990975 2542329 SPAC9G1.10c Schizosaccharomyces pombe 972h- inositol polyphosphate phosphatase (predicted) NP_593565.1 1987363 R 284812 CDS SPAC9G1.11c 19114478 2542193 complement(1991787..1992929) 1 NC_003424.3 septin Spn4 1992929 spn4 2542193 spn4 Schizosaccharomyces pombe 972h- septin Spn4 NP_593566.1 1991787 R 284812 CDS SPAC9G1.12 19114479 2542192 1993930..1995024 1 NC_003424.3 tRNA (m1A) methyltransferase complex catalytic subunit Cpd1 1995024 cpd1 2542192 cpd1 Schizosaccharomyces pombe 972h- tRNA (m1A) methyltransferase complex catalytic subunit Cpd1 NP_593567.1 1993930 D 284812 CDS SPAC9G1.13c 295442979 2542412 complement(join(1995208..1996148,1996191..1996268,1996325..1996413,1996478..1996683)) 1 NC_003424.3 Swr1 complex subunit Swc4 1996683 swc4 2542412 swc4 Schizosaccharomyces pombe 972h- Swr1 complex subunit Swc4 NP_593568.2 1995208 R 284812 CDS SPAC767.01c 162312426 2542724 complement(join(1997255..1999198,1999250..1999342)) 1 NC_003424.3 dynamin family protein Vps1 1999342 vps1 2542724 vps1 Schizosaccharomyces pombe 972h- dynamin family protein Vps1 XP_001713062.1 1997255 R 284812 CDS SPAC17H9.01 19114483 2542188 2000985..2004593 1 NC_003424.3 poly(A) polymerase Cid16 (predicted) 2004593 cid16 2542188 cid16 Schizosaccharomyces pombe 972h- poly(A) polymerase Cid16 (predicted) NP_593571.1 2000985 D 284812 CDS SPAC17H9.02 19114484 2542173 2004838..2007930 1 NC_003424.3 TRAMP complex ATP-dependent RNA helicase (predicted) 2007930 2542173 SPAC17H9.02 Schizosaccharomyces pombe 972h- TRAMP complex ATP-dependent RNA helicase (predicted) NP_593572.1 2004838 D 284812 CDS SPAC17H9.03c 19114485 2542295 complement(2008149..2008841) 1 NC_003424.3 highly conserved region A L/F M M * L * R K/E C/L R/K IL* R D/K L/F * L/M/V A V **************KPAL with vertebrate Trad; RAD51D-like protein 1 2008841 rdl1 2542295 rdl1 Schizosaccharomyces pombe 972h- RAD51D-like protein 1 NP_593573.1 2008149 R 284812 CDS SPAC17H9.04c 19114486 2542253 complement(2009905..2011719) 1 NC_003424.3 RNA-binding protein 2011719 2542253 SPAC17H9.04c Schizosaccharomyces pombe 972h- RNA-binding protein NP_593574.1 2009905 R 284812 CDS SPAC17H9.05 19114487 2542121 2012932..2013933 1 NC_003424.3 TAS Osami Niwa; rRNA processing protein Ebp2 2013933 ebp2 2542121 ebp2 Schizosaccharomyces pombe 972h- rRNA processing protein Ebp2 NP_593575.1 2012932 D 284812 CDS SPAC17H9.06c 19114488 2542297 complement(join(2014206..2014286,2014327..2014551,2014599..2015095,2015136..2016138)) 1 NC_003424.3 conserved fungal protein 2016138 2542297 SPAC17H9.06c Schizosaccharomyces pombe 972h- conserved fungal protein NP_593576.1 2014206 R 284812 CDS SPAC17H9.07 19114489 2542449 join(2016385..2016456,2016509..2016698,2016841..2016941) 1 NC_003424.3 signal recognition particle subunit Srp21 (predicted) 2016941 2542449 SPAC17H9.07 Schizosaccharomyces pombe 972h- signal recognition particle subunit Srp21 (predicted) NP_593577.1 2016385 D 284812 CDS SPAC17H9.08 19114490 2542177 2018369..2019349 1 NC_003424.3 mitochondrial coenzyme A transporter 2019349 2542177 SPAC17H9.08 Schizosaccharomyces pombe 972h- mitochondrial coenzyme A transporter NP_593578.1 2018369 D 284812 CDS SPAC17H9.09c 19114491 2542285 complement(join(2019758..2020411,2020483..2020488)) 1 NC_003424.3 GTPase Ras1 2020488 ras1 2542285 ras1 Schizosaccharomyces pombe 972h- GTPase Ras1 NP_593579.1 2019758 R 284812 CDS SPAC17H9.10c 19114492 2542207 complement(2021224..2024442) 1 NC_003424.3 damaged DNA binding protein Ddb1 2024442 ddb1 2542207 ddb1 Schizosaccharomyces pombe 972h- damaged DNA binding protein Ddb1 NP_593580.1 2021224 R 284812 CDS SPAC17H9.11 19114493 2542259 2025335..2025760 1 NC_003424.3 cofilin/tropomyosin family protein 2025760 2542259 SPAC17H9.11 Schizosaccharomyces pombe 972h- cofilin/tropomyosin family protein NP_593581.1 2025335 D 284812 CDS SPAC17H9.12c 19114494 2542246 complement(2026163..2026963) 1 NC_003424.3 NADH-cytochrome reductase 2026963 2542246 SPAC17H9.12c Schizosaccharomyces pombe 972h- NADH-cytochrome reductase NP_593582.1 2026163 R 284812 CDS SPAC17H9.13c 19114495 2542273 complement(join(2027344..2028198,2028275..2028573,2028698..2028752)) 1 NC_003424.3 glutamate 5-kinase (predicted) 2028752 2542273 SPAC17H9.13c Schizosaccharomyces pombe 972h- glutamate 5-kinase (predicted) NP_593583.1 2027344 R 284812 CDS SPAC17H9.14c 19114496 2542270 complement(2029229..2030308) 1 NC_003424.3 protein disulfide isomerase (predicted) 2030308 2542270 SPAC17H9.14c Schizosaccharomyces pombe 972h- protein disulfide isomerase (predicted) NP_593584.1 2029229 R 284812 CDS SPAC17H9.16 19114497 2542276 join(2031213..2031605,2031667..2031708) 1 NC_003424.3 mitochondrial TOM complex subunit Tom22 2031708 tom22 2542276 tom22 Schizosaccharomyces pombe 972h- mitochondrial TOM complex subunit Tom22 NP_593585.1 2031213 D 284812 CDS SPAC17H9.17c 19114498 2542383 complement(join(2032009..2032629,2032688..2033082,2033132..2033228)) 1 NC_003424.3 Mdm10/Mdm12/Mmm1 complex subunit Mdm10 (predicted) 2033228 mdm10 2542383 mdm10 Schizosaccharomyces pombe 972h- Mdm10/Mdm12/Mmm1 complex subunit Mdm10 (predicted) NP_593586.1 2032009 R 284812 CDS SPAC17H9.18c 19114499 2542377 complement(2033638..2033955) 1 NC_003424.3 dubious 2033955 2542377 SPAC17H9.18c Schizosaccharomyces pombe 972h- dubious NP_593587.1 2033638 R 284812 CDS SPAC17H9.19c 19114500 2542374 complement(2034178..2035650) 1 NC_003424.3 WD repeat protein Cdt2 2035650 cdt2 2542374 cdt2 Schizosaccharomyces pombe 972h- WD repeat protein Cdt2 NP_593588.1 2034178 R 284812 CDS SPAC17H9.20 162312428 2542387 join(2036403..2036667,2036713..2036825,2036864..2036959,2037008..2037417,2037468..2039067,2039116..2039520) 1 NC_003424.3 sequence updated from PMID: 16207082 added intron at 37250..37297 date=20051010; mitotic cohesin complex, non-SMC subunit Psc3 2039520 psc3 2542387 psc3 Schizosaccharomyces pombe 972h- mitotic cohesin complex, non-SMC subunit Psc3 XP_001713063.1 2036403 D 284812 CDS SPAC607.02c 19114503 2542508 complement(join(2039615..2039885,2039932..2040300,2040349..2040404)) 1 NC_003424.3 conserved fungal protein 2040404 2542508 SPAC607.02c Schizosaccharomyces pombe 972h- conserved fungal protein NP_593591.1 2039615 R 284812 CDS SPAC607.03c 19114504 2542663 complement(join(2040936..2041295,2041446..2041463)) 1 NC_003424.3 U3 snoRNP-associated protein Snu13 2041463 snu13 2542663 snu13 Schizosaccharomyces pombe 972h- U3 snoRNP-associated protein Snu13 NP_593592.1 2040936 R 284812 CDS SPAC607.04 19114505 2543061 2042490..2043296 1 NC_003424.3 inositol polyphosphate kinase (predicted) 2043296 2543061 SPAC607.04 Schizosaccharomyces pombe 972h- inositol polyphosphate kinase (predicted) NP_593593.1 2042490 D 284812 CDS SPAC607.05 19114506 2543114 join(2043842..2043954,2044009..2045041) 1 NC_003424.3 19S proteasome regulatory subunit Rpn9 2045041 rpn9 2543114 rpn9 Schizosaccharomyces pombe 972h- 19S proteasome regulatory subunit Rpn9 NP_593594.1 2043842 D 284812 CDS SPAC607.06c 19114507 2543169 complement(join(2045210..2045245,2045284..2047035,2047094..2047144)) 1 NC_003424.3 metallopeptidase 2047144 2543169 SPAC607.06c Schizosaccharomyces pombe 972h- metallopeptidase NP_593595.1 2045210 R 284812 CDS SPAC607.07c 19114508 2543158 complement(2047699..2048130) 1 NC_003424.3 sequence orphan 2048130 2543158 SPAC607.07c Schizosaccharomyces pombe 972h- sequence orphan NP_593596.1 2047699 R 284812 CDS SPAC607.08c 19114509 2543150 complement(2048421..2050160) 1 NC_003424.3 DUF726 family protein 2050160 2543150 SPAC607.08c Schizosaccharomyces pombe 972h- DUF726 family protein NP_593597.1 2048421 R 284812 CDS SPAC607.09c 19114510 2543645 complement(2050462..2051652) 1 NC_003424.3 battenin CLN3 family protein 2051652 btn1 2543645 btn1 Schizosaccharomyces pombe 972h- battenin CLN3 family protein NP_593598.1 2050462 R 284812 CDS SPAC607.10 19114511 2543520 2053945..2057031 1 NC_003424.3 sporulation protein Spo3 2057031 spo3 2543520 spo3 Schizosaccharomyces pombe 972h- sporulation protein Spo3 NP_593599.1 2053945 D 284812 CDS SPAC732.01 19114512 2541780 join(2057608..2057624,2057664..2057695,2057728..2057837,2057893..2057928,2057974..2058044,2058337..2058559) 1 NC_003424.3 V-type ATPase proteolipid subunit 2058559 vma11 2541780 vma11 Schizosaccharomyces pombe 972h- V-type ATPase proteolipid subunit NP_593600.1 2057608 D 284812 CDS SPAC732.02c 19114513 2541800 complement(2059251..2060477) 1 NC_003424.3 fructose-2,6-bisphosphate 2-phosphatase activity (predicted) 2060477 2541800 SPAC732.02c Schizosaccharomyces pombe 972h- fructose-2,6-bisphosphate 2-phosphatase activity (predicted) NP_593601.1 2059251 R 284812 CDS SPAC3C7.01c 162312430 3361512 complement(2061806..2063641) 1 NC_003424.3 inositol polyphosphate phosphatase (predicted) 2063641 3361512 SPAC3C7.01c Schizosaccharomyces pombe 972h- inositol polyphosphate phosphatase (predicted) XP_001713064.1 2061806 R 284812 CDS SPAC3C7.02c 19114515 2541709 complement(2064853..2066004) 1 NC_003424.3 protein kinase inhibitor (predicted) 2066004 2541709 SPAC3C7.02c Schizosaccharomyces pombe 972h- protein kinase inhibitor (predicted) NP_593603.1 2064853 R 284812 CDS SPAC3C7.03c 19114516 2543685 complement(join(2066668..2067704,2067749..2067764)) 1 NC_003424.3 RecA family ATPase Rhp55 2067764 rhp55 2543685 rhp55 Schizosaccharomyces pombe 972h- RecA family ATPase Rhp55 NP_593604.1 2066668 R 284812 CDS SPAC3C7.04 19114517 2543687 2068764..2071115 1 NC_003424.3 transcription factor (predicted) 2071115 2543687 SPAC3C7.04 Schizosaccharomyces pombe 972h- transcription factor (predicted) NP_593605.1 2068764 D 284812 CDS SPAC3C7.05c 19114518 2543191 complement(2071904..2073232) 1 NC_003424.3 alpha-1,6-mannanase (predicted) 2073232 mug191 2543191 mug191 Schizosaccharomyces pombe 972h- alpha-1,6-mannanase (predicted) NP_593606.1 2071904 R 284812 CDS SPAC3C7.06c 19114519 2543071 complement(2074294..2076246) 1 NC_003424.3 serine/threonine protein kinase, meiotic Pit1 2076246 pit1 2543071 pit1 Schizosaccharomyces pombe 972h- serine/threonine protein kinase, meiotic Pit1 NP_593607.1 2074294 R 284812 CDS SPAC3C7.07c 19114520 2542941 complement(join(2077280..2077384,2077424..2077684,2077726..2077796,2077843..2078366,2078421..2078486,2078528..2078550,2078695..2078730)) 1 NC_003424.3 arginine-tRNA protein transferase (predicted) 2078730 2542941 SPAC3C7.07c Schizosaccharomyces pombe 972h- arginine-tRNA protein transferase (predicted) NP_593608.1 2077280 R 284812 CDS SPAC3C7.08c 19114521 2543082 complement(2079274..2082447) 1 NC_003424.3 AAA family ATPase ELf1 2082447 elf1 2543082 elf1 Schizosaccharomyces pombe 972h- AAA family ATPase ELf1 NP_593609.1 2079274 R 284812 CDS SPAC3C7.09 19114522 2543159 2083519..2084808 1 NC_003424.3 lysine methyltransferase Set8 (predicted) 2084808 set8 2543159 set8 Schizosaccharomyces pombe 972h- lysine methyltransferase Set8 (predicted) NP_593610.1 2083519 D 284812 CDS SPAC3C7.10 19114523 2543046 2085248..2086114 1 NC_003424.3 peroxin-13 2086114 pex13 2543046 pex13 Schizosaccharomyces pombe 972h- peroxin-13 NP_593611.1 2085248 D 284812 CDS SPAC3C7.11c 19114524 2543041 complement(2086615..2088297) 1 NC_003424.3 calnexin Cnx1 2088297 cnx1 2543041 cnx1 Schizosaccharomyces pombe 972h- calnexin Cnx1 NP_593612.1 2086615 R 284812 CDS SPAC3C7.12 19114525 2543044 2089787..2091172 1 NC_003424.3 CLIP170 family protein Tip1 2091172 tip1 2543044 tip1 Schizosaccharomyces pombe 972h- CLIP170 family protein Tip1 NP_593613.1 2089787 D 284812 CDS SPAC3C7.13c 19114526 2543207 complement(2091521..2092942) 1 NC_003424.3 glucose-6-phosphate 1-dehydrogenase (predicted) 2092942 2543207 SPAC3C7.13c Schizosaccharomyces pombe 972h- glucose-6-phosphate 1-dehydrogenase (predicted) NP_593614.1 2091521 R 284812 CDS SPAC3C7.14c 19114527 2543686 complement(2094283..2094891) 1 NC_003424.3 this does not appear to be a histone fold as published in (PMID:7929079); Note:PMID: 12073089 does not refer to this apt1; ubiquitinated histone-like protein Uhp1 2094891 obr1 2543686 obr1 Schizosaccharomyces pombe 972h- ubiquitinated histone-like protein Uhp1 NP_593615.1 2094283 R 284812 CDS SPAC25A8.03c 63054556 2543202 complement(2096382..2097785) 1 NC_003424.3 DUF185 protein 2097785 2543202 SPAC25A8.03c Schizosaccharomyces pombe 972h- DUF185 protein NP_593616.2 2096382 R 284812 CDS SPAC25A8.01c 19114529 2541531 complement(2098281..2101049) 1 NC_003424.3 fun thirty related protein Fft3 2101049 fft3 2541531 fft3 Schizosaccharomyces pombe 972h- fun thirty related protein Fft3 NP_593617.1 2098281 R 284812 CDS SPAC25A8.02 19114530 2541691 2102782..2103954 1 NC_003424.3 sequence orphan 2103954 2541691 SPAC25A8.02 Schizosaccharomyces pombe 972h- sequence orphan NP_593618.1 2102782 D 284812 CDS SPAC631.01c 162312432 2543390 complement(join(2104197..2104600,2104650..2105046,2105244..2105249)) 1 NC_003424.3 F-actin capping protein beta subunit (predicted) 2105249 acp2 2543390 acp2 Schizosaccharomyces pombe 972h- F-actin capping protein beta subunit (predicted) NP_593619.3 2104197 R 284812 CDS SPAC631.02 295442981 2543426 join(2107470..2107515,2107860..2110123) 1 NC_003424.3 bromodomain protein 2110123 2543426 SPAC631.02 Schizosaccharomyces pombe 972h- bromodomain protein NP_593620.2 2107470 D 284812 CDS SPAC20H4.01 162312434 2543388 2111433..2113433 1 NC_003424.3 U3 snoRNP-associated protein Utp5 2113433 2543388 SPAC20H4.01 Schizosaccharomyces pombe 972h- U3 snoRNP-associated protein Utp5 NP_593621.2 2111433 D 284812 CDS SPAC20H4.02 19114534 2541990 2114011..2114763 1 NC_003424.3 conserved fungal protein 2114763 2541990 SPAC20H4.02 Schizosaccharomyces pombe 972h- conserved fungal protein NP_593622.1 2114011 D 284812 CDS SPAC20H4.03c 19114535 2541941 complement(join(2115156..2115200,2115250..2115274,2115338..2116017,2116193..2116255,2116313..2116381)) 1 NC_003424.3 transcription elongation factor TFIIS 2116381 tfs1 2541941 tfs1 Schizosaccharomyces pombe 972h- transcription elongation factor TFIIS NP_593623.1 2115156 R 284812 CDS SPAC20H4.04 19114536 2542014 2116869..2119220 1 NC_003424.3 ATP-dependent 3' to 5' DNA helicase (predicted) 2119220 mfh2 2542014 mfh2 Schizosaccharomyces pombe 972h- ATP-dependent 3' to 5' DNA helicase (predicted) NP_593624.1 2116869 D 284812 CDS SPAC20H4.05c 19114537 2542010 complement(join(2119362..2119570,2119614..2119792,2119838..2119915,2119975..2120052,2120163..2120284)) 1 NC_003424.3 adducin 2120284 2542010 SPAC20H4.05c Schizosaccharomyces pombe 972h- adducin NP_593625.1 2119362 R 284812 CDS SPAC20H4.06c 19114538 2542000 complement(2120604..2122208) 1 NC_003424.3 RNA-binding protein 2122208 2542000 SPAC20H4.06c Schizosaccharomyces pombe 972h- RNA-binding protein NP_593626.1 2120604 R 284812 CDS SPAC20H4.07 19114539 2542007 join(2123290..2123356,2123452..2124449) 1 NC_003424.3 RecA family ATPase Rhp57 2124449 rhp57 2542007 rhp57 Schizosaccharomyces pombe 972h- RecA family ATPase Rhp57 NP_593627.1 2123290 D 284812 CDS SPAC20H4.08 19114540 2542831 2124992..2125804 1 NC_003424.3 phosphatase activator (predicted) 2125804 2542831 SPAC20H4.08 Schizosaccharomyces pombe 972h- phosphatase activator (predicted) NP_593628.1 2124992 D 284812 CDS SPAC20H4.09 19114541 2542874 join(2126067..2126157,2126201..2126278,2126327..2126391,2126440..2126696,2126733..2127504,2127551..2127652,2127701..2127869,2127912..2128232,2128271..2128359) 1 NC_003424.3 ATP-dependent RNA helicase, spliceosomal (predicted) 2128359 2542874 SPAC20H4.09 Schizosaccharomyces pombe 972h- ATP-dependent RNA helicase, spliceosomal (predicted) NP_593629.1 2126067 D 284812 CDS SPAC20H4.10 19114542 2542023 join(2128463..2128480,2128523..2129266,2129313..2131509,2131550..2131623) 1 NC_003424.3 possibly overpredicted at the N-terminal exon; ubiquitin fusion degradation protein-2; ubiquitin-protein ligase E4 (predicted) 2131623 ufd2 2542023 ufd2 Schizosaccharomyces pombe 972h- ubiquitin-protein ligase E4 (predicted) NP_593630.1 2128463 D 284812 CDS SPAC20H4.11c 19114543 2542013 complement(join(2131895..2132426,2132545..2132615)) 1 NC_003424.3 Rho family GTPase Rho5 2132615 rho5 2542013 rho5 Schizosaccharomyces pombe 972h- Rho family GTPase Rho5 NP_593631.1 2131895 R 284812 CDS SPAC23C11.01 19114544 2542025 join(2133439..2133702,2133782..2134096,2134150..2134335,2134376..2134488,2134574..2135021) 1 NC_003424.3 ER membrane protein, ICE2 family 2135021 2542025 SPAC23C11.01 Schizosaccharomyces pombe 972h- ER membrane protein, ICE2 family NP_593632.1 2133439 D 284812 CDS SPAC23C11.02c 19114545 2542012 complement(2135357..2135788) 1 NC_003424.3 40S ribosomal protein S23 2135788 rps23 2542012 rps23 Schizosaccharomyces pombe 972h- 40S ribosomal protein S23 NP_593633.1 2135357 R 284812 CDS SPAC23C11.03 19114546 2542038 2136145..2137941 1 NC_003424.3 U3 snoRNP-associated protein Mpp1 (predicted) 2137941 2542038 SPAC23C11.03 Schizosaccharomyces pombe 972h- U3 snoRNP-associated protein Mpp1 (predicted) NP_593634.1 2136145 D 284812 CDS SPAC23C11.04c 19114547 2542032 complement(join(2138064..2138210,2138267..2138844,2138898..2139438)) 1 NC_003424.3 DNA kinase/phosphatase Pnk1 2139438 pnk1 2542032 pnk1 Schizosaccharomyces pombe 972h- DNA kinase/phosphatase Pnk1 NP_593635.1 2138064 R 284812 CDS SPAC23C11.05 19114548 2542011 2140529..2141398 1 NC_003424.3 inorganic pyrophosphatase (predicted) 2141398 2542011 SPAC23C11.05 Schizosaccharomyces pombe 972h- inorganic pyrophosphatase (predicted) NP_593636.1 2140529 D 284812 CDS SPAC23C11.06c 19114549 2542051 complement(2141684..2143291) 1 NC_003424.3 hydrolase (inferred from context) 2143291 2542051 SPAC23C11.06c Schizosaccharomyces pombe 972h- hydrolase (inferred from context) NP_593637.1 2141684 R 284812 CDS SPAC23C11.07 19114550 2542030 2144894..2145226 1 NC_003424.3 has transcript profile on microarray; sequence orphan 2145226 2542030 SPAC23C11.07 Schizosaccharomyces pombe 972h- sequence orphan NP_593638.1 2144894 D 284812 CDS SPAC23C11.08 19114551 2542027 join(2145681..2145779,2145927..2145987,2146043..2146170,2146326..2146388) 1 NC_003424.3 CCAAT-binding factor complex subunit Php3 2146388 php3 2542027 php3 Schizosaccharomyces pombe 972h- CCAAT-binding factor complex subunit Php3 NP_593639.1 2145681 D 284812 CDS SPAC23C11.09 19114552 2542031 2147202..2150081 1 NC_003424.3 mitochondrial and cytoplasmic alanine-tRNA ligase Ala1 (predicted) 2150081 ala1 2542031 ala1 Schizosaccharomyces pombe 972h- mitochondrial and cytoplasmic alanine-tRNA ligase Ala1 (predicted) NP_593640.1 2147202 D 284812 CDS SPAC23C11.10 63054558 2542061 join(2150624..2150744,2150784..2150882,2150930..2151128,2151180..2151342,2151386..2151601) 1 NC_003424.3 18/6/2002 added 3 additional C-terminal exons; conserved eukaryotic protein 2151601 2542061 SPAC23C11.10 Schizosaccharomyces pombe 972h- conserved eukaryotic protein NP_593641.2 2150624 D 284812 CDS SPAC23C11.11 19114554 2541972 join(2152154..2152199,2152260..2152540,2152699..2153011,2153073..2153374,2153468..2153524) 1 NC_003424.3 serine/threonine protein kinase Cka1 2153524 cka1 2541972 cka1 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Cka1 NP_593642.1 2152154 D 284812 CDS SPAC23C11.12 19114555 2542045 2154795..2155037 1 NC_003424.3 anaphase-promoting complex subunit Hcn1 2155037 hcn1 2542045 hcn1 Schizosaccharomyces pombe 972h- anaphase-promoting complex subunit Hcn1 NP_593643.1 2154795 D 284812 CDS SPAC23C11.13c 19114556 2541970 complement(join(2155562..2156048,2156323..2156456)) 1 NC_003424.3 xanthine phosphoribosyltransferase (predicted) 2156456 hpt1 2541970 hpt1 Schizosaccharomyces pombe 972h- xanthine phosphoribosyltransferase (predicted) NP_593644.1 2155562 R 284812 CDS SPAC23C11.14 19114557 2542060 2158812..2159975 1 NC_003424.3 zinc ion transporter Zhf1 2159975 zhf1 2542060 zhf1 Schizosaccharomyces pombe 972h- zinc ion transporter Zhf1 NP_593645.1 2158812 D 284812 CDS SPAC23C11.15 19114558 2541624 join(2160572..2160602,2160649..2160829,2160908..2163923) 1 NC_003424.3 Clr6 histone deacetylase complex subunit Pst2 2163923 pst2 2541624 pst2 Schizosaccharomyces pombe 972h- Clr6 histone deacetylase complex subunit Pst2 NP_593646.1 2160572 D 284812 CDS SPAC23C11.16 19114559 2541957 2164240..2166291 1 NC_003424.3 Polo kinase Plo1 2166291 plo1 2541957 plo1 Schizosaccharomyces pombe 972h- Polo kinase Plo1 NP_593647.1 2164240 D 284812 CDS SPAC23C11.17 19114560 2541952 join(2167170..2167245,2167302..2168683) 1 NC_003424.3 mitochondrial inner membrane protein involved in potassium ion transport 2168683 2541952 SPAC23C11.17 Schizosaccharomyces pombe 972h- mitochondrial inner membrane protein involved in potassium ion transport NP_593648.1 2167170 D 284812 CDS SPAC13F5.01c 162312436 2542833 complement(join(2169185..2169267,2169308..2169392,2169438..2172095)) 1 NC_003424.3 MutS protein homolog 1 2172095 msh1 2542833 msh1 Schizosaccharomyces pombe 972h- MutS protein homolog 1 NP_593649.2 2169185 R 284812 CDS SPAC13F5.02c 19114562 2542822 complement(join(2172530..2173383,2173425..2173752)) 1 NC_003424.3 transcription factor TFIID complex subunit Taf7 2173752 ptr6 2542822 ptr6 Schizosaccharomyces pombe 972h- transcription factor TFIID complex subunit Taf7 NP_593650.1 2172530 R 284812 CDS SPAC13F5.03c 19114563 2542881 complement(2175008..2176360) 1 NC_003424.3 mitochondrial glycerol dehydrogenase Gld1 2176360 gld1 2542881 gld1 Schizosaccharomyces pombe 972h- mitochondrial glycerol dehydrogenase Gld1 NP_593651.1 2175008 R 284812 CDS SPAC13F5.04c 19114564 2542892 complement(join(2177582..2178355,2178446..2178505)) 1 NC_003424.3 endosomal sorting protein (predicted) 2178505 2542892 SPAC13F5.04c Schizosaccharomyces pombe 972h- endosomal sorting protein (predicted) NP_593652.1 2177582 R 284812 CDS SPAC13F5.05 19114565 2542841 2180072..2181163 1 NC_003424.3 thioredoxin family protein 2181163 2542841 SPAC13F5.05 Schizosaccharomyces pombe 972h- thioredoxin family protein NP_593653.1 2180072 D 284812 CDS SPAC13F5.06c 19114566 2542843 complement(join(2181567..2181723,2181767..2181868,2181925..2183959,2184189..2184267,2184314..2184376)) 1 NC_003424.3 exocyst complex subunit Sec10 2184376 sec10 2542843 sec10 Schizosaccharomyces pombe 972h- exocyst complex subunit Sec10 NP_593654.1 2181567 R 284812 CDS SPAC13F5.07c 19114567 2542901 complement(2184865..2185182) 1 NC_003424.3 sequence orphan 2185182 2542901 SPAC13F5.07c Schizosaccharomyces pombe 972h- sequence orphan NP_593655.1 2184865 R 284812 CDS SPAC1783.01 19114568 2542364 2187554..2189305 1 NC_003424.3 FAD binding protein (predicted) 2189305 2542364 SPAC1783.01 Schizosaccharomyces pombe 972h- FAD binding protein (predicted) NP_593656.1 2187554 D 284812 CDS SPAC1783.02c 19114569 2542362 complement(join(2189507..2189845,2189907..2190180,2190245..2190509,2190566..2190674)) 1 NC_003424.3 acyltransferase (predicted) 2190674 vps66 2542362 vps66 Schizosaccharomyces pombe 972h- acyltransferase (predicted) NP_593657.1 2189507 R 284812 CDS SPAC1783.03 19114570 2542367 2191008..2192063 1 NC_003424.3 Sim4 and Mal2 associated (4 and 2 associated) protein 2 2192063 fta2 2542367 fta2 Schizosaccharomyces pombe 972h- Sim4 and Mal2 associated (4 and 2 associated) protein 2 NP_593658.1 2191008 D 284812 CDS SPAC1783.04c 19114571 2542366 complement(join(2192109..2193163,2193289..2193481)) 1 NC_003424.3 Sir2 family histone deacetylase Hst4 2193481 hst4 2542366 hst4 Schizosaccharomyces pombe 972h- Sir2 family histone deacetylase Hst4 NP_593659.1 2192109 R 284812 CDS SPAC1783.05 19114572 2542363 2195017..2199138 1 NC_003424.3 Helicase-Related Protein from S. Pombe; ATP-dependent DNA helicase Hrp1 2199138 hrp1 2542363 hrp1 Schizosaccharomyces pombe 972h- ATP-dependent DNA helicase Hrp1 NP_593660.1 2195017 D 284812 CDS SPAC1783.06c 19114573 2542368 complement(join(2199448..2199570,2199625..2199761,2199826..2199964)) 1 NC_003424.3 autophagy associated protein Atg12 (predicted) 2199964 atg12 2542368 atg12 Schizosaccharomyces pombe 972h- autophagy associated protein Atg12 (predicted) NP_593661.1 2199448 R 284812 CDS SPAC1783.07c 19114574 2542140 complement(2200589..2202247) 1 NC_003424.3 caf3-89 Leu->Ser disrupts nuclear export signal (PMID 14758541); transcription factor Pap1/Caf3 2202247 pap1 2542140 pap1 Schizosaccharomyces pombe 972h- transcription factor Pap1/Caf3 NP_593662.1 2200589 R 284812 CDS SPAC1783.08c 19114575 2542370 complement(2203741..2204346) 1 NC_003424.3 60S ribosomal protein L15b 2204346 rpl1502 2542370 rpl1502 Schizosaccharomyces pombe 972h- 60S ribosomal protein L15b NP_593663.1 2203741 R 284812 CDS SPAC1327.01c 63054560 2543092 complement(2205162..2208095) 1 NC_003424.3 transcription factor, zf-fungal binuclear cluster type (predicted) 2208095 2543092 SPAC1327.01c Schizosaccharomyces pombe 972h- transcription factor, zf-fungal binuclear cluster type (predicted) NP_593664.2 2205162 R 284812 CDS SPAC18G6.01c 19114577 2542185 complement(2209896..2210675) 1 NC_003424.3 calchone related protein family 2210675 2542185 SPAC18G6.01c Schizosaccharomyces pombe 972h- calchone related protein family NP_593665.1 2209896 R 284812 CDS SPAC18G6.02c 19114578 2542239 complement(2210977..2213859) 1 NC_003424.3 CHromodomain Protein 1; chromodomain protein Chp1 2213859 chp1 2542239 chp1 Schizosaccharomyces pombe 972h- chromodomain protein Chp1 NP_593666.1 2210977 R 284812 CDS SPAC18G6.03 19114579 2542219 join(2215815..2216241,2216486..2216566,2216621..2216757) 1 NC_003424.3 GTPase Ypt3 2216757 ypt3 2542219 ypt3 Schizosaccharomyces pombe 972h- GTPase Ypt3 NP_593667.1 2215815 D 284812 CDS SPAC18G6.04c 19114580 2542242 complement(2217187..2218605) 1 NC_003424.3 possibly spliced at 5' end (9288..10667, 10814..10897); serine hydroxymethyltransferase Shm2 (predicted) 2218605 shm2 2542242 shm2 Schizosaccharomyces pombe 972h- serine hydroxymethyltransferase Shm2 (predicted) NP_593668.1 2217187 R 284812 CDS SPAC18G6.05c 19114581 2542235 complement(join(2219255..2227119,2227193..2227340)) 1 NC_003424.3 translation elongation regulator Gcn1 (predicted) 2227340 2542235 SPAC18G6.05c Schizosaccharomyces pombe 972h- translation elongation regulator Gcn1 (predicted) NP_593669.1 2219255 R 284812 CDS SPAC18G6.06 19114582 2542134 2229015..2229764 1 NC_003424.3 U3 snoRNP-associated protein Utp11 (predicted) 2229764 2542134 SPAC18G6.06 Schizosaccharomyces pombe 972h- U3 snoRNP-associated protein Utp11 (predicted) NP_593670.1 2229015 D 284812 CDS SPAC18G6.07c 19114583 2542139 complement(2230333..2231412) 1 NC_003424.3 ribosome biogenesis protein Mra1 2231412 mra1 2542139 mra1 Schizosaccharomyces pombe 972h- ribosome biogenesis protein Mra1 NP_593671.1 2230333 R 284812 CDS SPAC18G6.09c 19114584 2542536 complement(2233149..2234087) 1 NC_003424.3 sequence orphan 2234087 2542536 SPAC18G6.09c Schizosaccharomyces pombe 972h- sequence orphan NP_593672.1 2233149 R 284812 CDS SPAC18G6.10 19114585 2542544 2234598..2236664 1 NC_003424.3 LEM domain protein Heh1/Lem2 2236664 heh1 2542544 heh1 Schizosaccharomyces pombe 972h- LEM domain protein Heh1/Lem2 NP_593673.1 2234598 D 284812 CDS SPAC18G6.11c 19114586 2542511 complement(2236996..2238795) 1 NC_003424.3 ribosomal DNA (rDNA) transcription factor Rrn3 2238795 rrn3 2542511 rrn3 Schizosaccharomyces pombe 972h- ribosomal DNA (rDNA) transcription factor Rrn3 NP_593674.1 2236996 R 284812 CDS SPAC18G6.12c 19114587 2542521 complement(2239501..2240430) 1 NC_003424.3 hypothetical protein 2240430 2542521 SPAC18G6.12c Schizosaccharomyces pombe 972h- hypothetical protein NP_593675.1 2239501 R 284812 CDS SPAC18G6.13 19114588 2542507 2241013..2241357 1 NC_003424.3 previously annotated as dubious, but has localization signal; sequence orphan 2241357 2542507 SPAC18G6.13 Schizosaccharomyces pombe 972h- sequence orphan NP_593676.1 2241013 D 284812 CDS SPAC18G6.14c 19114589 2542553 complement(2241936..2242523) 1 NC_003424.3 40S ribosomal protein S7 (predicted) 2242523 rps7 2542553 rps7 Schizosaccharomyces pombe 972h- 40S ribosomal protein S7 (predicted) NP_593677.1 2241936 R 284812 CDS SPAC18G6.15 19114590 2542123 join(2243636..2243677,2243738..2244622) 1 NC_003424.3 EB1 family Mal3 2244622 mal3 2542123 mal3 Schizosaccharomyces pombe 972h- EB1 family Mal3 NP_593678.1 2243636 D 284812 CDS SPAC13D6.01 19114591 2542815 2245786..2247081 1 NC_003424.3 F-box protein Pof14 2247081 pof14 2542815 pof14 Schizosaccharomyces pombe 972h- F-box protein Pof14 NP_593679.1 2245786 D 284812 CDS SPAC13D6.02c 19114592 2542829 complement(2247943..2248482) 1 NC_003424.3 zinc finger protein Byr3 2248482 byr3 2542829 byr3 Schizosaccharomyces pombe 972h- zinc finger protein Byr3 NP_593680.1 2247943 R 284812 CDS SPAC13D6.03c 19114593 2542906 complement(join(2250372..2250977,2251027..2251107)) 1 NC_003424.3 tRNA (uridine) methyltransferase Trm9 (predicted) 2251107 trm9 2542906 trm9 Schizosaccharomyces pombe 972h- tRNA (uridine) methyltransferase Trm9 (predicted) NP_593681.1 2250372 R 284812 CDS SPAC13D6.04c 19114594 2542872 complement(join(2251500..2252770,2252821..2252912,2252981..2253189)) 1 NC_003424.3 substrate adaptors for cullin 3 ubiquitin ligase Btb3 2253189 btb3 2542872 btb3 Schizosaccharomyces pombe 972h- substrate adaptors for cullin 3 ubiquitin ligase Btb3 NP_593682.1 2251500 R 284812 CDS SPAC13D6.05 63054561 2542814 2253468..2254172 1 NC_003424.3 tubulin specific chaperone cofactor B 2254172 alp11 2542814 alp11 Schizosaccharomyces pombe 972h- tubulin specific chaperone cofactor B NP_593683.2 2253468 D 284812 CDS SPAC4G9.02 19114596 2541542 2254588..2255568 1 NC_003424.3 ribonuclease H2 complex subunit Rnh201 (predicted) 2255568 rnh201 2541542 rnh201 Schizosaccharomyces pombe 972h- ribonuclease H2 complex subunit Rnh201 (predicted) NP_593684.1 2254588 D 284812 CDS SPAC4G9.03 19114597 2542704 2255935..2256597 1 NC_003424.3 adenylate kinase Adk1 2256597 adk1 2542704 adk1 Schizosaccharomyces pombe 972h- adenylate kinase Adk1 NP_593685.1 2255935 D 284812 CDS SPAC4G9.04c 19114598 2543037 complement(join(2256857..2258623,2258672..2258821)) 1 NC_003424.3 cleavage and polyadenylation specificity factor (predicted) 2258821 2543037 SPAC4G9.04c Schizosaccharomyces pombe 972h- cleavage and polyadenylation specificity factor (predicted) NP_593686.1 2256857 R 284812 CDS SPAC4G9.05 19114599 2543134 join(2259943..2260707,2260779..2261312,2261355..2261801) 1 NC_003424.3 meiotic PUF family protein 1 2261801 mpf1 2543134 mpf1 Schizosaccharomyces pombe 972h- meiotic PUF family protein 1 NP_593687.1 2259943 D 284812 CDS SPAC4G9.06c 19114600 2543404 complement(join(2261963..2262129,2262195..2262340,2262387..2262415)) 1 NC_003424.3 histone chaperone Chz1 (predicted) 2262415 chz1 2543404 chz1 Schizosaccharomyces pombe 972h- histone chaperone Chz1 (predicted) NP_593688.1 2261963 R 284812 CDS SPAC4G9.07 19114601 2543433 2263667..2265208 1 NC_003424.3 S. pombe specific UPF0300 family protein 2 2265208 mug133 2543433 mug133 Schizosaccharomyces pombe 972h- S. pombe specific UPF0300 family protein 2 NP_593689.1 2263667 D 284812 CDS SPAC4G9.08c 19114602 2543393 complement(2266025..2269522) 1 NC_003424.3 DNA-directed RNA polymerase III complex subunit Rpc2 2269522 rpc2 2543393 rpc2 Schizosaccharomyces pombe 972h- DNA-directed RNA polymerase III complex subunit Rpc2 NP_593690.1 2266025 R 284812 CDS SPAC4G9.09c 19114603 2543391 complement(2270019..2272676) 1 NC_003424.3 N-acetyl-gamma-glutamyl-phosphate reductase/acetylglutamate kinase 2272676 arg11 2543391 arg11 Schizosaccharomyces pombe 972h- N-acetyl-gamma-glutamyl-phosphate reductase/acetylglutamate kinase NP_593691.1 2270019 R 284812 CDS SPAC4G9.10 19114604 2543593 2274012..2274995 1 NC_003424.3 ornithine carbamoyltransferase Arg3 2274995 arg3 2543593 arg3 Schizosaccharomyces pombe 972h- ornithine carbamoyltransferase Arg3 NP_593692.1 2274012 D 284812 CDS SPAC4G9.11c 19114605 2543595 complement(2275578..2276249) 1 NC_003424.3 cytosine-mismatch binding protein 1 2276249 cmb1 2543595 cmb1 Schizosaccharomyces pombe 972h- cytosine-mismatch binding protein 1 NP_593693.1 2275578 R 284812 CDS SPAC4G9.12 19114606 2543385 2277199..2277780 1 NC_003424.3 gluconokinase 2277780 2543385 SPAC4G9.12 Schizosaccharomyces pombe 972h- gluconokinase NP_593694.1 2277199 D 284812 CDS SPAC4G9.13c 19114607 2543395 complement(join(2278242..2278994,2279091..2279234)) 1 NC_003424.3 retromer complex subunit Vps26 2279234 vps26 2543395 vps26 Schizosaccharomyces pombe 972h- retromer complex subunit Vps26 NP_593695.1 2278242 R 284812 CDS SPAC4G9.14 19114608 2543598 join(2280423..2280442,2280492..2280766,2280860..2280882,2280992..2281120,2281168..2281239,2281308..2281454) 1 NC_003424.3 mitochondrial Mvp17/PMP22 family protein 2 2281454 2543598 SPAC4G9.14 Schizosaccharomyces pombe 972h- mitochondrial Mvp17/PMP22 family protein 2 NP_593696.1 2280423 D 284812 CDS SPAC4G9.15 19114609 2543099 join(2282230..2282242,2282303..2282433,2282483..2283364) 1 NC_003424.3 ketoreductase (predicted) 2283364 2543099 SPAC4G9.15 Schizosaccharomyces pombe 972h- ketoreductase (predicted) NP_593697.1 2282230 D 284812 CDS SPAC4G9.16c 19114610 2543380 complement(2283637..2284209) 1 NC_003424.3 60S ribosomal protein L9 2284209 rpl901 2543380 rpl901 Schizosaccharomyces pombe 972h- 60S ribosomal protein L9 NP_593698.1 2283637 R 284812 CDS SPAC4G9.17c 19114611 2543504 complement(join(2284503..2284717,2284845..2285793)) 1 NC_003424.3 mitochondrial ribosomal protein subunit S5 (predicted) 2285793 mrps5 2543504 mrps5 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit S5 (predicted) NP_593699.1 2284503 R 284812 CDS SPAC4G9.19 19114612 2543511 2287377..2288189 1 NC_003424.3 DNAJ domain protein DNAJB family 2288189 2543511 SPAC4G9.19 Schizosaccharomyces pombe 972h- DNAJ domain protein DNAJB family NP_593700.1 2287377 D 284812 CDS SPAC4G9.20c 19114613 2543680 complement(join(2288689..2289546,2289647..2289697)) 1 NC_003424.3 may use upstream Met with alternative intron; mitochondrial carrier with solute carrier repeats 2289697 2543680 SPAC4G9.20c Schizosaccharomyces pombe 972h- mitochondrial carrier with solute carrier repeats NP_593701.1 2288689 R 284812 CDS SPAC4G9.22 295442983 9406902 2292013..2292297 1 NC_003424.3 WARNING: This may be a non-coding RNA, longest ORF in Solexa transcript; sequence orphan 2292297 9406902 SPAC4G9.22 Schizosaccharomyces pombe 972h- sequence orphan XP_002742507.1 2292013 D 284812 CDS SPAC13G7.01c 63054562 2542882 complement(join(2292801..2293088,2293137..2293754,2293811..2294893,2294940..2295116)) 1 NC_003424.3 lanosterol synthase Erg7 (predicted) 2295116 erg7 2542882 erg7 Schizosaccharomyces pombe 972h- lanosterol synthase Erg7 (predicted) NP_593702.2 2292801 R 284812 CDS SPAC13G7.02c 19114616 2542875 complement(2295819..2297753) 1 NC_003424.3 heat shock protein Ssa1 (predicted) 2297753 ssa1 2542875 ssa1 Schizosaccharomyces pombe 972h- heat shock protein Ssa1 (predicted) NP_593704.1 2295819 R 284812 CDS SPAC13G7.03 19114617 2542908 join(2298979..2299133,2299193..2299299,2299350..2299924) 1 NC_003424.3 up-frameshift suppressor3 family 2299924 2542908 SPAC13G7.03 Schizosaccharomyces pombe 972h- up-frameshift suppressor3 family NP_593705.1 2298979 D 284812 CDS SPAC13G7.04c 19114618 2542863 complement(2300522..2302792) 1 NC_003424.3 membrane anchored protein Mac1 2302792 mac1 2542863 mac1 Schizosaccharomyces pombe 972h- membrane anchored protein Mac1 NP_593706.1 2300522 R 284812 CDS SPAC13G7.05 19114619 2542851 2305345..2306958 1 NC_003424.3 acyl-coA-sterol acyltransferase (predicted) 2306958 2542851 SPAC13G7.05 Schizosaccharomyces pombe 972h- acyl-coA-sterol acyltransferase (predicted) NP_593707.1 2305345 D 284812 CDS SPAC13G7.06 19114620 2542836 2307729..2308529 1 NC_003424.3 phosphoadenosine phosphosulfate reductase 2308529 met16 2542836 met16 Schizosaccharomyces pombe 972h- phosphoadenosine phosphosulfate reductase NP_593708.1 2307729 D 284812 CDS SPAC13G7.07 162312438 2542879 join(2309026..2309212,2309259..2309569,2309610..2309667,2309714..2309958) 1 NC_003424.3 argonaute binding protein 2 2309958 arb2 2542879 arb2 Schizosaccharomyces pombe 972h- argonaute binding protein 2 NP_593709.2 2309026 D 284812 CDS SPAC13G7.08c 19114622 2542844 complement(join(2310386..2310517,2310561..2311571,2311694..2311891)) 1 NC_003424.3 WD repeat protein Crb3 2311891 crb3 2542844 crb3 Schizosaccharomyces pombe 972h- WD repeat protein Crb3 NP_593710.1 2310386 R 284812 CDS SPAC13G7.09c 19114623 2542852 complement(2312618..2313025) 1 NC_003424.3 sequence orphan 2313025 2542852 SPAC13G7.09c Schizosaccharomyces pombe 972h- sequence orphan NP_593711.1 2312618 R 284812 CDS SPAC13G7.10 19114624 2542820 join(2313746..2313961,2314049..2314131,2314190..2315063) 1 NC_003424.3 Myb family protein (predicted) 2315063 mug152 2542820 mug152 Schizosaccharomyces pombe 972h- Myb family protein (predicted) NP_593712.1 2313746 D 284812 CDS SPAC13G7.11 19114625 2542838 join(2315187..2315349,2315386..2315599,2315701..2316133) 1 NC_003424.3 mitochondrial respiratory complex assembly protein (predicted) 2316133 2542838 SPAC13G7.11 Schizosaccharomyces pombe 972h- mitochondrial respiratory complex assembly protein (predicted) NP_593713.1 2315187 D 284812 CDS SPAC13G7.12c 19114626 2542839 complement(2316467..2317837) 1 NC_003424.3 choline kinase (predicted) 2317837 2542839 SPAC13G7.12c Schizosaccharomyces pombe 972h- choline kinase (predicted) NP_593714.1 2316467 R 284812 CDS SPAC13G7.13c 63054563 2542861 complement(2318638..2320239) 1 NC_003424.3 RNA-binding protein Msa1 2320239 msa1 2542861 msa1 Schizosaccharomyces pombe 972h- RNA-binding protein Msa1 NP_593715.2 2318638 R 284812 CDS SPAC6C3.02c 19114628 2543292 complement(2324645..2325163) 1 NC_003424.3 CHCH domain protein (predicted) 2325163 2543292 SPAC6C3.02c Schizosaccharomyces pombe 972h- CHCH domain protein (predicted) NP_593716.1 2324645 R 284812 CDS SPAC6C3.03c 19114629 2543288 complement(2326332..2326634) 1 NC_003424.3 previously annotated as dubious, may not be protein coding; sequence orphan 2326634 2543288 SPAC6C3.03c Schizosaccharomyces pombe 972h- sequence orphan NP_593717.1 2326332 R 284812 CDS SPAC6C3.04 19114630 2543283 2328675..2330096 1 NC_003424.3 citrate synthase (predicted) 2330096 cit1 2543283 cit1 Schizosaccharomyces pombe 972h- citrate synthase (predicted) NP_593718.1 2328675 D 284812 CDS SPAC6C3.05 19114631 2543274 2331155..2331964 1 NC_003424.3 sequence orphan 2331964 2543274 SPAC6C3.05 Schizosaccharomyces pombe 972h- sequence orphan NP_593719.1 2331155 D 284812 CDS SPAC6C3.06c 19114632 2542915 complement(join(2332120..2332256,2332306..2332385,2332437..2332563,2332605..2335362)) 1 NC_003424.3 P-type ATPase, calcium transporting 2335362 2542915 SPAC6C3.06c Schizosaccharomyces pombe 972h- P-type ATPase, calcium transporting NP_593720.1 2332120 R 284812 CDS SPAC6C3.07 19114633 2542954 2336034..2337581 1 NC_003424.3 sequence orphan 2337581 mug68 2542954 mug68 Schizosaccharomyces pombe 972h- sequence orphan NP_593721.1 2336034 D 284812 CDS SPAC6C3.08 19114634 2542919 join(2338175..2338279,2338418..2339017) 1 NC_003424.3 proteasome regulatory particle, gankyrin (predicted) 2339017 2542919 SPAC6C3.08 Schizosaccharomyces pombe 972h- proteasome regulatory particle, gankyrin (predicted) NP_593722.1 2338175 D 284812 CDS SPAC6C3.09 19114635 2543013 join(2339884..2339976,2340021..2340168,2340219..2340275,2340392..2340950,2340991..2341141) 1 NC_003424.3 RNase P subunit (predicted) 2341141 2543013 SPAC6C3.09 Schizosaccharomyces pombe 972h- RNase P subunit (predicted) NP_593723.1 2339884 D 284812 CDS SPAC17G8.01c 63054564 2542158 complement(join(2341346..2343706,2343754..2343756)) 1 NC_003424.3 overlaps and extends orf SPAC6C3.09c which has similar to tRNA ligase, no met initiation codon near 5' end in this frame and splicing uncertain; tRNA ligase Trl1 (predicted) 2343756 trl1 2542158 trl1 Schizosaccharomyces pombe 972h- tRNA ligase Trl1 (predicted) NP_593724.2 2341346 R 284812 CDS SPAC17G8.02 19114637 2542154 2344815..2345807 1 NC_003424.3 uridine ribohydrolase (predicted) 2345807 2542154 SPAC17G8.02 Schizosaccharomyces pombe 972h- uridine ribohydrolase (predicted) NP_593725.1 2344815 D 284812 CDS SPAC17G8.03c 19114638 2542201 complement(2346432..2347031) 1 NC_003424.3 Dpb3p may be important for establishing or maintaining normal localization of Dbp4p (PMID 15388803); SPAC17G8.03c was annotated as similar to its top Blast hit S. cerevisiae YER159C, but its functional ortholog is YBR278W and the full length alignment is better; DNA polymerase epsilon subunit Dpb3 2347031 dpb3 2542201 dpb3 Schizosaccharomyces pombe 972h- DNA polymerase epsilon subunit Dpb3 NP_593726.1 2346432 R 284812 CDS SPAC17G8.04c 19114639 2542275 complement(join(2348552..2348614,2348705..2348881,2349008..2349080,2349125..2349270)) 1 NC_003424.3 ARP2/3 actin-organizing complex subunit Arc5 2349270 arc5 2542275 arc5 Schizosaccharomyces pombe 972h- ARP2/3 actin-organizing complex subunit Arc5 NP_593727.1 2348552 R 284812 CDS SPAC17G8.05 19114640 2542421 join(2350408..2350471,2350541..2351019) 1 NC_003424.3 mediator complex subunit Med20 2351019 med20 2542421 med20 Schizosaccharomyces pombe 972h- mediator complex subunit Med20 NP_593728.1 2350408 D 284812 CDS SPAC17G8.06c 19114641 2542155 complement(2351371..2353167) 1 NC_003424.3 dihydroxy-acid dehydratase (predicted) 2353167 2542155 SPAC17G8.06c Schizosaccharomyces pombe 972h- dihydroxy-acid dehydratase (predicted) NP_593729.1 2351371 R 284812 CDS SPAC17G8.07 19114642 2542278 2354401..2355054 1 NC_003424.3 YEATS family histone acetyltransferase subunit Yaf9 2355054 yaf9 2542278 yaf9 Schizosaccharomyces pombe 972h- YEATS family histone acetyltransferase subunit Yaf9 NP_593730.1 2354401 D 284812 CDS SPAC17G8.08c 19114643 2542208 complement(join(2355348..2356154,2356426..2356482)) 1 NC_003424.3 human TMEM165 homolog 2356482 2542208 SPAC17G8.08c Schizosaccharomyces pombe 972h- human TMEM165 homolog NP_593731.1 2355348 R 284812 CDS SPAC17G8.09 67999782 3361506 join(2357361..2357456,2357576..2357697,2357763..2357931) 1 NC_003424.3 Set1C complex subunit Shg1 2357931 shg1 3361506 shg1 Schizosaccharomyces pombe 972h- Set1C complex subunit Shg1 NP_001018248.1 2357361 D 284812 CDS SPAC17G8.10c 19114645 2542409 complement(2358570..2359373) 1 NC_003424.3 mitotic spindle checkpoint protein Dma1 2359373 dma1 2542409 dma1 Schizosaccharomyces pombe 972h- mitotic spindle checkpoint protein Dma1 NP_593733.1 2358570 R 284812 CDS SPAC17G8.11c 19114646 2542292 complement(2360443..2361513) 1 NC_003424.3 mannosyltransferase (predicted) 2361513 2542292 SPAC17G8.11c Schizosaccharomyces pombe 972h- mannosyltransferase (predicted) NP_593734.1 2360443 R 284812 CDS SPAC17G8.12 19114647 2542129 2363568..2365394 1 NC_003424.3 sequence orphan 2365394 2542129 SPAC17G8.12 Schizosaccharomyces pombe 972h- sequence orphan NP_593735.1 2363568 D 284812 CDS SPAC17G8.13c 19114648 2542170 complement(join(2365447..2366127,2366175..2366264,2366381..2366833)) 1 NC_003424.3 functional studies suggest that Mst2 is functionally more similar to S. cerevisiae Sas2 than Sas3; histone acetyltransferase Mst2 2366833 mst2 2542170 mst2 Schizosaccharomyces pombe 972h- histone acetyltransferase Mst2 NP_593736.1 2365447 R 284812 CDS SPAC17G8.14c 63054566 2542293 complement(join(2367405..2367496,2367542..2367725,2367767..2367955,2368000..2368201,2368257..2370556)) 1 NC_003424.3 protein kinase C (PKC)-like Pck1 2370556 pck1 2542293 pck1 Schizosaccharomyces pombe 972h- protein kinase C (PKC)-like Pck1 NP_593737.2 2367405 R 284812 CDS SPAC22H10.02 19114650 2541793 join(2371692..2371809,2371877..2371965,2372103..2372372) 1 NC_003424.3 conserved fungal protein 2372372 2541793 SPAC22H10.02 Schizosaccharomyces pombe 972h- conserved fungal protein NP_593738.1 2371692 D 284812 CDS SPAC22H10.03c 19114651 2541885 complement(join(2373144..2373263,2373303..2373355,2373413..2373583,2373626..2373744,2373792..2373961,2374002..2376223,2376280..2376385)) 1 NC_003424.3 karyopherin Kap14 2376385 kap114 2541885 kap114 Schizosaccharomyces pombe 972h- karyopherin Kap14 NP_593739.1 2373144 R 284812 CDS SPAC22H10.04 19114652 2541444 join(2377355..2377515,2377582..2377652,2377765..2378456) 1 NC_003424.3 protein phosphatase type 2A (predicted) 2378456 2541444 SPAC22H10.04 Schizosaccharomyces pombe 972h- protein phosphatase type 2A (predicted) NP_593740.1 2377355 D 284812 CDS SPAC22H10.05c 19114653 2541907 complement(join(2378728..2380026,2380172..2380243)) 1 NC_003424.3 mRNA cleavage and polyadenylation specificity factor complex subunit (predicted) 2380243 2541907 SPAC22H10.05c Schizosaccharomyces pombe 972h- mRNA cleavage and polyadenylation specificity factor complex subunit (predicted) NP_593741.1 2378728 R 284812 CDS SPAC22H10.06c 19114654 2541880 complement(2381320..2381601) 1 NC_003424.3 dubious 2381601 2541880 SPAC22H10.06c Schizosaccharomyces pombe 972h- dubious NP_593742.1 2381320 R 284812 CDS SPAC22H10.13 19114655 2541743 2381730..2381882 1 NC_003424.3 metallothionein Zym1 2381882 zym1 2541743 zym1 Schizosaccharomyces pombe 972h- metallothionein Zym1 NP_593743.1 2381730 D 284812 CDS SPAC22H10.07 19114656 2541726 join(2383172..2383180,2383234..2384835) 1 NC_003424.3 scaffold protein Scd2 2384835 scd2 2541726 scd2 Schizosaccharomyces pombe 972h- scaffold protein Scd2 NP_593744.1 2383172 D 284812 CDS SPAC22H10.08 19114657 2541732 join(2385907..2387265,2387322..2387441) 1 NC_003424.3 DUF2009 protein 2387441 2541732 SPAC22H10.08 Schizosaccharomyces pombe 972h- DUF2009 protein NP_593745.1 2385907 D 284812 CDS SPAC22H10.09 19114658 2541742 2387733..2389673 1 NC_003424.3 sequence orphan 2389673 2541742 SPAC22H10.09 Schizosaccharomyces pombe 972h- sequence orphan NP_593746.1 2387733 D 284812 CDS SPAC22H10.10 19114659 2541847 join(2390086..2390240,2390279..2390547,2390590..2390689,2390736..2391011,2391055..2391790) 1 NC_003424.3 tubulin specific chaperone cofactor E 2391790 alp21 2541847 alp21 Schizosaccharomyces pombe 972h- tubulin specific chaperone cofactor E NP_593747.1 2390086 D 284812 CDS SPAC22H10.11c 19114660 2541730 complement(2392370..2394259) 1 NC_003424.3 TOR signaling pathway transcriptional corepressor Crf1 (predicted) 2394259 2541730 SPAC22H10.11c Schizosaccharomyces pombe 972h- TOR signaling pathway transcriptional corepressor Crf1 (predicted) NP_593748.1 2392370 R 284812 CDS SPAC22H10.12c 19114661 2541727 complement(join(2395415..2396615,2396701..2396822)) 1 NC_003424.3 GDP dissociation inhibitor Gdi1 (predicted) 2396822 gdi1 2541727 gdi1 Schizosaccharomyces pombe 972h- GDP dissociation inhibitor Gdi1 (predicted) NP_593749.1 2395415 R 284812 CDS SPAC15F9.01c 19114662 2542752 complement(join(2397450..2397823,2397879..2398188)) 1 NC_003424.3 sequence orphan 2398188 2542752 SPAC15F9.01c Schizosaccharomyces pombe 972h- sequence orphan NP_593750.1 2397450 R 284812 CDS SPAC15F9.02 19114663 2541682 join(2399421..2399487,2399529..2400462,2400517..2400535) 1 NC_003424.3 nucleoporin Seh1 2400535 seh1 2541682 seh1 Schizosaccharomyces pombe 972h- nucleoporin Seh1 NP_593751.1 2399421 D 284812 CDS SPAC15F9.03c 162312440 2542783 complement(join(2400960..2401067,2401146..2401247,2401300..2401371,2401441..2401523,2401566..2401572)) 1 NC_003424.3 nuclear transport factor Nxt2 2401572 nxt2 2542783 nxt2 Schizosaccharomyces pombe 972h- nuclear transport factor Nxt2 XP_001713065.1 2400960 R 284812 CDS SPAC1B9.02c 19114666 2542492 complement(join(2402301..2402493,2402544..2403510,2403560..2404250,2404367..2404606)) 1 NC_003424.3 serine/threonine protein kinase Sck1 2404606 sck1 2542492 sck1 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Sck1 NP_593754.1 2402301 R 284812 CDS SPAC1B9.03c 162312442 2542610 join(2406664..2406687,2406746..2406805,2406866..2407951) 1 NC_003424.3 RNA-binding protein involved in ribosomal large subunit assembly and maintenance (predicted) 2407951 2542610 SPAC1B9.03c Schizosaccharomyces pombe 972h- RNA-binding protein involved in ribosomal large subunit assembly and maintenance (predicted) NP_593755.2 2406664 D 284812 CDS SPAC6B12.02c 19114669 2543237 complement(2408304..2413970) 1 NC_003424.3 DNA repair protein Mus7/Mms22 2413970 mus7 2543237 mus7 Schizosaccharomyces pombe 972h- DNA repair protein Mus7/Mms22 NP_593757.1 2408304 R 284812 CDS SPAC6B12.03c 19114670 2543232 complement(2414229..2415137) 1 NC_003424.3 HbrB family protein 2415137 2543232 SPAC6B12.03c Schizosaccharomyces pombe 972h- HbrB family protein NP_593758.1 2414229 R 284812 CDS SPAC6B12.18 162312444 5802889 2416385..2416606 1 NC_003424.3 dubious 2416606 5802889 SPAC6B12.18 Schizosaccharomyces pombe 972h- dubious XP_001713066.1 2416385 D 284812 CDS SPAC6B12.04c 19114671 2543228 complement(2416782..2418047) 1 NC_003424.3 no other genes of the kynurenine pathway (de novo synthesis of NAD+ from tryptophan) can be identified in S. pombe the arylformamidase activity molecular function was not included in the annotation inferrence.; aminotransferase class I and II 2418047 2543228 SPAC6B12.04c Schizosaccharomyces pombe 972h- aminotransferase class I and II NP_593759.1 2416782 R 284812 CDS SPAC6B12.05c 19114672 2543226 complement(2418732..2419619) 1 NC_003424.3 Ino80 complex subunit Ies2 2419619 ies2 2543226 ies2 Schizosaccharomyces pombe 972h- Ino80 complex subunit Ies2 NP_593760.1 2418732 R 284812 CDS SPAC6B12.06c 63054567 2543244 complement(2420488..2420841) 1 NC_003424.3 02-04-2004 deleted Adenine at 13981, extended gene prediction from 64 aa to 117 AA; conserved fungal protein 2420841 2543244 SPAC6B12.06c Schizosaccharomyces pombe 972h- conserved fungal protein NP_593761.2 2420488 R 284812 CDS SPAC6B12.07c 19114674 2543315 complement(2421791..2423161) 1 NC_003424.3 ubiquitin-protein ligase E3 (predicted) 2423161 2543315 SPAC6B12.07c Schizosaccharomyces pombe 972h- ubiquitin-protein ligase E3 (predicted) NP_593762.1 2421791 R 284812 CDS SPAC6B12.08 19114675 2542938 join(2426191..2426279,2426414..2427467) 1 NC_003424.3 NAS from PMID:17242366; DNAJ domain protein Jjj family 2427467 mug185 2542938 mug185 Schizosaccharomyces pombe 972h- DNAJ domain protein Jjj family NP_593763.1 2426191 D 284812 CDS SPAC6B12.09 19114676 2543319 2428020..2428934 1 NC_003424.3 tRNA m(1)G methyltransferase Trm10 (predicted) 2428934 trm10 2543319 trm10 Schizosaccharomyces pombe 972h- tRNA m(1)G methyltransferase Trm10 (predicted) NP_593764.1 2428020 D 284812 CDS SPAC6B12.10c 19114677 2543323 complement(join(2429169..2430459,2430544..2430617)) 1 NC_003424.3 DNA primase catalytic subunit Spp1 2430617 spp1 2543323 spp1 Schizosaccharomyces pombe 972h- DNA primase catalytic subunit Spp1 NP_593765.1 2429169 R 284812 CDS SPAC6B12.11 19114678 2543310 join(2430998..2431127,2431184..2431816,2431857..2432107) 1 NC_003424.3 DNA replication checkpoint protein Drc1 2432107 drc1 2543310 drc1 Schizosaccharomyces pombe 972h- DNA replication checkpoint protein Drc1 NP_593766.1 2430998 D 284812 CDS SPAC6B12.12 19114679 2543304 2433392..2435269 1 NC_003424.3 mitochondrial TOM complex subunit Tom70 (predicted) 2435269 tom70 2543304 tom70 Schizosaccharomyces pombe 972h- mitochondrial TOM complex subunit Tom70 (predicted) NP_593767.1 2433392 D 284812 CDS SPAC6B12.13 19114680 2543302 join(2436049..2436241,2436467..2436588) 1 NC_003424.3 protein phosphatase inhibitor (predicted) 2436588 2543302 SPAC6B12.13 Schizosaccharomyces pombe 972h- protein phosphatase inhibitor (predicted) NP_593768.1 2436049 D 284812 CDS SPAC6B12.14c 19114681 2543300 complement(2436999..2437463) 1 NC_003424.3 previously annotated as dubious, may not be protein coding; conserved fungal protein 2437463 2543300 SPAC6B12.14c Schizosaccharomyces pombe 972h- conserved fungal protein NP_593769.1 2436999 R 284812 CDS SPAC6B12.15 19114682 2543298 join(2439532..2439657,2439855..2440253,2440507..2440926) 1 NC_003424.3 RACK1 ortholog Cpc2 2440926 cpc2 2543298 cpc2 Schizosaccharomyces pombe 972h- RACK1 ortholog Cpc2 NP_593770.1 2439532 D 284812 CDS SPAC6B12.16 19114683 2543294 join(2442689..2443634,2443741..2443829) 1 NC_003424.3 conserved KTS*YWYHMN**HGI*SKG; conserved fungal protein 2443829 meu26 2543294 meu26 Schizosaccharomyces pombe 972h- conserved fungal protein NP_593771.1 2442689 D 284812 CDS SPAC32A11.04c 63054568 2542942 complement(join(2443986..2444921,2445002..2445031)) 1 NC_003424.3 translation initiation factor eIF2 beta subunit (predicted) 2445031 tif212 2542942 tif212 Schizosaccharomyces pombe 972h- translation initiation factor eIF2 beta subunit (predicted) NP_593772.2 2443986 R 284812 CDS SPAC32A11.01 19114686 2542524 join(2445280..2445412,2445473..2445968,2446052..2447585) 1 NC_003424.3 possible alternative for first splice donor sequence at 418 (gtatgg); orthology prediction, reciprocal Blast and PSI Blast (pers. comm. Maria Novatchkova); conserved fungal protein 2447585 mug8 2542524 mug8 Schizosaccharomyces pombe 972h- conserved fungal protein NP_593774.1 2445280 D 284812 CDS SPAC32A11.02c 19114687 2541700 complement(2447948..2450503) 1 NC_003424.3 conserved fungal protein 2450503 2541700 SPAC32A11.02c Schizosaccharomyces pombe 972h- conserved fungal protein NP_593775.1 2447948 R 284812 CDS SPAC32A11.03c 19114688 2542405 complement(2452719..2455547) 1 NC_003424.3 Pombe HomeoboX; homeobox transcription factor Phx1 2455547 phx1 2542405 phx1 Schizosaccharomyces pombe 972h- homeobox transcription factor Phx1 NP_593776.1 2452719 R 284812 CDS SPAC19A8.15 19114689 2542240 complement(2457658..2459751) 1 NC_003424.3 tryptophan synthase (predicted) 2459751 trp2 2542240 trp2 Schizosaccharomyces pombe 972h- tryptophan synthase (predicted) NP_593777.1 2457658 R 284812 CDS SPAC19A8.14 19114690 2542124 complement(2460340..2460957) 1 NC_003424.3 aminoacyl-tRNA hydrolase (predicted) 2460957 2542124 SPAC19A8.14 Schizosaccharomyces pombe 972h- aminoacyl-tRNA hydrolase (predicted) NP_593778.1 2460340 R 284812 CDS SPAC19A8.13 19114691 2542461 complement(2461349..2462134) 1 NC_003424.3 U1 snRNP-associated protein Usp101 (predicted) 2462134 usp101 2542461 usp101 Schizosaccharomyces pombe 972h- U1 snRNP-associated protein Usp101 (predicted) NP_593779.1 2461349 R 284812 CDS SPAC19A8.12 19114692 2542503 complement(2462726..2464951) 1 NC_003424.3 mRNA decapping complex subunit Dcp2 2464951 dcp2 2542503 dcp2 Schizosaccharomyces pombe 972h- mRNA decapping complex subunit Dcp2 NP_593780.1 2462726 R 284812 CDS SPAC19A8.11c 19114693 2542549 join(2465348..2465405,2465446..2465835,2465878..2466069,2466113..2466213) 1 NC_003424.3 recombination protein Irc6 (predicted) 2466213 2542549 SPAC19A8.11c Schizosaccharomyces pombe 972h- recombination protein Irc6 (predicted) NP_593781.1 2465348 D 284812 CDS SPAC19A8.10 19114694 2542542 complement(2466495..2467259) 1 NC_003424.3 SUMO-targeted ubiquitin-protein ligase subunit Rfp1 2467259 rfp1 2542542 rfp1 Schizosaccharomyces pombe 972h- SUMO-targeted ubiquitin-protein ligase subunit Rfp1 NP_593782.1 2466495 R 284812 CDS SPAC19A8.09 19114695 2542215 complement(join(2467945..2468000,2468043..2468144,2468195..2468254,2468292..2468319)) 1 NC_003424.3 ER to Golgi transport protein Yos1 (predicted) 2468319 2542215 SPAC19A8.09 Schizosaccharomyces pombe 972h- ER to Golgi transport protein Yos1 (predicted) NP_593783.1 2467945 R 284812 CDS SPAC19A8.08 19114696 2542147 complement(2468794..2471943) 1 NC_003424.3 nonsense-mediated decay protein Upf2 2471943 upf2 2542147 upf2 Schizosaccharomyces pombe 972h- nonsense-mediated decay protein Upf2 NP_593784.1 2468794 R 284812 CDS SPAC19A8.07c 19114697 2542446 2474717..2475586 1 NC_003424.3 U3 snoRNP-associated protein Imp4 (predicted) 2475586 2542446 SPAC19A8.07c Schizosaccharomyces pombe 972h- U3 snoRNP-associated protein Imp4 (predicted) NP_593785.1 2474717 D 284812 CDS SPAC19A8.06 19114698 2542391 complement(2475966..2477159) 1 NC_003424.3 short chain dehydrogenase (predicted) 2477159 2542391 SPAC19A8.06 Schizosaccharomyces pombe 972h- short chain dehydrogenase (predicted) NP_593786.1 2475966 R 284812 CDS SPAC19A8.05c 19114699 2542403 2478119..2479951 1 NC_003424.3 sorting receptor for ubiquitinated membrane proteins, ESCRT 0 complex subunit Sst4 2479951 sst4 2542403 sst4 Schizosaccharomyces pombe 972h- sorting receptor for ubiquitinated membrane proteins, ESCRT 0 complex subunit Sst4 NP_593787.1 2478119 D 284812 CDS SPAC19A8.04 19114700 2542469 complement(join(2480147..2481645,2481978..2482104)) 1 NC_003424.3 C-22 sterol desaturase Erg5 (predicted) 2482104 erg5 2542469 erg5 Schizosaccharomyces pombe 972h- C-22 sterol desaturase Erg5 (predicted) NP_593788.1 2480147 R 284812 CDS SPAC19A8.03 19114701 2542522 complement(join(2482966..2484045,2484091..2484666,2484723..2484746)) 1 NC_003424.3 phosphatidylinositol-3-phosphatase (predicted) 2484746 2542522 SPAC19A8.03 Schizosaccharomyces pombe 972h- phosphatidylinositol-3-phosphatase (predicted) NP_593789.1 2482966 R 284812 CDS SPAC19A8.02 19114702 2542216 complement(join(2485198..2485537,2485636..2488937)) 1 NC_003424.3 pleckstrin homology domain protein 2488937 2542216 SPAC19A8.02 Schizosaccharomyces pombe 972h- pleckstrin homology domain protein NP_593790.1 2485198 R 284812 CDS SPAC19A8.01c 162312446 3361502 2490863..2494111 1 NC_003424.3 guanyl-nucleotide exchange factor Sec73 (predicted) 2494111 sec73 3361502 sec73 Schizosaccharomyces pombe 972h- guanyl-nucleotide exchange factor Sec73 (predicted) XP_001713067.1 2490863 D 284812 CDS SPAC23H3.02c 19114704 2541843 complement(join(2494814..2494856,2494896..2495142,2495214..2495267,2495309..2495318)) 1 NC_003424.3 RING finger-like protein Ini1 2495318 ini1 2541843 ini1 Schizosaccharomyces pombe 972h- RING finger-like protein Ini1 NP_593792.1 2494814 R 284812 CDS SPAC23H3.03c 19114705 2541840 complement(join(2496113..2496697,2496739..2496875,2496919..2497426)) 1 NC_003424.3 nitrogen permease regulator family 2497426 2541840 SPAC23H3.03c Schizosaccharomyces pombe 972h- nitrogen permease regulator family NP_593793.1 2496113 R 284812 CDS SPAC23H3.04 295442985 2541775 join(2499035..2499159,2499161..2499353,2499443..2499824,2499875..2500236) 1 NC_003424.3 conserved fungal protein 2500236 2541775 SPAC23H3.04 Schizosaccharomyces pombe 972h- conserved fungal protein NP_593794.2 2499035 D 284812 CDS SPAC23H3.05c 19114707 2541776 complement(2500613..2501809) 1 NC_003424.3 Set1C complex subunit Swd1 2501809 swd1 2541776 swd1 Schizosaccharomyces pombe 972h- Set1C complex subunit Swd1 NP_593795.1 2500613 R 284812 CDS SPAC23H3.06 19114708 2541771 join(2502977..2503957,2504008..2505264) 1 NC_003424.3 AP-3 adaptor complex subunit Apl6 (predicted) 2505264 apl6 2541771 apl6 Schizosaccharomyces pombe 972h- AP-3 adaptor complex subunit Apl6 (predicted) NP_593796.1 2502977 D 284812 CDS SPAC23H3.07c 19114709 2541862 complement(join(2505437..2505452,2505494..2505540,2505590..2505844)) 1 NC_003424.3 mitochondrial ribosomal protein subunit S14 (predicted) 2505844 mrp2 2541862 mrp2 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit S14 (predicted) NP_593797.1 2505437 R 284812 CDS SPAC23H3.08c 19114710 2541856 complement(join(2506299..2506939,2506985..2507306)) 1 NC_003424.3 mitotic spindle checkpoint protein Bub3 2507306 bub3 2541856 bub3 Schizosaccharomyces pombe 972h- mitotic spindle checkpoint protein Bub3 NP_593798.1 2506299 R 284812 CDS SPAC23H3.09c 19114711 2541852 complement(2507913..2509043) 1 NC_003424.3 threonine aldolase (predicted) 2509043 gly1 2541852 gly1 Schizosaccharomyces pombe 972h- threonine aldolase (predicted) NP_593799.1 2507913 R 284812 CDS SPAC23H3.10 19114712 2541851 2511251..2512762 1 NC_003424.3 SWI/SNF and RSC complex subunit Ssr2 2512762 ssr2 2541851 ssr2 Schizosaccharomyces pombe 972h- SWI/SNF and RSC complex subunit Ssr2 NP_593800.1 2511251 D 284812 CDS SPAC23H3.11c 19114713 2541866 complement(2512960..2514849) 1 NC_003424.3 glucosidase (predicted) 2514849 2541866 SPAC23H3.11c Schizosaccharomyces pombe 972h- glucosidase (predicted) NP_593801.1 2512960 R 284812 CDS SPAC23H3.12c 19114714 2541865 complement(2515193..2515873) 1 NC_003424.3 conserved protein (fungal and plant) 2515873 2541865 SPAC23H3.12c Schizosaccharomyces pombe 972h- conserved protein (fungal and plant) NP_593802.1 2515193 R 284812 CDS SPAC23H3.13c 19114715 2541720 complement(join(2516846..2517789,2518195..2518315)) 1 NC_003424.3 heterotrimeric G protein alpha-2 subunit Gpa2 2518315 gpa2 2541720 gpa2 Schizosaccharomyces pombe 972h- heterotrimeric G protein alpha-2 subunit Gpa2 NP_593803.1 2516846 R 284812 CDS SPAC23H3.14 19114716 2541794 join(2521698..2521750,2521809..2521917,2522034..2523281) 1 NC_003424.3 LAlv9 family protein, involved in post Golgi transport 2523281 2541794 SPAC23H3.14 Schizosaccharomyces pombe 972h- LAlv9 family protein, involved in post Golgi transport NP_593804.1 2521698 D 284812 CDS SPAC23H3.15c 19114717 2541823 complement(2523629..2524606) 1 NC_003424.3 sequence orphan 2524606 2541823 SPAC23H3.15c Schizosaccharomyces pombe 972h- sequence orphan NP_593805.1 2523629 R 284812 CDS SPAC25H1.02 19114718 2542086 2525917..2527311 1 NC_003424.3 Jmj1 protein 2527311 jmj1 2542086 jmj1 Schizosaccharomyces pombe 972h- Jmj1 protein NP_593806.1 2525917 D 284812 CDS SPAC25H1.03 19114719 2542723 join(2528038..2528101,2528154..2528644) 1 NC_003424.3 meiotically upregulated gene Mug66 2528644 mug66 2542723 mug66 Schizosaccharomyces pombe 972h- meiotically upregulated gene Mug66 NP_593807.1 2528038 D 284812 CDS SPAC25H1.04 19114720 2542717 2529085..2529819 1 NC_003424.3 DUF1671 family protein 2529819 mug105 2542717 mug105 Schizosaccharomyces pombe 972h- DUF1671 family protein NP_593808.1 2529085 D 284812 CDS SPAC25H1.05 19114721 2542722 2530138..2530791 1 NC_003424.3 sequence orphan 2530791 meu29 2542722 meu29 Schizosaccharomyces pombe 972h- sequence orphan NP_593809.1 2530138 D 284812 CDS SPAC25H1.06 19114722 2541656 2531453..2532679 1 NC_003424.3 CAF assembly factor (CAF-1) complex subunit C, Pcf3 2532679 pcf3 2541656 pcf3 Schizosaccharomyces pombe 972h- CAF assembly factor (CAF-1) complex subunit C, Pcf3 NP_593810.1 2531453 D 284812 CDS SPAC25H1.10c 295442987 9407226 complement(join(2532904..2532928,2532991..2533127,2533170..2533214)) 1 NC_003424.3 F0-ATPase subunit K 2533214 atp19 9407226 atp19 Schizosaccharomyces pombe 972h- F0-ATPase subunit K XP_002742508.1 2532904 R 284812 CDS SPAC25H1.07 19114723 2542716 2533821..2536478 1 NC_003424.3 DUF1620 family protein 2536478 2542716 SPAC25H1.07 Schizosaccharomyces pombe 972h- DUF1620 family protein NP_593811.1 2533821 D 284812 CDS SPAC25H1.08c 19114724 2542715 complement(2536701..2537900) 1 NC_003424.3 ribosome biogenesis protein Sqt1 (predicted) 2537900 2542715 SPAC25H1.08c Schizosaccharomyces pombe 972h- ribosome biogenesis protein Sqt1 (predicted) NP_593812.1 2536701 R 284812 CDS SPAC25H1.09 162312448 3361499 2538461..2540002 1 NC_003424.3 alpha-amylase homolog Mde5 2540002 mde5 3361499 mde5 Schizosaccharomyces pombe 972h- alpha-amylase homolog Mde5 XP_001713068.1 2538461 D 284812 CDS SPAC4A8.02c 19114725 2543398 complement(join(2540247..2540642,2540693..2540725)) 1 NC_003424.3 hypothetical protein 2540725 2543398 SPAC4A8.02c Schizosaccharomyces pombe 972h- hypothetical protein NP_593813.1 2540247 R 284812 CDS SPAC4A8.03c 19114726 2543095 complement(2541287..2542438) 1 NC_003424.3 protein phosphatase 2C Ptc4 2542438 ptc4 2543095 ptc4 Schizosaccharomyces pombe 972h- protein phosphatase 2C Ptc4 NP_593814.1 2541287 R 284812 CDS SPAC4A8.04 19114727 2543097 2545350..2546753 1 NC_003424.3 vacuolar serine protease Isp6 2546753 isp6 2543097 isp6 Schizosaccharomyces pombe 972h- vacuolar serine protease Isp6 NP_593815.1 2545350 D 284812 CDS SPAC4A8.05c 19114728 2543576 complement(2547351..2553665) 1 NC_003424.3 myosin-3 isoform; myosin II heavy chain Myo3 2553665 myp2 2543576 myp2 Schizosaccharomyces pombe 972h- myosin II heavy chain Myo3 NP_593816.1 2547351 R 284812 CDS SPAC4A8.06c 19114729 2543098 complement(2554013..2555749) 1 NC_003424.3 esterase/lipase (predicted) 2555749 2543098 SPAC4A8.06c Schizosaccharomyces pombe 972h- esterase/lipase (predicted) NP_593817.1 2554013 R 284812 CDS SPAC4A8.07c 19114730 2543328 complement(join(2556773..2557848,2557938..2558123,2558183..2558297)) 1 NC_003424.3 sphingoid long chain base kinase (predicted) 2558297 2543328 SPAC4A8.07c Schizosaccharomyces pombe 972h- sphingoid long chain base kinase (predicted) NP_593818.1 2556773 R 284812 CDS SPAC4A8.08c 19114731 2543603 complement(join(2558600..2558893,2558942..2559214,2559254..2561080,2561121..2561210,2561255..2561371,2561410..2561562,2561616..2561714)) 1 NC_003424.3 assigned mitochondrial location due to presence of presequence similar to that found on S. cerevisiae YGR094W, used to direct protein to the mitochondria; mitochondrial valine-tRNA ligase Vas1 (predicted) 2561714 vas1 2543603 vas1 Schizosaccharomyces pombe 972h- mitochondrial valine-tRNA ligase Vas1 (predicted) NP_593819.1 2558600 R 284812 CDS SPAC4A8.09c 19114733 2543616 complement(join(2563011..2563889,2563961..2563963)) 1 NC_003424.3 annexin v-binding protein?; complexed with Cdc5 protein Cwf21 2563963 cwf21 2543616 cwf21 Schizosaccharomyces pombe 972h- complexed with Cdc5 protein Cwf21 NP_593820.1 2563011 R 284812 CDS SPAC4A8.10 19114734 2543617 2564629..2566800 1 NC_003424.3 lipase (predicted) 2566800 2543617 SPAC4A8.10 Schizosaccharomyces pombe 972h- lipase (predicted) NP_593822.1 2564629 D 284812 CDS SPAC4A8.11c 19114735 2543618 complement(2567040..2572568) 1 NC_003424.3 primary name changed to fas2 and synonym to lsd1 date=20061024; fatty acid synthase alpha subunit Lsd1 2572568 fas2 2543618 fas2 Schizosaccharomyces pombe 972h- fatty acid synthase alpha subunit Lsd1 NP_593823.1 2567040 R 284812 CDS SPAC4A8.12c 19114736 2543597 complement(join(2573420..2574295,2574351..2574473)) 1 NC_003424.3 protein phosphatase regulatory subunit Sds22 2574473 sds22 2543597 sds22 Schizosaccharomyces pombe 972h- protein phosphatase regulatory subunit Sds22 NP_593824.1 2573420 R 284812 CDS SPAC4A8.13c 19114737 2543623 complement(2575106..2575924) 1 NC_003424.3 20S proteasome component beta 5 2575924 pts1 2543623 pts1 Schizosaccharomyces pombe 972h- 20S proteasome component beta 5 NP_593825.1 2575106 R 284812 CDS SPAC4A8.14 19114738 2543525 join(2576501..2577577,2577620..2577772) 1 NC_003424.3 prs1 is the primary name for SPBC19C7.06 using unified nomenclature for tRNA ligases; ribose-phosphate pyrophosphokinase (predicted) 2577772 2543525 SPAC4A8.14 Schizosaccharomyces pombe 972h- ribose-phosphate pyrophosphokinase (predicted) NP_593826.1 2576501 D 284812 CDS SPAC4A8.15c 19114739 2543526 complement(join(2578990..2579027,2579084..2579416,2579466..2579478)) 1 NC_003424.3 profilin 2579478 cdc3 2543526 cdc3 Schizosaccharomyces pombe 972h- profilin NP_593827.1 2578990 R 284812 CDS SPAC4A8.16c 63054571 2543621 complement(2580220..2582976) 1 NC_003424.3 translation initiation factor eIF3c 2582976 tif33 2543621 tif33 Schizosaccharomyces pombe 972h- translation initiation factor eIF3c NP_593828.2 2580220 R 284812 CDS SPAC823.02 19114741 2542525 join(2583804..2583902,2583941..2583973) 1 NC_003424.3 confirmed intron; sequence orphan 2583973 2542525 SPAC823.02 Schizosaccharomyces pombe 972h- sequence orphan NP_593829.1 2583804 D 284812 CDS SPAC823.03 19114742 2542228 join(2585755..2585943,2585991..2587406) 1 NC_003424.3 serine/threonine protein kinase Ppk15 (predicted) 2587406 ppk15 2542228 ppk15 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Ppk15 (predicted) NP_593830.1 2585755 D 284812 CDS SPAC823.04 295442989 2543403 join(2587729..2587897,2588106..2588620) 1 NC_003424.3 This does not agree with Solexa intron at 2587898..2587951 but can't find a better prediction; rRNA processing protein, DUF947 family (predicted) 2588620 2543403 SPAC823.04 Schizosaccharomyces pombe 972h- rRNA processing protein, DUF947 family (predicted) NP_593831.2 2587729 D 284812 CDS SPAC823.05c 19114744 2543436 complement(join(2588863..2589275,2589328..2589820)) 1 NC_003424.3 SNARE Tlg2 (predicted) 2589820 tlg2 2543436 tlg2 Schizosaccharomyces pombe 972h- SNARE Tlg2 (predicted) NP_593832.1 2588863 R 284812 CDS SPAC823.06 19114745 2543604 2590313..2590780 1 NC_003424.3 transcription factor TFIID complex subunit Taf3 (predicted) 2590780 taf3 2543604 taf3 Schizosaccharomyces pombe 972h- transcription factor TFIID complex subunit Taf3 (predicted) NP_593833.1 2590313 D 284812 CDS SPAC823.07 19114746 2543664 2591413..2592408 1 NC_003424.3 GPI-phospholipase A2 activity regulator (predicted) 2592408 2543664 SPAC823.07 Schizosaccharomyces pombe 972h- GPI-phospholipase A2 activity regulator (predicted) NP_593834.1 2591413 D 284812 CDS SPAC823.08c 19114747 2543571 complement(2592647..2594044) 1 NC_003424.3 ATP-dependent RNA helicase Rrp3 (predicted) 2594044 2543571 SPAC823.08c Schizosaccharomyces pombe 972h- ATP-dependent RNA helicase Rrp3 (predicted) NP_593835.1 2592647 R 284812 CDS SPAC823.09c 295442991 2543542 complement(join(2594777..2594913,2594966..2595693,2595734..2595819)) 1 NC_003424.3 L-asparaginase (predicted) 2595819 2543542 SPAC823.09c Schizosaccharomyces pombe 972h- L-asparaginase (predicted) NP_593836.2 2594777 R 284812 CDS SPAC823.10c 19114749 2543361 complement(join(2596251..2596736,2596805..2597209)) 1 NC_003424.3 mitochondrial carrier with solute carrier repeats 2597209 2543361 SPAC823.10c Schizosaccharomyces pombe 972h- mitochondrial carrier with solute carrier repeats NP_593837.1 2596251 R 284812 CDS SPAC823.11 19114750 2543496 join(2598325..2598495,2598552..2599299,2599352..2599668) 1 NC_003424.3 sphingosine-1-phosphate phosphatase (predicted) 2599668 2543496 SPAC823.11 Schizosaccharomyces pombe 972h- sphingosine-1-phosphate phosphatase (predicted) NP_593838.1 2598325 D 284812 CDS SPAC823.12 19114751 2543359 2601242..2603962 1 NC_003424.3 zinc finger protein, HOPs complex subunit Pep5/Vps11 (predicted) 2603962 2543359 SPAC823.12 Schizosaccharomyces pombe 972h- zinc finger protein, HOPs complex subunit Pep5/Vps11 (predicted) NP_593839.1 2601242 D 284812 CDS SPAC823.13c 19114752 2543230 complement(2604259..2605212) 1 NC_003424.3 mitochondrial inner membrane protein (predicted) 2605212 2543230 SPAC823.13c Schizosaccharomyces pombe 972h- mitochondrial inner membrane protein (predicted) NP_593840.1 2604259 R 284812 CDS SPAC823.14 19114753 2543317 join(2606185..2606227,2606279..2606317,2606541..2606613,2606655..2607189) 1 NC_003424.3 phosphoric monoester hydrolase (predicted) 2607189 2543317 SPAC823.14 Schizosaccharomyces pombe 972h- phosphoric monoester hydrolase (predicted) NP_593841.1 2606185 D 284812 CDS SPAC823.15 19114754 2542052 2608103..2609032 1 NC_003424.3 minor serine/threonine protein phosphatase Ppa1 2609032 ppa1 2542052 ppa1 Schizosaccharomyces pombe 972h- minor serine/threonine protein phosphatase Ppa1 NP_593842.1 2608103 D 284812 CDS SPAC823.16c 19114755 2543297 complement(join(2609469..2609481,2609522..2610291,2610348..2610454,2610529..2610602,2610661..2610704)) 1 NC_003424.3 WD repeat protein Mug179 2610704 mug179 2543297 mug179 Schizosaccharomyces pombe 972h- WD repeat protein Mug179 NP_593843.1 2609469 R 284812 CDS SPAC7D4.14c 19114756 2541655 2611100..2612755 1 NC_003424.3 sequence orphan 2612755 2541655 SPAC7D4.14c Schizosaccharomyces pombe 972h- sequence orphan NP_593844.1 2611100 D 284812 CDS SPAC7D4.13c 19114757 2541497 join(2613296..2613310,2613383..2614306) 1 NC_003424.3 sequence orphan 2614306 2541497 SPAC7D4.13c Schizosaccharomyces pombe 972h- sequence orphan NP_593845.1 2613296 D 284812 CDS SPAC7D4.12c 19114758 2541761 2615042..2617321 1 NC_003424.3 DUF1212 family protein 2617321 2541761 SPAC7D4.12c Schizosaccharomyces pombe 972h- DUF1212 family protein NP_593846.1 2615042 D 284812 CDS SPAC7D4.11c 19114759 2541492 2617975..2620284 1 NC_003424.3 secretory pathway protein Sec39 (predicted) 2620284 sec39 2541492 sec39 Schizosaccharomyces pombe 972h- secretory pathway protein Sec39 (predicted) NP_593847.1 2617975 D 284812 CDS SPAC7D4.10 19114760 2541906 complement(join(2620295..2620319,2620575..2621519,2621662..2621725,2621776..2621878,2621932..2622120,2622169..2622195)) 1 NC_003424.3 there are 2 different confirmed introns at 3' which would give slightly different products; possible alternative splice for C-term, have 2 different confirmed introns; V-type ATPase subunit H (predicted) 2622195 vma13 2541906 vma13 Schizosaccharomyces pombe 972h- V-type ATPase subunit H (predicted) NP_593848.1 2620295 R 284812 CDS SPAC7D4.09c 19114761 2541583 2622666..2623490 1 NC_003424.3 steroid dehydrogenase (predicted) 2623490 2541583 SPAC7D4.09c Schizosaccharomyces pombe 972h- steroid dehydrogenase (predicted) NP_593849.1 2622666 D 284812 CDS SPAC7D4.15c 19114762 2542479 complement(2623940..2624038) 1 NC_003424.3 oligosaccharyltransferase subunit Ost4 (predicted) 2624038 ost4 2542479 ost4 Schizosaccharomyces pombe 972h- oligosaccharyltransferase subunit Ost4 (predicted) NP_593850.1 2623940 R 284812 CDS SPAC7D4.08 19114763 2542739 complement(2625042..2625332) 1 NC_003424.3 previously annotated as dubious, but has localization signal; below 100 amino acid size threshold; sequence orphan 2625332 2542739 SPAC7D4.08 Schizosaccharomyces pombe 972h- sequence orphan NP_593851.1 2625042 R 284812 CDS SPAC7D4.07c 19114764 2542084 2625457..2625768 1 NC_003424.3 cytosolic thioredoxin Trx1 2625768 trx1 2542084 trx1 Schizosaccharomyces pombe 972h- cytosolic thioredoxin Trx1 NP_593852.1 2625457 D 284812 CDS SPAC7D4.06c 19114765 2542768 2626583..2627803 1 NC_003424.3 dolichol-P-Man dependent alpha(1-3) mannosyltransferase Alg3 2627803 alg3 2542768 alg3 Schizosaccharomyces pombe 972h- dolichol-P-Man dependent alpha(1-3) mannosyltransferase Alg3 NP_593853.1 2626583 D 284812 CDS SPAC7D4.05 19114766 2541452 complement(join(2629373..2629819,2629909..2629985,2630030..2630183)) 1 NC_003424.3 hydrolase (predicted) 2630183 2541452 SPAC7D4.05 Schizosaccharomyces pombe 972h- hydrolase (predicted) NP_593854.1 2629373 R 284812 CDS SPAC7D4.04 19114767 2541735 complement(2630589..2633369) 1 NC_003424.3 Taz1 interacting factor 1, autophagy protein 2633369 taf1 2541735 taf1 Schizosaccharomyces pombe 972h- Taz1 interacting factor 1, autophagy protein NP_593855.1 2630589 R 284812 CDS SPAC7D4.03c 19114768 2542089 2634211..2636871 1 NC_003424.3 conserved fungal family 2636871 2542089 SPAC7D4.03c Schizosaccharomyces pombe 972h- conserved fungal family NP_593856.1 2634211 D 284812 CDS SPAC7D4.02c 19114769 2542091 join(2637726..2637808,2637979..2638210,2638304..2639057,2639121..2639299) 1 NC_003424.3 src (SH3) homology domain protein 2639299 2542091 SPAC7D4.02c Schizosaccharomyces pombe 972h- src (SH3) homology domain protein NP_593857.1 2637726 D 284812 CDS SPAC4F8.15 63054572 2543145 complement(2639701..2641428) 1 NC_003424.3 myo-inositol transporter Itr1 2641428 itr1 2543145 itr1 Schizosaccharomyces pombe 972h- myo-inositol transporter Itr1 NP_593858.2 2639701 R 284812 CDS SPAC4F8.14c 19114771 2543141 join(2643624..2643683,2643860..2645143) 1 NC_003424.3 3-hydroxy-3-methylglutaryl-CoA synthase 2645143 hcs1 2543141 hcs1 Schizosaccharomyces pombe 972h- 3-hydroxy-3-methylglutaryl-CoA synthase NP_593859.1 2643624 D 284812 CDS SPAC4F8.13c 19114772 2543129 2645517..2649986 1 NC_003424.3 localization dependent on actin; IQGAP 2649986 rng2 2543129 rng2 Schizosaccharomyces pombe 972h- IQGAP NP_593860.1 2645517 D 284812 CDS SPAC4F8.12c 19114773 2543413 2650738..2657829 1 NC_003424.3 U5 snRNP complex subunit Spp42 2657829 spp42 2543413 spp42 Schizosaccharomyces pombe 972h- U5 snRNP complex subunit Spp42 NP_593861.1 2650738 D 284812 CDS SPAC4F8.11 19114774 2543518 complement(2658044..2660584) 1 NC_003424.3 WD repeat protein, human WDR24 family 2660584 2543518 SPAC4F8.11 Schizosaccharomyces pombe 972h- WD repeat protein, human WDR24 family NP_593862.1 2658044 R 284812 CDS SPAC4F8.10c 19114775 2543446 2661801..2662325 1 NC_003424.3 SM22/transgelin-like actin modulating protein Stg1 2662325 stg1 2543446 stg1 Schizosaccharomyces pombe 972h- SM22/transgelin-like actin modulating protein Stg1 NP_593863.1 2661801 D 284812 CDS SPAC4F8.08 19114776 2543615 complement(2664524..2664979) 1 NC_003424.3 sequence orphan 2664979 mug114 2543615 mug114 Schizosaccharomyces pombe 972h- sequence orphan NP_593864.1 2664524 R 284812 CDS SPAC4F8.07c 19114777 2543607 2665816..2667183 1 NC_003424.3 hexokinase 2 2667183 hxk2 2543607 hxk2 Schizosaccharomyces pombe 972h- hexokinase 2 NP_593865.1 2665816 D 284812 CDS SPAC4F8.06 19114778 2543614 complement(2668334..2668774) 1 NC_003424.3 mitochondrial ribosomal protein subunit S12 (predicted) 2668774 2543614 SPAC4F8.06 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit S12 (predicted) NP_593866.1 2668334 R 284812 CDS SPAC4F8.05c 19114779 2543588 2669813..2670169 1 NC_003424.3 mitochondrial ribosomal protein subunit L28 (predicted) 2670169 mrpl28 2543588 mrpl28 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit L28 (predicted) NP_593867.1 2669813 D 284812 CDS SPAC4F8.04 19114780 2543503 complement(2670529..2671449) 1 NC_003424.3 Brix domain protein Rpf1 (predicted) 2671449 2543503 SPAC4F8.04 Schizosaccharomyces pombe 972h- Brix domain protein Rpf1 (predicted) NP_593868.1 2670529 R 284812 CDS SPAC4F8.03 19114781 2543459 complement(join(2672171..2672783,2672978..2673105)) 1 NC_003424.3 SBDS family ribosome maturation protein Sdo1 (predicted) 2673105 2543459 SPAC4F8.03 Schizosaccharomyces pombe 972h- SBDS family ribosome maturation protein Sdo1 (predicted) NP_593869.1 2672171 R 284812 CDS SPAC4F8.02c 19114782 2543447 2673980..2674819 1 NC_003424.3 mitochondrial ribosomal protein subunit L40 (predicted) 2674819 mrpl40 2543447 mrpl40 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit L40 (predicted) NP_593870.1 2673980 D 284812 CDS SPAC4F8.01 162312450 2543521 complement(join(2675099..2675398,2675556..2675606,2675689..2675970)) 1 NC_003424.3 vacuolar sorting protein Did4 2675970 did4 2543521 did4 Schizosaccharomyces pombe 972h- vacuolar sorting protein Did4 NP_593871.3 2675099 R 284812 CDS SPAC644.04 19114784 2543671 join(2677140..2677373,2677428..2678105) 1 NC_003424.3 RNA 5'-triphosphatase 2678105 pct1 2543671 pct1 Schizosaccharomyces pombe 972h- RNA 5'-triphosphatase NP_593872.1 2677140 D 284812 CDS SPAC644.05c 19114785 2543669 complement(2678627..2679049) 1 NC_003424.3 deoxyuridine 5'-triphosphate nucleotidohydrolase (predicted) 2679049 2543669 SPAC644.05c Schizosaccharomyces pombe 972h- deoxyuridine 5'-triphosphate nucleotidohydrolase (predicted) NP_593873.1 2678627 R 284812 CDS SPAC644.06c 19114786 2543666 complement(2679765..2681546) 1 NC_003424.3 GIN4 family protein kinase Cdr1 2681546 cdr1 2543666 cdr1 Schizosaccharomyces pombe 972h- GIN4 family protein kinase Cdr1 NP_593874.1 2679765 R 284812 CDS SPAC644.07 19114787 2543663 2686406..2687755 1 NC_003424.3 mitochondrial Rieske ISP assembly ATPase (predicted) 2687755 2543663 SPAC644.07 Schizosaccharomyces pombe 972h- mitochondrial Rieske ISP assembly ATPase (predicted) NP_593875.1 2686406 D 284812 CDS SPAC644.08 19114788 2543661 join(2688195..2688263,2688317..2688898) 1 NC_003424.3 methionine salvage haloacid dehalogenase-like hydrolase (predicted) 2688898 2543661 SPAC644.08 Schizosaccharomyces pombe 972h- methionine salvage haloacid dehalogenase-like hydrolase (predicted) NP_593876.1 2688195 D 284812 CDS SPAC644.09 19114789 2543658 join(2689703..2689771,2690153..2690272,2690408..2690743,2690804..2690992) 1 NC_003424.3 alanine racemase (predicted) 2690992 2543658 SPAC644.09 Schizosaccharomyces pombe 972h- alanine racemase (predicted) NP_593877.1 2689703 D 284812 CDS SPAC644.10 19114790 2543656 join(2691464..2691798,2691859..2691874) 1 NC_003424.3 previously annotated as dubious, but has localization signal; mediator complex subunit Med11 (predicted) 2691874 med11 2543656 med11 Schizosaccharomyces pombe 972h- mediator complex subunit Med11 (predicted) NP_593878.1 2691464 D 284812 CDS SPAC644.11c 19114791 2543651 complement(join(2692031..2692174,2692234..2693106,2693186..2693352,2693436..2693529)) 1 NC_003424.3 no detectable kinase domain; mitochondrial pyruvate dehydrogenase (lipoamide) kinase 2693529 2543651 SPAC644.11c Schizosaccharomyces pombe 972h- mitochondrial pyruvate dehydrogenase (lipoamide) kinase NP_593879.1 2692031 R 284812 CDS SPAC644.12 19114792 2543583 join(2694758..2694776,2694817..2694836,2694903..2694917,2694982..2695101,2695171..2695619,2695684..2697334) 1 NC_003424.3 cell division control protein Cdc5 2697334 cdc5 2543583 cdc5 Schizosaccharomyces pombe 972h- cell division control protein Cdc5 NP_593880.1 2694758 D 284812 CDS SPAC644.13c 19114793 2543575 complement(2697418..2698095) 1 NC_003424.3 Rab GTPase binding (predicted) 2698095 2543575 SPAC644.13c Schizosaccharomyces pombe 972h- Rab GTPase binding (predicted) NP_593881.1 2697418 R 284812 CDS SPAC644.14c 19114794 2543580 complement(2699007..2700104) 1 NC_003424.3 recombinase Rhp51 2700104 rhp51 2543580 rhp51 Schizosaccharomyces pombe 972h- recombinase Rhp51 NP_593882.1 2699007 R 284812 CDS SPAC644.15 19114795 2543217 join(2700453..2700521,2700658..2700918) 1 NC_003424.3 60S acidic ribosomal protein Rpp1-1 2700918 rpp101 2543217 rpp101 Schizosaccharomyces pombe 972h- 60S acidic ribosomal protein Rpp1-1 NP_593883.1 2700453 D 284812 CDS SPAC644.16 19114796 2543462 join(2701629..2701653,2701694..2702937) 1 NC_003424.3 RNA-binding protein 2702937 2543462 SPAC644.16 Schizosaccharomyces pombe 972h- RNA-binding protein NP_593884.1 2701629 D 284812 CDS SPAC644.17c 19114797 2543386 complement(2702997..2703776) 1 NC_003424.3 mitochondrial ribosomal protein subunit L9 (predicted) 2703776 mrpl9 2543386 mrpl9 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit L9 (predicted) NP_593885.1 2702997 R 284812 CDS SPAC644.18c 19114798 2543570 complement(join(2704905..2705024,2705076..2705361,2705409..2705503,2705553..2705603)) 1 NC_003424.3 TRAPP complex subunit Bet3 (predicted) 2705603 bet3 2543570 bet3 Schizosaccharomyces pombe 972h- TRAPP complex subunit Bet3 (predicted) NP_593886.1 2704905 R 284812 CDS SPAPB2B4.01c 19114799 2543490 complement(join(2706276..2706552,2706604..2706671,2706728..2706918,2706983..2707193)) 1 NC_003424.3 pig-L, N-acetylglucosaminylphosphatidyl inositoldeacetylase (predicted) 2707193 gpi12 2543490 gpi12 Schizosaccharomyces pombe 972h- pig-L, N-acetylglucosaminylphosphatidyl inositoldeacetylase (predicted) NP_593887.1 2706276 R 284812 CDS SPAPB2B4.02 19114800 2543483 join(2708097..2708446,2708779..2708869) 1 NC_003424.3 monothiol glutaredoxin Grx5 2708869 grx5 2543483 grx5 Schizosaccharomyces pombe 972h- monothiol glutaredoxin Grx5 NP_593888.1 2708097 D 284812 CDS SPAPB2B4.03 19114801 2543481 2711080..2712315 1 NC_003424.3 G1/S-specific B-type cyclin Cig2 2712315 cig2 2543481 cig2 Schizosaccharomyces pombe 972h- G1/S-specific B-type cyclin Cig2 NP_593889.1 2711080 D 284812 CDS SPAPB2B4.04c 19114802 2543477 complement(2713053..2716931) 1 NC_003424.3 vacuolar calcium transporting P-type ATPase, Pmc1 2716931 2543477 SPAPB2B4.04c Schizosaccharomyces pombe 972h- vacuolar calcium transporting P-type ATPase, Pmc1 NP_593890.1 2713053 R 284812 CDS SPAPB2B4.05 19114803 2543469 join(2720954..2721100,2721202..2721355,2721405..2721499,2721552..2721643,2721748..2722008,2722060..2722291,2722375..2722578) 1 NC_003424.3 V-type ATPase subunit C (predicted) 2722578 vma5 2543469 vma5 Schizosaccharomyces pombe 972h- V-type ATPase subunit C (predicted) NP_593891.1 2720954 D 284812 CDS SPAPB2B4.06 295442993 2543466 join(2722735..2723210,2723273..2723300,2723349..2723559,2723608..2723660) 1 NC_003424.3 conserved fungal protein 2723660 2543466 SPAPB2B4.06 Schizosaccharomyces pombe 972h- conserved fungal protein NP_593892.2 2722735 D 284812 CDS SPAPB2B4.07 19114805 2543223 2724376..2725095 1 NC_003424.3 possibly conserved in human, D. melanogaster and A. thaliana by mulitiple alignment; ubiquitin family protein, human UBTD1 homolog 2725095 2543223 SPAPB2B4.07 Schizosaccharomyces pombe 972h- ubiquitin family protein, human UBTD1 homolog NP_593893.1 2724376 D 284812 CDS SPAC6F6.01 19114806 2542812 2726719..2732283 1 NC_003424.3 calcium channel Cch1 2732283 cch1 2542812 cch1 Schizosaccharomyces pombe 972h- calcium channel Cch1 NP_593894.1 2726719 D 284812 CDS SPAC6F6.02c 19114807 2542810 complement(2732524..2733570) 1 NC_003424.3 F-box protein Pof5 2733570 pof5 2542810 pof5 Schizosaccharomyces pombe 972h- F-box protein Pof5 NP_593895.1 2732524 R 284812 CDS SPAC6F6.03c 19114808 2542777 complement(join(2734109..2734927,2735332..2736126)) 1 NC_003424.3 ribosome export GTPase (predicted) 2736126 2542777 SPAC6F6.03c Schizosaccharomyces pombe 972h- ribosome export GTPase (predicted) NP_593896.1 2734109 R 284812 CDS SPAC6F6.04c 19114809 2542743 complement(2736676..2738145) 1 NC_003424.3 membrane transporter (predicted) 2738145 2542743 SPAC6F6.04c Schizosaccharomyces pombe 972h- membrane transporter (predicted) NP_593897.1 2736676 R 284812 CDS SPAC6F6.05 19114810 2542110 join(2740539..2740840,2740894..2740960) 1 NC_003424.3 oligosaccharyltransferase epsilon subunit (predicted) 2740960 2542110 SPAC6F6.05 Schizosaccharomyces pombe 972h- oligosaccharyltransferase epsilon subunit (predicted) NP_593898.1 2740539 D 284812 CDS SPAC6F6.06c 19114811 2542793 complement(2741551..2745018) 1 NC_003424.3 cell polarity factor Rax2 2745018 rax2 2542793 rax2 Schizosaccharomyces pombe 972h- cell polarity factor Rax2 NP_593899.1 2741551 R 284812 CDS SPAC6F6.07c 19114812 2542108 complement(join(2745955..2746128,2746193..2746239,2746303..2746335,2746439..2746640)) 1 NC_003424.3 40S ribosomal protein S13 (predicted) 2746640 rps13 2542108 rps13 Schizosaccharomyces pombe 972h- 40S ribosomal protein S13 (predicted) NP_593900.1 2745955 R 284812 CDS SPAC6F6.08c 19114813 2542162 complement(join(2746772..2746931,2747119..2747266,2747341..2747431,2747509..2748009)) 1 NC_003424.3 two-component GAP Cdc16 2748009 cdc16 2542162 cdc16 Schizosaccharomyces pombe 972h- two-component GAP Cdc16 NP_593901.1 2746772 R 284812 CDS SPAC6F6.09 19114814 2542157 join(2749068..2749100,2749164..2749547) 1 NC_003424.3 NuA4 histone acetyltransferase complex subunit (predicted) 2749547 2542157 SPAC6F6.09 Schizosaccharomyces pombe 972h- NuA4 histone acetyltransferase complex subunit (predicted) NP_593902.1 2749068 D 284812 CDS SPAC6F6.10c 19114815 2542287 complement(join(2749978..2750869,2750910..2750971)) 1 NC_003424.3 ARP2/3 actin-organizing complex subunit Arc34 2750971 arc2 2542287 arc2 Schizosaccharomyces pombe 972h- ARP2/3 actin-organizing complex subunit Arc34 NP_593903.1 2749978 R 284812 CDS SPAC6F6.11c 19114816 2542390 complement(join(2751672..2752152,2752212..2752329,2752387..2752575,2752623..2752731,2752774..2752806)) 1 NC_003424.3 pyridoxine-pyridoxal-pyridoxamine kinase (predicted) 2752806 2542390 SPAC6F6.11c Schizosaccharomyces pombe 972h- pyridoxine-pyridoxal-pyridoxamine kinase (predicted) NP_593904.1 2751672 R 284812 CDS SPAC6F6.12 19114817 2542427 join(2754768..2754899,2754968..2755103,2755192..2756129) 1 NC_003424.3 autophagy associated protein Atg24 (predicted) 2756129 2542427 SPAC6F6.12 Schizosaccharomyces pombe 972h- autophagy associated protein Atg24 (predicted) NP_593905.1 2754768 D 284812 CDS SPAC6F6.13c 19114818 2542120 complement(2756498..2758834) 1 NC_003424.3 DUF726 family protein 2758834 2542120 SPAC6F6.13c Schizosaccharomyces pombe 972h- DUF726 family protein NP_593906.1 2756498 R 284812 CDS SPAC6F6.19 295442995 9407200 complement(join(2759155..2759292,2759479..2759709)) 1 NC_003424.3 RNA-binding protein, G-patch type 2759709 9407200 SPAC6F6.19 Schizosaccharomyces pombe 972h- RNA-binding protein, G-patch type XP_002742509.1 2759155 R 284812 CDS SPAC6F6.15 19114819 2542248 join(2762302..2762382,2762454..2762493,2762562..2762585,2762662..2762722,2762787..2762833,2762875..2762921,2763001..2763126,2763181..2763390) 1 NC_003424.3 GTPase Ypt5 2763390 ypt5 2542248 ypt5 Schizosaccharomyces pombe 972h- GTPase Ypt5 NP_593907.1 2762302 D 284812 CDS SPAC6F6.16c 295442997 2542414 complement(join(2763686..2764572,2764611..2764752,2764791..2764825,2764872..2765122,2765166..2765263,2765320..2765433)) 1 NC_003424.3 SPAC6F6.16c and SPAC6F6.18c were merged 09-06-08; Tppl homolog Tpz1 2765433 tpz1 2542414 tpz1 Schizosaccharomyces pombe 972h- Tppl homolog Tpz1 NP_593908.2 2763686 R 284812 CDS SPAC6F6.17 63054575 2542144 2766370..2770572 1 NC_003424.3 telomere length regulator protein Rif1 2770572 rif1 2542144 rif1 Schizosaccharomyces pombe 972h- telomere length regulator protein Rif1 NP_593910.2 2766370 D 284812 CDS SPAC1805.01c 162312452 2542386 complement(join(2770704..2770895,2770936..2773012,2773108..2773156,2773204..2773213)) 1 NC_003424.3 possible internal in-frame splice at bases 1119..2154, doesnt improve homology; serine/threonine protein kinase Ppk6 2773213 ppk6 2542386 ppk6 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Ppk6 XP_001713069.1 2770704 R 284812 CDS SPAC1805.02c 19114825 2542385 complement(join(2774092..2774745,2774818..2774928)) 1 NC_003424.3 electron transfer flavoprotein beta subunit (predicted) 2774928 2542385 SPAC1805.02c Schizosaccharomyces pombe 972h- electron transfer flavoprotein beta subunit (predicted) NP_593913.1 2774092 R 284812 CDS SPAC1805.03c 19114826 2542398 complement(join(2775340..2776083,2776135..2776171,2776251..2776598,2776787..2776881)) 1 NC_003424.3 first intron may be incorrect; tRNA 2'-O-methyltransferase Trm13 (predicted) 2776881 trm13 2542398 trm13 Schizosaccharomyces pombe 972h- tRNA 2'-O-methyltransferase Trm13 (predicted) NP_593914.1 2775340 R 284812 CDS SPAC1805.04 19114827 2542378 join(2777371..2777554,2777619..2780923) 1 NC_003424.3 nucleoporin Nup132 2780923 nup132 2542378 nup132 Schizosaccharomyces pombe 972h- nucleoporin Nup132 NP_593915.1 2777371 D 284812 CDS SPAC1805.05 19114828 2542395 join(2781416..2781550,2781617..2781686,2781747..2781895,2781969..2782934) 1 NC_003424.3 serine/threonine protein kinase Cki3 2782934 cki3 2542395 cki3 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Cki3 NP_593916.1 2781416 D 284812 CDS SPAC1805.06c 19114829 2542373 complement(2783941..2784930) 1 NC_003424.3 porphobilinogen synthase Hem2 (predicted) 2784930 hem2 2542373 hem2 Schizosaccharomyces pombe 972h- porphobilinogen synthase Hem2 (predicted) NP_593917.1 2783941 R 284812 CDS SPAC1805.07c 19114830 2542418 complement(join(2785536..2785684,2786013..2786148)) 1 NC_003424.3 high osmolarity sensitivity for growth protein Hos2; DASH complex subunit Dad2 2786148 dad2 2542418 dad2 Schizosaccharomyces pombe 972h- DASH complex subunit Dad2 NP_593918.1 2785536 R 284812 CDS SPAC1805.08 67999971 3361491 join(2788070..2788078,2788128..2788238,2788299..2788514) 1 NC_003424.3 dynein light chain Dlc1 2788514 dlc1 3361491 dlc1 Schizosaccharomyces pombe 972h- dynein light chain Dlc1 NP_001018252.1 2788070 D 284812 CDS SPAC1805.09c 19114832 2542294 complement(2790199..2791221) 1 NC_003424.3 methionyl-tRNA formyltransferase Fmt1 (predicted) 2791221 fmt1 2542294 fmt1 Schizosaccharomyces pombe 972h- methionyl-tRNA formyltransferase Fmt1 (predicted) NP_593920.1 2790199 R 284812 CDS SPAC1805.10 19114833 2542399 2791243..2792826 1 NC_003424.3 sequence orphan 2792826 2542399 SPAC1805.10 Schizosaccharomyces pombe 972h- sequence orphan NP_593921.1 2791243 D 284812 CDS SPAC1805.11c 19114834 2542538 complement(join(2793017..2793252,2793353..2793476)) 1 NC_003424.3 40S ribosomal protein S26 (predicted) 2793476 rps2602 2542538 rps2602 Schizosaccharomyces pombe 972h- 40S ribosomal protein S26 (predicted) NP_593922.1 2793017 R 284812 CDS SPAC1805.12c 19114835 2542428 complement(2794338..2794724) 1 NC_003424.3 ribosomal-ubiquitin fusion protein Ubi2 2794724 uep1 2542428 uep1 Schizosaccharomyces pombe 972h- ribosomal-ubiquitin fusion protein Ubi2 NP_593923.1 2794338 R 284812 CDS SPAC1805.13 19114836 2542425 join(2794938..2795045,2795290..2795586) 1 NC_003424.3 60S ribosomal protein L14 (predicted) 2795586 rpl14 2542425 rpl14 Schizosaccharomyces pombe 972h- 60S ribosomal protein L14 (predicted) NP_593924.1 2794938 D 284812 CDS SPAC1805.14 19114837 2542424 2796469..2797827 1 NC_003424.3 sequence orphan 2797827 2542424 SPAC1805.14 Schizosaccharomyces pombe 972h- sequence orphan NP_593925.1 2796469 D 284812 CDS SPAC1805.15c 19114838 2542432 complement(join(2798023..2798122,2798164..2799766,2799862..2799995,2800053..2800231)) 1 NC_003424.3 HECT-type ubiquitin-protein ligase Pub2 2800231 pub2 2542432 pub2 Schizosaccharomyces pombe 972h- HECT-type ubiquitin-protein ligase Pub2 NP_593926.1 2798023 R 284812 CDS SPAC1805.16c 19114839 2542435 complement(2800953..2801900) 1 NC_003424.3 purine nucleoside phosphorylase (predicted) 2801900 2542435 SPAC1805.16c Schizosaccharomyces pombe 972h- purine nucleoside phosphorylase (predicted) NP_593927.1 2800953 R 284812 CDS SPAC1805.17 162312454 3361487 2804508..2807744 1 NC_003424.3 nuclear export receptor Crm1 2807744 crm1 3361487 crm1 Schizosaccharomyces pombe 972h- nuclear export receptor Crm1 XP_001713070.1 2804508 D 284812 CDS SPAC1B2.02c 19114841 2542501 complement(2808542..2809807) 1 NC_003424.3 mitochondrial fusion and transport protein Ugo1 (predicted) 2809807 ugo1 2542501 ugo1 Schizosaccharomyces pombe 972h- mitochondrial fusion and transport protein Ugo1 (predicted) NP_593929.1 2808542 R 284812 CDS SPAC1B2.03c 19114842 2542505 complement(join(2811438..2812368,2812412..2812485)) 1 NC_003424.3 GNS1/SUR4 family protein 2812485 2542505 SPAC1B2.03c Schizosaccharomyces pombe 972h- GNS1/SUR4 family protein NP_593930.1 2811438 R 284812 CDS SPAC1B2.04 19114843 2542493 join(2814368..2814516,2814928..2815201) 1 NC_003424.3 cytochrome c oxidase subunit VI (predicted) 2815201 cox6 2542493 cox6 Schizosaccharomyces pombe 972h- cytochrome c oxidase subunit VI (predicted) NP_593931.1 2814368 D 284812 CDS SPAC1B2.05 162312456 2542477 join(2815942..2817623,2817665..2818037,2818078..2818185) 1 NC_003424.3 MCM complex subunit Mcm5 2818185 mcm5 2542477 mcm5 Schizosaccharomyces pombe 972h- MCM complex subunit Mcm5 XP_001713071.1 2815942 D 284812 CDS SPAC3F10.02c 19114846 2543048 complement(2818256..2820781) 1 NC_003424.3 potassium ion transporter Trk1 2820781 trk1 2543048 trk1 Schizosaccharomyces pombe 972h- potassium ion transporter Trk1 NP_593934.1 2818256 R 284812 CDS SPAC3F10.03 19114847 2543181 2821486..2823444 1 NC_003424.3 mitochondrial and cytoplasmic glycine-tRNA ligase Grs1 (predicted) 2823444 grs1 2543181 grs1 Schizosaccharomyces pombe 972h- mitochondrial and cytoplasmic glycine-tRNA ligase Grs1 (predicted) NP_593935.1 2821486 D 284812 CDS SPAC3F10.04 19114848 2542896 2823967..2825463 1 NC_003424.3 protein is cleaved to produce different subunits (PMID 12734194); glutathione synthetase large subunit Gsa1 2825463 gsa1 2542896 gsa1 Schizosaccharomyces pombe 972h- glutathione synthetase large subunit Gsa1 NP_593936.1 2823967 D 284812 CDS SPAC3F10.05c 19114849 2543144 complement(2825838..2826818) 1 NC_003424.3 DUF1766 family protein 2826818 mug113 2543144 mug113 Schizosaccharomyces pombe 972h- DUF1766 family protein NP_593937.1 2825838 R 284812 CDS SPAC3F10.06c 19114850 2543128 complement(join(2827047..2828349,2828629..2828687)) 1 NC_003424.3 initiator methionine tRNA 2'-O-ribosyl phosphate transferase (predicted) 2828687 2543128 SPAC3F10.06c Schizosaccharomyces pombe 972h- initiator methionine tRNA 2'-O-ribosyl phosphate transferase (predicted) NP_593938.1 2827047 R 284812 CDS SPAC3F10.07c 19114851 2543113 complement(2828666..2829184) 1 NC_003424.3 previously annotated as dubious; palmitoyltransferase complex Erf4 (predicted) 2829184 mug91 2543113 mug91 Schizosaccharomyces pombe 972h- palmitoyltransferase complex Erf4 (predicted) NP_593939.1 2828666 R 284812 CDS SPAC3F10.08c 19114852 2543196 complement(2831810..2832589) 1 NC_003424.3 rRNA processing protein Faf1 (predicted) 2832589 2543196 SPAC3F10.08c Schizosaccharomyces pombe 972h- rRNA processing protein Faf1 (predicted) NP_593940.1 2831810 R 284812 CDS SPAC3F10.09 19114853 2543103 join(2832796..2833036,2833099..2833169,2833426..2833529,2833596..2833974) 1 NC_003424.3 possibly his6 from map position; 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino) methylideneamino]imidazole-4-carboxamide isomerase (predicted) 2833974 2543103 SPAC3F10.09 Schizosaccharomyces pombe 972h- 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino) methylideneamino]imidazole-4-carboxamide isomerase (predicted) NP_593941.1 2832796 D 284812 CDS SPAC3F10.10c 19114854 2542271 complement(2833891..2834988) 1 NC_003424.3 overlaps C-term of SPAC3F10.09, possibility of splicing at codon 316; pheromone M-factor receptor Map3 2834988 map3 2542271 map3 Schizosaccharomyces pombe 972h- pheromone M-factor receptor Map3 NP_593942.1 2833891 R 284812 CDS SPAC3F10.11c 162312458 2543193 complement(2837268..2841659) 1 NC_003424.3 glutathione S-conjugate-exporting ATPase Abc2 2841659 abc2 2543193 abc2 Schizosaccharomyces pombe 972h- glutathione S-conjugate-exporting ATPase Abc2 NP_593943.2 2837268 R 284812 CDS SPAC3F10.12c 19114856 2543157 complement(2842317..2842922) 1 NC_003424.3 transcription factor (predicted) 2842922 2543157 SPAC3F10.12c Schizosaccharomyces pombe 972h- transcription factor (predicted) NP_593944.1 2842317 R 284812 CDS SPAC3F10.13 19114857 2543043 2846535..2848373 1 NC_003424.3 UBA domain protein Ucp6 2848373 ucp6 2543043 ucp6 Schizosaccharomyces pombe 972h- UBA domain protein Ucp6 NP_593945.1 2846535 D 284812 CDS SPAC3F10.15c 19114859 2543201 complement(2848929..2849201) 1 NC_003424.3 Spo12 family protein 2849201 spo12 2543201 spo12 Schizosaccharomyces pombe 972h- Spo12 family protein NP_593947.1 2848929 R 284812 CDS SPAC3F10.16c 19114860 2541449 complement(join(2849710..2851557,2851667..2851669)) 1 NC_003424.3 GTP binding protein, HSR1-related (predicted) 2851669 2541449 SPAC3F10.16c Schizosaccharomyces pombe 972h- GTP binding protein, HSR1-related (predicted) NP_593948.1 2849710 R 284812 CDS SPAC3F10.17 19114861 2541634 join(2852036..2852038,2852175..2853332) 1 NC_003424.3 ribosome biogenesis protein Ltv1 (predicted) 2853332 2541634 SPAC3F10.17 Schizosaccharomyces pombe 972h- ribosome biogenesis protein Ltv1 (predicted) NP_593949.1 2852036 D 284812 CDS SPAC3F10.18c 19114862 2543180 complement(join(2853790..2853796,2853849..2853919)) 1 NC_003424.3 60S ribosomal protein L41 (predicted) 2853919 rpl4102 2543180 rpl4102 Schizosaccharomyces pombe 972h- 60S ribosomal protein L41 (predicted) NP_593950.1 2853790 R 284812 CDS SPAC8F11.02c 19114863 2543434 complement(join(2855322..2855456,2855516..2855577,2855620..2855662)) 1 NC_003424.3 diphthamide biosynthesis protein Dph3 (predicted) 2855662 2543434 SPAC8F11.02c Schizosaccharomyces pombe 972h- diphthamide biosynthesis protein Dph3 (predicted) NP_593951.1 2855322 R 284812 CDS SPAC8F11.03 19114864 2543392 join(2855931..2857427,2857463..2858980) 1 NC_003424.3 changed splice boundary from the experimentally determined one. possible alternative splice used with low frequency, the acceptor used in this prediction has better consensus, and increases the homology when this translation is aligned with homologs; MutS protein homolog 3 2858980 msh3 2543392 msh3 Schizosaccharomyces pombe 972h- MutS protein homolog 3 NP_593952.1 2855931 D 284812 CDS SPAC8F11.04 19114865 2543438 join(2859456..2859491,2859619..2860704) 1 NC_003424.3 U3 snoRNP-associated protein Cic1/Utp30 family (predicted) 2860704 2543438 SPAC8F11.04 Schizosaccharomyces pombe 972h- U3 snoRNP-associated protein Cic1/Utp30 family (predicted) NP_593953.1 2859456 D 284812 CDS SPAC8F11.05c 19114866 2543594 complement(join(2860952..2861354,2861418..2861740)) 1 NC_003424.3 sequence orphan 2861740 mug130 2543594 mug130 Schizosaccharomyces pombe 972h- sequence orphan NP_593954.1 2860952 R 284812 CDS SPAC8F11.06 19114867 2543596 2862674..2863567 1 NC_003424.3 nuclear envelope protein Brr6/Brl1 2863567 brr6 2543596 brr6 Schizosaccharomyces pombe 972h- nuclear envelope protein Brr6/Brl1 NP_593955.1 2862674 D 284812 CDS SPAC8F11.07c 19114868 2543407 complement(join(2863965..2864266,2864308..2864442,2864488..2865151,2865210..2865409,2865474..2865501,2865556..2865640,2865696..2865787)) 1 NC_003424.3 DNA replication protein Cdc24 2865787 cdc24 2543407 cdc24 Schizosaccharomyces pombe 972h- DNA replication protein Cdc24 NP_593956.1 2863965 R 284812 CDS SPAC8F11.08c 19114869 2543418 complement(join(2866179..2866235,2866289..2867362)) 1 NC_003424.3 esterase/lipase (predicted) 2867362 2543418 SPAC8F11.08c Schizosaccharomyces pombe 972h- esterase/lipase (predicted) NP_593957.1 2866179 R 284812 CDS SPAC8F11.09c 19114870 2543599 complement(join(2868517..2869171,2869265..2869377)) 1 NC_003424.3 nicotinamide N-methyltransferase Nnt1 (predicted) 2869377 nnt1 2543599 nnt1 Schizosaccharomyces pombe 972h- nicotinamide N-methyltransferase Nnt1 (predicted) NP_593958.1 2868517 R 284812 CDS SPAC8F11.10c 19114871 2543508 complement(2870120..2871325) 1 NC_003424.3 pyruvyltransferase Pvg1 2871325 pvg1 2543508 pvg1 Schizosaccharomyces pombe 972h- pyruvyltransferase Pvg1 NP_593959.1 2870120 R 284812 CDS SPACUNK4.17 19114872 2542371 complement(2873032..2874249) 1 NC_003424.3 NAD binding dehydrogenase family protein 2874249 2542371 SPACUNK4.17 Schizosaccharomyces pombe 972h- NAD binding dehydrogenase family protein NP_593960.1 2873032 R 284812 CDS SPACUNK4.19 19114873 2542261 2875888..2876217 1 NC_003424.3 sequence orphan 2876217 mug153 2542261 mug153 Schizosaccharomyces pombe 972h- sequence orphan NP_593961.1 2875888 D 284812 CDS SPACUNK4.16c 19114874 2542498 2877519..2880353 1 NC_003424.3 alpha,alpha-trehalose-phosphate synthase (predicted) 2880353 2542498 SPACUNK4.16c Schizosaccharomyces pombe 972h- alpha,alpha-trehalose-phosphate synthase (predicted) NP_593962.1 2877519 D 284812 CDS SPACUNK4.15 19114875 2542612 complement(2881105..2881731) 1 NC_003424.3 2',3'-cyclic-nucleotide 3'-phosphodiesterase (predicted) 2881731 2542612 SPACUNK4.15 Schizosaccharomyces pombe 972h- 2',3'-cyclic-nucleotide 3'-phosphodiesterase (predicted) NP_593963.1 2881105 R 284812 CDS SPACUNK4.14 19114876 2542517 complement(join(2883184..2883489,2883542..2884783,2884840..2884854)) 1 NC_003424.3 BRCT domain protein 2884854 mdb1 2542517 mdb1 Schizosaccharomyces pombe 972h- BRCT domain protein NP_593964.1 2883184 R 284812 CDS SPACUNK4.13c 19114877 2542506 join(2885342..2885526,2885592..2885632,2885724..2886721) 1 NC_003424.3 GTPase Ylf2 (predicted) 2886721 2542506 SPACUNK4.13c Schizosaccharomyces pombe 972h- GTPase Ylf2 (predicted) NP_593965.1 2885342 D 284812 CDS SPACUNK4.12c 19114878 2542436 2887039..2889948 1 NC_003424.3 metallopeptidase 2889948 mug138 2542436 mug138 Schizosaccharomyces pombe 972h- metallopeptidase NP_593966.1 2887039 D 284812 CDS SPACUNK4.11c 19114879 2542214 join(2890158..2890184,2890240..2890779) 1 NC_003424.3 sequence orphan 2890779 2542214 SPACUNK4.11c Schizosaccharomyces pombe 972h- sequence orphan NP_593967.1 2890158 D 284812 CDS SPACUNK4.10 19114880 2542594 complement(join(2891216..2891258,2891310..2892175,2892432..2892527)) 1 NC_003424.3 hydroxyacid dehydrogenase (predicted) 2892527 2542594 SPACUNK4.10 Schizosaccharomyces pombe 972h- hydroxyacid dehydrogenase (predicted) NP_593968.1 2891216 R 284812 CDS SPACUNK4.09 19114881 2542547 complement(2893972..2894991) 1 NC_003424.3 hypothetical protein 2894991 2542547 SPACUNK4.09 Schizosaccharomyces pombe 972h- hypothetical protein NP_593969.1 2893972 R 284812 CDS SPACUNK4.08 19114882 2542415 complement(2895219..2897600) 1 NC_003424.3 one of the S. cerevisiae paralogs in involved in alpha-factor maturation; dipeptidyl peptidase (predicted) 2897600 2542415 SPACUNK4.08 Schizosaccharomyces pombe 972h- dipeptidyl peptidase (predicted) NP_593970.1 2895219 R 284812 CDS SPACUNK4.07c 19114883 2542381 2898059..2901694 1 NC_003424.3 P-type ATPase, calcium transporting Cta4 2901694 cta4 2542381 cta4 Schizosaccharomyces pombe 972h- P-type ATPase, calcium transporting Cta4 NP_593971.1 2898059 D 284812 CDS SPACUNK4.06c 162312460 2542097 join(2902288..2902761,2902829..2902873) 1 NC_003424.3 DNA-directed RNA polymerase complex II subunit Rpb7 2902873 rpb7 2542097 rpb7 Schizosaccharomyces pombe 972h- DNA-directed RNA polymerase complex II subunit Rpb7 XP_001713072.1 2902288 D 284812 CDS SPAPYUK71.03c 19114886 2542267 complement(2903369..2907046) 1 NC_003424.3 C2 domain protein 2907046 2542267 SPAPYUK71.03c Schizosaccharomyces pombe 972h- C2 domain protein NP_593974.1 2903369 R 284812 CDS SPAC513.01c 162312462 3361483 complement(2907701..2910229) 1 NC_003424.3 translation elongation factor 2 (EF-2) Eft2,A 2910229 eft201 3361483 eft201 Schizosaccharomyces pombe 972h- translation elongation factor 2 (EF-2) Eft2,A XP_001713073.1 2907701 R 284812 CDS SPAC513.02 19114888 2543364 2911719..2912369 1 NC_003424.3 phosphoglycerate mutase family 2912369 2543364 SPAC513.02 Schizosaccharomyces pombe 972h- phosphoglycerate mutase family NP_593976.1 2911719 D 284812 CDS SPAC513.03 19114889 2543495 complement(join(2913008..2913020,2913063..2913184)) 1 NC_003424.3 M-factor precursor Mfm2 2913184 mfm2 2543495 mfm2 Schizosaccharomyces pombe 972h- M-factor precursor Mfm2 NP_593977.1 2913008 R 284812 CDS SPAC513.04 19114890 2543489 2913403..2913705 1 NC_003424.3 previously annotated as dubious, but has localization signal; sequence orphan 2913705 2543489 SPAC513.04 Schizosaccharomyces pombe 972h- sequence orphan NP_593978.1 2913403 D 284812 CDS SPAC513.05 19114891 2543485 2914901..2918134 1 NC_003424.3 alpha-mannosidase (predicted) 2918134 ams1 2543485 ams1 Schizosaccharomyces pombe 972h- alpha-mannosidase (predicted) NP_593979.1 2914901 D 284812 CDS SPAC513.06c 19114892 2543473 complement(2918362..2919468) 1 NC_003424.3 dihydrodiol dehydrogenase (predicted) 2919468 2543473 SPAC513.06c Schizosaccharomyces pombe 972h- dihydrodiol dehydrogenase (predicted) NP_593980.1 2918362 R 284812 CDS SPAC513.07 19114893 2543471 2921568..2922578 1 NC_003424.3 flavonol reductase/cinnamoyl-CoA reductase family 2922578 2543471 SPAC513.07 Schizosaccharomyces pombe 972h- flavonol reductase/cinnamoyl-CoA reductase family NP_593981.1 2921568 D 284812 CDS SPAC2E1P3.01 19114894 2541784 2923322..2924368 1 NC_003424.3 zinc binding dehydrogenase 2924368 2541784 SPAC2E1P3.01 Schizosaccharomyces pombe 972h- zinc binding dehydrogenase NP_593982.1 2923322 D 284812 CDS SPAC2E1P3.02c 19114895 2541795 complement(2924893..2926446) 1 NC_003424.3 putative splice 2531,2640 but inframe and no consensus branch; ammonium transporter Amt3 2926446 amt3 2541795 amt3 Schizosaccharomyces pombe 972h- ammonium transporter Amt3 NP_593983.1 2924893 R 284812 CDS SPAC2E1P3.03c 19114896 2541833 complement(2927204..2931205) 1 NC_003424.3 retrotransposable element 2931205 Tf2-3 2541833 Tf2-3 Schizosaccharomyces pombe 972h- retrotransposable element NP_593984.1 2927204 R 284812 CDS SPAC2E1P3.04 19114897 2541754 2932797..2934935 1 NC_003424.3 copper amine oxidase Cao1 2934935 cao1 2541754 cao1 Schizosaccharomyces pombe 972h- copper amine oxidase Cao1 NP_593985.1 2932797 D 284812 CDS SPAC2E1P3.05c 19114898 2542656 complement(2935510..2936103) 1 NC_003424.3 fungal cellulose binding domain protein 2936103 2542656 SPAC2E1P3.05c Schizosaccharomyces pombe 972h- fungal cellulose binding domain protein NP_593986.1 2935510 R 284812 CDS SPAPB2C8.01 19114899 2543356 2942389..2946051 1 NC_003424.3 3kb of 36 AA repeat; cell surface glycoprotein (predicted) 2946051 2543356 SPAPB2C8.01 Schizosaccharomyces pombe 972h- cell surface glycoprotein (predicted) NP_593987.1 2942389 D 284812 CDS SPAPB24D3.01 162312464 3361482 2947944..2949728 1 NC_003424.3 transcription factor (predicted) 2949728 3361482 SPAPB24D3.01 Schizosaccharomyces pombe 972h- transcription factor (predicted) XP_001713074.1 2947944 D 284812 CDS SPAPB24D3.02c 19114901 2543419 complement(2950090..2951721) 1 NC_003424.3 amino acid permease, unknown 3 2951721 2543419 SPAPB24D3.02c Schizosaccharomyces pombe 972h- amino acid permease, unknown 3 NP_593989.1 2950090 R 284812 CDS SPAPB24D3.03 19114902 2543569 2952485..2953642 1 NC_003424.3 agmatinase (predicted) 2953642 2543569 SPAPB24D3.03 Schizosaccharomyces pombe 972h- agmatinase (predicted) NP_593990.1 2952485 D 284812 CDS SPAPB24D3.04c 19114903 2543565 complement(2954138..2954824) 1 NC_003424.3 DNA-3-methyladenine glycosylase Mag1 2954824 mag1 2543565 mag1 Schizosaccharomyces pombe 972h- DNA-3-methyladenine glycosylase Mag1 NP_593991.1 2954138 R 284812 CDS SPAPB24D3.06c 19114904 2543543 complement(2956064..2957014) 1 NC_003424.3 DUF1749 family protein 2957014 2543543 SPAPB24D3.06c Schizosaccharomyces pombe 972h- DUF1749 family protein NP_593992.1 2956064 R 284812 CDS SPAPB24D3.07c 19114905 2543541 complement(2958024..2958926) 1 NC_003424.3 sequence orphan 2958926 2543541 SPAPB24D3.07c Schizosaccharomyces pombe 972h- sequence orphan NP_593993.1 2958024 R 284812 CDS SPAPB24D3.08c 19114906 2543522 complement(2961199..2962248) 1 NC_003424.3 NADP-dependent oxidoreductase (predicted) 2962248 2543522 SPAPB24D3.08c Schizosaccharomyces pombe 972h- NADP-dependent oxidoreductase (predicted) NP_593994.1 2961199 R 284812 CDS SPAPB24D3.09c 19114907 2543363 complement(2963162..2967352) 1 NC_003424.3 ABC transporter Pdr1 2967352 pdr1 2543363 pdr1 Schizosaccharomyces pombe 972h- ABC transporter Pdr1 NP_593995.1 2963162 R 284812 CDS SPAPB24D3.10c 19114908 2543499 complement(2968079..2970988) 1 NC_003424.3 alpha-glucosidase Agl1 2970988 agl1 2543499 agl1 Schizosaccharomyces pombe 972h- alpha-glucosidase Agl1 NP_593996.1 2968079 R 284812 CDS SPAPB1A11.01 162312466 3361480 2977811..2979298 1 NC_003424.3 membrane transporter 2979298 3361480 SPAPB1A11.01 Schizosaccharomyces pombe 972h- membrane transporter XP_001713075.1 2977811 D 284812 CDS SPAPB1A11.02 19114910 2543389 join(2980473..2980532,2980630..2981589) 1 NC_003424.3 esterase/lipase (predicted) 2981589 2543389 SPAPB1A11.02 Schizosaccharomyces pombe 972h- esterase/lipase (predicted) NP_593998.1 2980473 D 284812 CDS SPAPB1A11.03 19114911 2543401 2984786..2986009 1 NC_003424.3 cytochrome b2 (L-lactate cytochrome-c oxidoreductase) (predicted) 2986009 2543401 SPAPB1A11.03 Schizosaccharomyces pombe 972h- cytochrome b2 (L-lactate cytochrome-c oxidoreductase) (predicted) NP_593999.1 2984786 D 284812 CDS SPAPB1A11.04c 19114912 2543602 complement(2986336..2988429) 1 NC_003424.3 transcription factor (predicted) 2988429 2543602 SPAPB1A11.04c Schizosaccharomyces pombe 972h- transcription factor (predicted) NP_594000.1 2986336 R 284812 CDS SPAC31G5.01 63054583 2542426 join(2989396..2989507,2989565..2990460) 1 NC_003424.3 RNA-binding protein Sap49 2990460 sap49 2542426 sap49 Schizosaccharomyces pombe 972h- RNA-binding protein Sap49 NP_594001.2 2989396 D 284812 CDS SPAC31G5.02 19114914 2541623 join(2990973..2991107,2991157..2991271,2991498..2991946) 1 NC_003424.3 ER chaperone Rot1 (predicted) 2991946 2541623 SPAC31G5.02 Schizosaccharomyces pombe 972h- ER chaperone Rot1 (predicted) NP_594002.1 2990973 D 284812 CDS SPAC31G5.03 19114915 2543120 2992657..2993115 1 NC_003424.3 40S ribosomal protein S11 2993115 rps1101 2543120 rps1101 Schizosaccharomyces pombe 972h- 40S ribosomal protein S11 NP_594003.1 2992657 D 284812 CDS SPAC31G5.04 19114916 2542609 2993498..2994586 1 NC_003424.3 homoisocitrate dehydrogenase 2994586 2542609 SPAC31G5.04 Schizosaccharomyces pombe 972h- homoisocitrate dehydrogenase NP_594004.1 2993498 D 284812 CDS SPAC31G5.05c 19114917 2543174 complement(join(2995039..2995688,2995734..2995770)) 1 NC_003424.3 ribulose phosphate 3-epimerase (predicted) 2995770 2543174 SPAC31G5.05c Schizosaccharomyces pombe 972h- ribulose phosphate 3-epimerase (predicted) NP_594005.1 2995039 R 284812 CDS SPAC31G5.06 162312468 2543185 join(2996304..2996403,2996454..2997058) 1 NC_003424.3 orthology prediction pers. comm. Charly Chahwan; mitochondrial protein 2997058 2543185 SPAC31G5.06 Schizosaccharomyces pombe 972h- mitochondrial protein NP_594006.2 2996304 D 284812 CDS SPAC31G5.07 63054584 2543166 2997453..2998157 1 NC_003424.3 conjugation protein (predicted) 2998157 2543166 SPAC31G5.07 Schizosaccharomyces pombe 972h- conjugation protein (predicted) NP_594007.2 2997453 D 284812 CDS SPAC31G5.08 19114920 2543161 2999088..2999843 1 NC_003424.3 uroporphyrinogen-III synthase Ups1 2999843 ups1 2543161 ups1 Schizosaccharomyces pombe 972h- uroporphyrinogen-III synthase Ups1 NP_594008.1 2999088 D 284812 CDS SPAC31G5.09c 19114921 2542474 complement(2999850..3000968) 1 NC_003424.3 MAP kinase Spk1 3000968 spk1 2542474 spk1 Schizosaccharomyces pombe 972h- MAP kinase Spk1 NP_594009.1 2999850 R 284812 CDS SPAC31G5.10 19114922 2542575 3002057..3003766 1 NC_003424.3 Myb family protein Eta2 3003766 eta2 2542575 eta2 Schizosaccharomyces pombe 972h- Myb family protein Eta2 NP_594010.1 3002057 D 284812 CDS SPAC31G5.11 19114923 2542103 3006138..3006845 1 NC_003424.3 cAMP-independent regulatory protein Pac2 3006845 pac2 2542103 pac2 Schizosaccharomyces pombe 972h- cAMP-independent regulatory protein Pac2 NP_594011.1 3006138 D 284812 CDS SPAC31G5.12c 295443000 2542394 complement(join(3008184..3008795,3009160..3009258,3009312..3009317)) 1 NC_003424.3 repressor of RNA polymerase III Maf1 3009317 maf1 2542394 maf1 Schizosaccharomyces pombe 972h- repressor of RNA polymerase III Maf1 NP_594012.2 3008184 R 284812 CDS SPAC31G5.21 19114925 2543102 3010087..3010443 1 NC_003424.3 human family 32A homolog 3010443 2543102 SPAC31G5.21 Schizosaccharomyces pombe 972h- human family 32A homolog NP_594013.1 3010087 D 284812 CDS SPAC31G5.13 19114926 2543040 3010979..3011905 1 NC_003424.3 19S proteasome regulatory subunit Rpn11 3011905 rpn11 2543040 rpn11 Schizosaccharomyces pombe 972h- 19S proteasome regulatory subunit Rpn11 NP_594014.1 3010979 D 284812 CDS SPAC31G5.14 19114927 2543195 3012593..3013756 1 NC_003424.3 glycine decarboxylase T subunit 3013756 gcv1 2543195 gcv1 Schizosaccharomyces pombe 972h- glycine decarboxylase T subunit NP_594015.1 3012593 D 284812 CDS SPAC31G5.15 19114928 2543178 join(3014466..3014663,3014720..3014947,3015007..3015472,3015515..3016560,3016601..3016775,3016826..3016967,3017011..3017698) 1 NC_003424.3 phosphatidylserine decarboxylase (predicted) 3017698 2543178 SPAC31G5.15 Schizosaccharomyces pombe 972h- phosphatidylserine decarboxylase (predicted) NP_594016.1 3014466 D 284812 CDS SPAC31G5.16c 19114929 2543121 complement(join(3017927..3018073,3018199..3018762)) 1 NC_003424.3 dolichol-phosphate mannosyltransferase catalytic subunit Dpm1 3018762 dpm1 2543121 dpm1 Schizosaccharomyces pombe 972h- dolichol-phosphate mannosyltransferase catalytic subunit Dpm1 NP_594017.1 3017927 R 284812 CDS SPAC31G5.17c 19114930 2542561 complement(join(3019652..3020010,3020230..3020305)) 1 NC_003424.3 40S ribosomal protein S10 3020305 rps1001 2542561 rps1001 Schizosaccharomyces pombe 972h- 40S ribosomal protein S10 NP_594018.1 3019652 R 284812 CDS SPAC31G5.18c 19114931 2542222 complement(3020942..3021733) 1 NC_003424.3 ubiquitin family, human C1ORF55 related 3021733 2542222 SPAC31G5.18c Schizosaccharomyces pombe 972h- ubiquitin family, human C1ORF55 related NP_594019.1 3020942 R 284812 CDS SPAC31G5.19 19114932 2543084 3024418..3027990 1 NC_003424.3 ATPase with bromodomain protein 3027990 2543084 SPAC31G5.19 Schizosaccharomyces pombe 972h- ATPase with bromodomain protein NP_594020.1 3024418 D 284812 CDS SPAC1786.01c 162312470 2542286 complement(join(3028233..3028520,3028570..3029905,3029972..3030188,3030272..3030323)) 1 NC_003424.3 triacylglycerol lipase 3030323 2542286 SPAC1786.01c Schizosaccharomyces pombe 972h- triacylglycerol lipase XP_001713076.1 3028233 R 284812 CDS SPAC1786.04 19114935 2542451 complement(3033581..3033916) 1 NC_003424.3 previously annotated as dubious, but has localization signal; sequence orphan 3033916 2542451 SPAC1786.04 Schizosaccharomyces pombe 972h- sequence orphan NP_594023.1 3033581 R 284812 CDS SPAC1786.02 19114936 2542164 3034882..3036816 1 NC_003424.3 phospholipase (predicted) 3036816 2542164 SPAC1786.02 Schizosaccharomyces pombe 972h- phospholipase (predicted) NP_594024.1 3034882 D 284812 CDS SPAC1786.03 63054586 2542161 join(3037718..3037877,3037920..3039565) 1 NC_003424.3 integral membrane nucleoporin 3039565 cut11 2542161 cut11 Schizosaccharomyces pombe 972h- integral membrane nucleoporin NP_594025.2 3037718 D 284812 CDS SPAC24C9.02c 19114938 2541462 complement(join(3039710..3039995,3040088..3040452)) 1 NC_003424.3 cytochrome c1 heme lyase 3040452 2541462 SPAC24C9.02c Schizosaccharomyces pombe 972h- cytochrome c1 heme lyase NP_594026.1 3039710 R 284812 CDS SPAC24C9.03 19114939 2541430 3041282..3042463 1 NC_003424.3 diphosphomevalonate decarboxylase (predicted) 3042463 mvd1 2541430 mvd1 Schizosaccharomyces pombe 972h- diphosphomevalonate decarboxylase (predicted) NP_594027.1 3041282 D 284812 CDS SPAC24C9.16c 19114940 2542644 complement(join(3042800..3042817,3042872..3042909,3043096..3043157,3043225..3043307)) 1 NC_003424.3 cytochrome c oxidase subunit VIII 3043307 cox8 2542644 cox8 Schizosaccharomyces pombe 972h- cytochrome c oxidase subunit VIII NP_594028.1 3042800 R 284812 CDS SPAC24C9.04 19114941 2541676 3044351..3044716 1 NC_003424.3 sequence orphan 3044716 2541676 SPAC24C9.04 Schizosaccharomyces pombe 972h- sequence orphan NP_594029.1 3044351 D 284812 CDS SPAC24C9.05c 19114942 2541689 complement(3045121..3047313) 1 NC_003424.3 conserved protein (fungal and plant) 3047313 mug70 2541689 mug70 Schizosaccharomyces pombe 972h- conserved protein (fungal and plant) NP_594030.1 3045121 R 284812 CDS SPAC24C9.06c 19114943 2541450 complement(3048409..3050745) 1 NC_003424.3 aconitate hydratase 3050745 2541450 SPAC24C9.06c Schizosaccharomyces pombe 972h- aconitate hydratase NP_594031.1 3048409 R 284812 CDS SPAC24C9.07c 19114944 2541586 complement(3053598..3059282) 1 NC_003424.3 1,3-beta-glucan synthase subunit Bgs2 3059282 bgs2 2541586 bgs2 Schizosaccharomyces pombe 972h- 1,3-beta-glucan synthase subunit Bgs2 NP_594032.1 3053598 R 284812 CDS SPAC24C9.08 19114945 2541555 3061611..3063401 1 NC_003424.3 vacuolar carboxypeptidase (predicted) 3063401 2541555 SPAC24C9.08 Schizosaccharomyces pombe 972h- vacuolar carboxypeptidase (predicted) NP_594033.1 3061611 D 284812 CDS SPAC24C9.09 19114946 2541554 3063770..3065191 1 NC_003424.3 Has been mapped to YKL194C rather than YIL078W due to domain combination; mitochondrial threonine-tRNA ligase 3065191 2541554 SPAC24C9.09 Schizosaccharomyces pombe 972h- mitochondrial threonine-tRNA ligase NP_594034.1 3063770 D 284812 CDS SPAC24C9.10c 19114947 2541569 complement(3065418..3066209) 1 NC_003424.3 mitochondrial ribosomal protein subunit S2 3066209 mrp4 2541569 mrp4 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit S2 NP_594035.1 3065418 R 284812 CDS SPAC24C9.11 19114948 2541610 join(3066588..3066657,3066707..3068370,3068414..3068734,3068782..3069054) 1 NC_003424.3 eIF4 binding protein, human NOM1 ortholog 3069054 2541610 SPAC24C9.11 Schizosaccharomyces pombe 972h- eIF4 binding protein, human NOM1 ortholog NP_594036.1 3066588 D 284812 CDS SPAC24C9.12c 19114949 2542651 complement(3069614..3071017) 1 NC_003424.3 glycine hydroxymethyltransferase (predicted) 3071017 2542651 SPAC24C9.12c Schizosaccharomyces pombe 972h- glycine hydroxymethyltransferase (predicted) NP_594037.1 3069614 R 284812 CDS SPAC24C9.13c 19114950 2542645 complement(join(3071685..3071750,3071804..3072004)) 1 NC_003424.3 mitochondrial ribosomal protein subunit Mrp10 3072004 mrp10 2542645 mrp10 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit Mrp10 NP_594038.1 3071685 R 284812 CDS SPAC24C9.14 19114951 2542649 3073178..3074167 1 NC_003424.3 ubiquitin-specific protease (predicted) 3074167 otu1 2542649 otu1 Schizosaccharomyces pombe 972h- ubiquitin-specific protease (predicted) NP_594039.1 3073178 D 284812 CDS SPAC24C9.15c 19114952 2542641 complement(join(3074467..3074719,3074772..3075353,3075429..3075988)) 1 NC_003424.3 septin Spn5 3075988 spn5 2542641 spn5 Schizosaccharomyces pombe 972h- septin Spn5 NP_594040.1 3074467 R 284812 CDS SPAC16A10.01 19114953 2542317 3077676..3080168 1 NC_003424.3 DUF1212 family protein 3080168 2542317 SPAC16A10.01 Schizosaccharomyces pombe 972h- DUF1212 family protein NP_594041.1 3077676 D 284812 CDS SPAC16A10.02 19114954 2542309 join(3081012..3081104,3081155..3081472) 1 NC_003424.3 transcription coactivator PC4 3081472 sub1 2542309 sub1 Schizosaccharomyces pombe 972h- transcription coactivator PC4 NP_594042.1 3081012 D 284812 CDS SPAC16A10.03c 19114955 2542307 complement(join(3081568..3083850,3083902..3084081,3084125..3084244)) 1 NC_003424.3 zinc finger protein Pep5/Vps11-like (predicted) 3084244 2542307 SPAC16A10.03c Schizosaccharomyces pombe 972h- zinc finger protein Pep5/Vps11-like (predicted) NP_594043.1 3081568 R 284812 CDS SPAC16A10.04 68000097 3361476 join(3087038..3087071,3087127..3087168,3087230..3087276,3087384..3087587,3087704..3087838,3087895..3088044) 1 NC_003424.3 Rho family GTPase Rho4 3088044 rho4 3361476 rho4 Schizosaccharomyces pombe 972h- Rho family GTPase Rho4 NP_001018257.1 3087038 D 284812 CDS SPAC16A10.05c 19114957 2542311 complement(3089053..3089310) 1 NC_003424.3 DASH complex subunit Dad1 3089310 dad1 2542311 dad1 Schizosaccharomyces pombe 972h- DASH complex subunit Dad1 NP_594045.1 3089053 R 284812 CDS SPAC16A10.06c 295443002 2542312 complement(join(3089583..3090047,3090112..3090285,3090533..3090697)) 1 NC_003424.3 Smc5-6 complex non-SMC subunit 2 3090697 nse2 2542312 nse2 Schizosaccharomyces pombe 972h- Smc5-6 complex non-SMC subunit 2 XP_001713077.2 3089583 R 284812 CDS SPAC16A10.07c 19114959 2542313 complement(3091237..3093228) 1 NC_003424.3 provides a telomeric cap that prevents Ku from recognising telomeres as double strand breaks (Ku-dependent end-to-end fusions) (PMID 11172711); requires a ss telomeric overhang for T-loop formation (PMID 15383525); forms oligomeric donut structures (PMID 15383525); human TRF ortholog Taz1 3093228 taz1 2542313 taz1 Schizosaccharomyces pombe 972h- human TRF ortholog Taz1 NP_594047.1 3091237 R 284812 CDS SPAC16A10.08c 63054588 2542321 complement(join(3093973..3094173,3094229..3094885)) 1 NC_003424.3 sequence orphan 3094885 mug74 2542321 mug74 Schizosaccharomyces pombe 972h- sequence orphan NP_594048.2 3093973 R 284812 CDS SPAC589.02c 295443004 2542571 complement(join(3095075..3098590,3098626..3098781,3098878..3098883)) 1 NC_003424.3 mediator complex subunit Srb9 3098883 med13 2542571 med13 Schizosaccharomyces pombe 972h- mediator complex subunit Srb9 NP_594050.2 3095075 R 284812 CDS SPAC589.03c 19114963 2542416 complement(join(3099261..3099419,3099483..3099830)) 1 NC_003424.3 sequence orphan 3099830 2542416 SPAC589.03c Schizosaccharomyces pombe 972h- sequence orphan NP_594051.1 3099261 R 284812 CDS SPAC589.04 19114964 2542623 join(3100107..3100667,3100747..3101001) 1 NC_003424.3 metaxin 1 may be the ortholog of S. cerevisiae TOM37. multiply alignment has conserved common residues; TOM37 has a C term TMM region like many metaxin 1 family; both are mitochondrial membrane proteins involved in pre-protein import; S. cerevisiae ortholog for metaxin hasn't been identified and vice versa; can't make a Pfam family because it overlaps with glutathionine S-transferase; metaxin 1 3101001 2542623 SPAC589.04 Schizosaccharomyces pombe 972h- metaxin 1 NP_594052.1 3100107 D 284812 CDS SPAC589.05c 19114965 2542579 complement(join(3101297..3102149,3102283..3102431,3102478..3102516)) 1 NC_003424.3 conserved eukaryotic protein 3102516 2542579 SPAC589.05c Schizosaccharomyces pombe 972h- conserved eukaryotic protein NP_594053.1 3101297 R 284812 CDS SPAC589.06c 19114966 2542504 complement(join(3102969..3103565,3103708..3103719)) 1 NC_003424.3 pho88 family protein 3103719 2542504 SPAC589.06c Schizosaccharomyces pombe 972h- pho88 family protein NP_594054.1 3102969 R 284812 CDS SPAC589.07c 19114967 2542180 complement(join(3104343..3104364,3104433..3105153,3105219..3105378,3105441..3105547,3105613..3105686,3105871..3105908)) 1 NC_003424.3 WD repeat protein Atg18 3105908 2542180 SPAC589.07c Schizosaccharomyces pombe 972h- WD repeat protein Atg18 NP_594055.1 3104343 R 284812 CDS SPAC589.08c 19114968 2542489 complement(3106374..3106841) 1 NC_003424.3 DASH complex subunit Dam1 3106841 dam1 2542489 dam1 Schizosaccharomyces pombe 972h- DASH complex subunit Dam1 NP_594056.1 3106374 R 284812 CDS SPAC589.09 19114969 2542218 3106840..3108006 1 NC_003424.3 sec14 cytosolic factor family 3108006 2542218 SPAC589.09 Schizosaccharomyces pombe 972h- sec14 cytosolic factor family NP_594057.1 3106840 D 284812 CDS SPAC589.10c 19114970 2542138 complement(3108428..3108880) 1 NC_003424.3 ribomal-ubiquitin fusion protein Ubi5 3108880 2542138 SPAC589.10c Schizosaccharomyces pombe 972h- ribomal-ubiquitin fusion protein Ubi5 NP_594058.1 3108428 R 284812 CDS SPAC589.11 19114971 2541472 join(3109174..3109312,3109606..3110015) 1 NC_003424.3 mitochondrial translation release factor (predicted) 3110015 mug82 2541472 mug82 Schizosaccharomyces pombe 972h- mitochondrial translation release factor (predicted) NP_594059.1 3109174 D 284812 CDS SPAC589.12 63054589 2542152 join(3110201..3110323,3110508..3113300) 1 NC_003424.3 glycosylceramide biosynthesis protein (predicted) 3113300 2542152 SPAC589.12 Schizosaccharomyces pombe 972h- glycosylceramide biosynthesis protein (predicted) NP_594060.2 3110201 D 284812 CDS SPAC688.02c 19114973 2543482 complement(join(3113565..3113999,3114129..3114276,3114363..3114412)) 1 NC_003424.3 kinetochore protein Mis14 3114412 mis14 2543482 mis14 Schizosaccharomyces pombe 972h- kinetochore protein Mis14 NP_594061.1 3113565 R 284812 CDS SPAC688.03c 19114974 2543480 complement(join(3114616..3114973,3115103..3115317,3115401..3115442)) 1 NC_003424.3 human AMMECR1 homolog 3115442 2543480 SPAC688.03c Schizosaccharomyces pombe 972h- human AMMECR1 homolog NP_594062.1 3114616 R 284812 CDS SPAC688.04c 295443006 2543479 complement(3116067..3116744) 1 NC_003424.3 glutathione S-transferase Gst3 3116744 gst3 2543479 gst3 Schizosaccharomyces pombe 972h- glutathione S-transferase Gst3 NP_594063.2 3116067 R 284812 CDS SPAC688.06c 19114976 2543478 complement(join(3117657..3118862,3118947..3119000)) 1 NC_003424.3 structure-specific endonuclease subunit 3119000 slx4 2543478 slx4 Schizosaccharomyces pombe 972h- structure-specific endonuclease subunit NP_594064.1 3117657 R 284812 CDS SPAC688.07c 19114977 2543470 complement(3119379..3122495) 1 NC_003424.3 sequence orphan 3122495 2543470 SPAC688.07c Schizosaccharomyces pombe 972h- sequence orphan NP_594065.1 3119379 R 284812 CDS SPAC688.08 295443008 2543467 join(3123163..3125057,3125099..3126310,3126356..3126653) 1 NC_003424.3 NOTE:first intron possibly incorrect as has no consensus branch and last exon predicted may not be correct; first intron may not be correct, possible frameshift; mediator complex subunit Srb8 3126653 srb8 2543467 srb8 Schizosaccharomyces pombe 972h- mediator complex subunit Srb8 NP_594066.2 3123163 D 284812 CDS SPAC688.09 19114979 2543465 join(3127647..3127813,3127862..3128780) 1 NC_003424.3 NAS from PMID:16043509, not yet annotated in yeast; mitochondrial pyrimidine nucletide transporter (predicted) 3128780 2543465 SPAC688.09 Schizosaccharomyces pombe 972h- mitochondrial pyrimidine nucletide transporter (predicted) NP_594067.1 3127647 D 284812 CDS SPAC688.10 19114980 2543358 3129878..3134320 1 NC_003424.3 DNA polymerase zeta catalytic subunit Rev3 3134320 rev3 2543358 rev3 Schizosaccharomyces pombe 972h- DNA polymerase zeta catalytic subunit Rev3 NP_594068.1 3129878 D 284812 CDS SPAC688.11 19114981 2543336 3135155..3138433 1 NC_003424.3 Huntingtin-interacting protein homolog 3138433 end4 2543336 end4 Schizosaccharomyces pombe 972h- Huntingtin-interacting protein homolog NP_594069.1 3135155 D 284812 CDS SPAC688.12c 19114982 2543357 complement(3138722..3139225) 1 NC_003424.3 sequence orphan 3139225 2543357 SPAC688.12c Schizosaccharomyces pombe 972h- sequence orphan NP_594070.1 3138722 R 284812 CDS SPAC688.13 19114983 2543348 3139724..3140731 1 NC_003424.3 TatD DNase family Scn1 3140731 scn1 2543348 scn1 Schizosaccharomyces pombe 972h- TatD DNase family Scn1 NP_594071.1 3139724 D 284812 CDS SPAC688.14 19114984 2543346 join(3141484..3141603,3141652..3142329,3142396..3142667,3142719..3143034) 1 NC_003424.3 lysine methyltransferase (predicted) 3143034 2543346 SPAC688.14 Schizosaccharomyces pombe 972h- lysine methyltransferase (predicted) NP_594072.1 3141484 D 284812 CDS SPAC688.16 295443010 9406951 join(3143922..3144046,3144125..3144329) 1 NC_003424.3 sequence orphan 3144329 9406951 SPAC688.16 Schizosaccharomyces pombe 972h- sequence orphan XP_002742510.1 3143922 D 284812 CDS SPAC3G9.16c 19114985 2543335 join(3145214..3145250,3145298..3145728) 1 NC_003424.3 TRAPP complex subunit Bet5 (predicted) 3145728 bet5 2543335 bet5 Schizosaccharomyces pombe 972h- TRAPP complex subunit Bet5 (predicted) NP_594073.1 3145214 D 284812 CDS SPAC3G9.15c 162312474 2543250 3145867..3146559 1 NC_003424.3 rRNA processing protein Fcf2 (predicted) 3146559 fcf2 2543250 fcf2 Schizosaccharomyces pombe 972h- rRNA processing protein Fcf2 (predicted) NP_594087.3 3145867 D 284812 CDS SPAC3G9.14 19114998 2543421 complement(3147207..3149507) 1 NC_003424.3 transcriptional repressor Sak1 3149507 sak1 2543421 sak1 Schizosaccharomyces pombe 972h- transcriptional repressor Sak1 NP_594086.1 3147207 R 284812 CDS SPAC3G9.13c 19114997 2543249 join(3151326..3151625,3151789..3151869,3151952..3152079,3152134..3152255,3152328..3152782) 1 NC_003424.3 mitochondrial tryptophan-tRNA ligase Msw1 (predicted) 3152782 msw1 2543249 msw1 Schizosaccharomyces pombe 972h- mitochondrial tryptophan-tRNA ligase Msw1 (predicted) NP_594085.1 3151326 D 284812 CDS SPAC3G9.12 19114996 2543399 complement(join(3152779..3157050,3157130..3157197,3157240..3157288)) 1 NC_003424.3 CLASP family microtubule-associated protein 3157288 peg1 2543399 peg1 Schizosaccharomyces pombe 972h- CLASP family microtubule-associated protein NP_594084.1 3152779 R 284812 CDS SPAC3G9.11c 19114995 2543400 3160230..3161942 1 NC_003424.3 pyruvate decarboxylase (predicted) 3161942 2543400 SPAC3G9.11c Schizosaccharomyces pombe 972h- pyruvate decarboxylase (predicted) NP_594083.1 3160230 D 284812 CDS SPAC3G9.10c 19114994 2543451 join(3163221..3163223,3163272..3163311,3163423..3164108) 1 NC_003424.3 exosomal 3'-to-5' phosphorolytic exoribonuclease Ski6 (predicted) 3164108 ski6 2543451 ski6 Schizosaccharomyces pombe 972h- exosomal 3'-to-5' phosphorolytic exoribonuclease Ski6 (predicted) NP_594082.1 3163221 D 284812 CDS SPAC3G9.09c 19114993 2543455 join(3166456..3166525,3166588..3166758,3166865..3167544) 1 NC_003424.3 translation initiation factor eIF2 alpha subunit 3167544 tif211 2543455 tif211 Schizosaccharomyces pombe 972h- translation initiation factor eIF2 alpha subunit NP_594081.1 3166456 D 284812 CDS SPAC3G9.08 19114992 2543454 complement(3168191..3169042) 1 NC_003424.3 ING family homolog Png1 3169042 png1 2543454 png1 Schizosaccharomyces pombe 972h- ING family homolog Png1 NP_594080.1 3168191 R 284812 CDS SPAC3G9.07c 19114991 2543643 3170110..3171414 1 NC_003424.3 histone deacetylase (class I) Hos2 3171414 hos2 2543643 hos2 Schizosaccharomyces pombe 972h- histone deacetylase (class I) Hos2 NP_594079.1 3170110 D 284812 CDS SPAC3G9.06 19114990 2543647 complement(join(3171584..3172699,3172768..3172857,3173052..3173345)) 1 NC_003424.3 cytoplasmic phenylalanine-tRNA ligase alpha subunit Frs2 (predicted) 3173345 frs2 2543647 frs2 Schizosaccharomyces pombe 972h- cytoplasmic phenylalanine-tRNA ligase alpha subunit Frs2 (predicted) NP_594078.1 3171584 R 284812 CDS SPAC3G9.05 19114989 2543517 complement(join(3173946..3175729,3175778..3175906,3175993..3176059)) 1 NC_003424.3 GTPase activating protein (predicted) 3176059 2543517 SPAC3G9.05 Schizosaccharomyces pombe 972h- GTPase activating protein (predicted) NP_594077.1 3173946 R 284812 CDS SPAC3G9.04 19114988 2543452 complement(join(3176488..3176998,3177048..3177130)) 1 NC_003424.3 phosphoric ester hydrolase Ssu72 (predicted) 3177130 ssu72 2543452 ssu72 Schizosaccharomyces pombe 972h- phosphoric ester hydrolase Ssu72 (predicted) NP_594076.1 3176488 R 284812 CDS SPAC3G9.03 19114987 2543453 complement(join(3179462..3179709,3179821..3179992)) 1 NC_003424.3 60S ribosomal protein L23 3179992 rpl2301 2543453 rpl2301 Schizosaccharomyces pombe 972h- 60S ribosomal protein L23 NP_594075.1 3179462 R 284812 CDS SPAC3G9.02 19114986 2543512 complement(3180426..3181136) 1 NC_003424.3 3-oxoacyl-[acyl-carrier-protein] reductase Oar2 (predicted) 3181136 oar2 2543512 oar2 Schizosaccharomyces pombe 972h- 3-oxoacyl-[acyl-carrier-protein] reductase Oar2 (predicted) NP_594074.1 3180426 R 284812 CDS SPAC3G9.01 68000141 3361470 complement(3181639..3183027) 1 NC_003424.3 Clp1-interacting protein Nsk1 3183027 nsk1 3361470 nsk1 Schizosaccharomyces pombe 972h- Clp1-interacting protein Nsk1 NP_001018258.1 3181639 R 284812 CDS SPAC1486.01 19115001 2542886 join(3185470..3185577,3185701..3186249) 1 NC_003424.3 manganese superoxide dismutase (predicted) 3186249 2542886 SPAC1486.01 Schizosaccharomyces pombe 972h- manganese superoxide dismutase (predicted) NP_594089.1 3185470 D 284812 CDS SPAC1486.02c 19115002 2542884 complement(join(3186754..3187722,3187811..3187941,3188049..3188067)) 1 NC_003424.3 UBA domain protein Ucp14 3188067 ucp14 2542884 ucp14 Schizosaccharomyces pombe 972h- UBA domain protein Ucp14 NP_594090.1 3186754 R 284812 CDS SPAC1486.03c 19115003 2542910 complement(3188398..3190791) 1 NC_003424.3 RNA-binding splicing factor 3190791 2542910 SPAC1486.03c Schizosaccharomyces pombe 972h- RNA-binding splicing factor NP_594091.1 3188398 R 284812 CDS SPAC1486.04c 19115004 2542883 complement(3191532..3196715) 1 NC_003424.3 medial ring protein Alm1 3196715 alm1 2542883 alm1 Schizosaccharomyces pombe 972h- medial ring protein Alm1 NP_594092.1 3191532 R 284812 CDS SPAC1486.05 19115005 2541547 join(3197028..3197443,3197530..3202450) 1 NC_003424.3 nucleoporin Nup189 3202450 nup189 2541547 nup189 Schizosaccharomyces pombe 972h- nucleoporin Nup189 NP_594093.1 3197028 D 284812 CDS SPAC1486.06 19115006 2542272 3204361..3205593 1 NC_003424.3 nicotinate phosphoribosyltransferase (predicted) 3205593 2542272 SPAC1486.06 Schizosaccharomyces pombe 972h- nicotinate phosphoribosyltransferase (predicted) NP_594094.1 3204361 D 284812 CDS SPAC1486.07c 19115007 2541549 complement(3206100..3206534) 1 NC_003424.3 mitochondrial ribosomal protein subunit L19 3206534 mrpl19 2541549 mrpl19 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit L19 NP_594095.1 3206100 R 284812 CDS SPAC1486.08 19115008 2541594 join(3207520..3207750,3207870..3207980) 1 NC_003424.3 mitochondrial inner membrane protein involved in cytochrome c oxidase assembly Cox16 3207980 2541594 SPAC1486.08 Schizosaccharomyces pombe 972h- mitochondrial inner membrane protein involved in cytochrome c oxidase assembly Cox16 NP_594096.1 3207520 D 284812 CDS SPAC1486.09 19115009 2541448 join(3209901..3210102,3210318..3211282) 1 NC_003424.3 ribosome biogenesis protein Nob1 (predicted) 3211282 2541448 SPAC1486.09 Schizosaccharomyces pombe 972h- ribosome biogenesis protein Nob1 (predicted) NP_594097.1 3209901 D 284812 CDS SPAC1486.10 63054592 2541581 3211979..3214306 1 NC_003424.3 transcription factor Thi1 3214306 thi1 2541581 thi1 Schizosaccharomyces pombe 972h- transcription factor Thi1 NP_594098.2 3211979 D 284812 CDS SPAC6G10.02c 19115011 2542619 complement(3214690..3218067) 1 NC_003424.3 cell end marker Tea3 3218067 tea3 2542619 tea3 Schizosaccharomyces pombe 972h- cell end marker Tea3 NP_594099.1 3214690 R 284812 CDS SPAC6G10.03c 19115012 2542281 complement(3218952..3220238) 1 NC_003424.3 mitochondrial cardiolipin-specific phopholipase 3220238 2542281 SPAC6G10.03c Schizosaccharomyces pombe 972h- mitochondrial cardiolipin-specific phopholipase NP_594100.1 3218952 R 284812 CDS SPAC6G10.04c 19115013 2542559 complement(join(3221056..3221620,3221795..3221898,3221949..3222079,3222123..3222141)) 1 NC_003424.3 20S proteasome component alpha 6 subunit Pre5 3222141 2542559 SPAC6G10.04c Schizosaccharomyces pombe 972h- 20S proteasome component alpha 6 subunit Pre5 NP_594101.1 3221056 R 284812 CDS SPAC6G10.05c 19115014 2542375 complement(join(3222505..3222782,3222848..3226036,3226078..3226243)) 1 NC_003424.3 TRAPP complex subunit Trs120 (predicted) 3226243 2542375 SPAC6G10.05c Schizosaccharomyces pombe 972h- TRAPP complex subunit Trs120 (predicted) NP_594102.1 3222505 R 284812 CDS SPAC6G10.06 19115015 2542382 join(3226929..3226980,3227042..3227383,3227456..3228192) 1 NC_003424.3 FAD-dependent amino acid oxidase (predicted) 3228192 2542382 SPAC6G10.06 Schizosaccharomyces pombe 972h- FAD-dependent amino acid oxidase (predicted) NP_594103.1 3226929 D 284812 CDS SPAC6G10.07 19115016 2542556 join(3228533..3228783,3228833..3230924) 1 NC_003424.3 nuclear cap-binding complex large subunit (predicted) 3230924 2542556 SPAC6G10.07 Schizosaccharomyces pombe 972h- nuclear cap-binding complex large subunit (predicted) NP_594104.1 3228533 D 284812 CDS SPAC6G10.08 19115017 2542598 3231599..3232855 1 NC_003424.3 isocitrate dehydrogenase Idp1 3232855 idp1 2542598 idp1 Schizosaccharomyces pombe 972h- isocitrate dehydrogenase Idp1 NP_594105.1 3231599 D 284812 CDS SPAC6G10.09 19115018 2542534 join(3233670..3233907,3233958..3236146) 1 NC_003424.3 glucosidase I Gls1 (predicted) 3236146 2542534 SPAC6G10.09 Schizosaccharomyces pombe 972h- glucosidase I Gls1 (predicted) NP_594106.1 3233670 D 284812 CDS SPAC6G10.10c 19115019 2541457 complement(3236417..3237001) 1 NC_003424.3 human hmmtag2 homolog 3237001 2541457 SPAC6G10.10c Schizosaccharomyces pombe 972h- human hmmtag2 homolog NP_594107.1 3236417 R 284812 CDS SPAC6G10.11c 19115020 2541445 complement(3237910..3238362) 1 NC_003424.3 ribosomal-ubiquitin fusion protein Ubi3 3238362 ubi3 2541445 ubi3 Schizosaccharomyces pombe 972h- ribosomal-ubiquitin fusion protein Ubi3 NP_594108.1 3237910 R 284812 CDS SPAC6G10.12c 19115021 2541661 complement(3239366..3240967) 1 NC_003424.3 transcription factor Ace2 3240967 ace2 2541661 ace2 Schizosaccharomyces pombe 972h- transcription factor Ace2 NP_594109.1 3239366 R 284812 CDS SPAC6G9.01c 19115022 2541905 complement(join(3241563..3241570,3241655..3241753,3242152..3242332)) 1 NC_003424.3 hypothetical protein 3242332 2541905 SPAC6G9.01c Schizosaccharomyces pombe 972h- hypothetical protein NP_594110.1 3241563 R 284812 CDS SPAC6G9.02c 19115023 2542044 complement(3243258..3245225) 1 NC_003424.3 RNA-binding protein Nop9 3245225 nop9 2542044 nop9 Schizosaccharomyces pombe 972h- RNA-binding protein Nop9 NP_594111.1 3243258 R 284812 CDS SPAC6G9.03c 19115024 2542055 complement(join(3246488..3246912,3246957..3247590)) 1 NC_003424.3 histone chaperone Rtt106-like 3247590 mug183 2542055 mug183 Schizosaccharomyces pombe 972h- histone chaperone Rtt106-like NP_594112.1 3246488 R 284812 CDS SPAC6G9.04 19115025 2541456 3248598..3252554 1 NC_003424.3 meiotically upregulated gene Mug79 3252554 mug79 2541456 mug79 Schizosaccharomyces pombe 972h- meiotically upregulated gene Mug79 NP_594113.1 3248598 D 284812 CDS SPAC6G9.05 19115026 2541509 3253513..3254370 1 NC_003424.3 alterntive start at 12302; coenzyme A diphosphatase (predicted) 3254370 pcd1 2541509 pcd1 Schizosaccharomyces pombe 972h- coenzyme A diphosphatase (predicted) NP_594114.1 3253513 D 284812 CDS SPAC6G9.06c 19115027 2541455 complement(3254539..3258165) 1 NC_003424.3 pole target of calmodulin in S. pombe Pcp1; pericentrin Pcp1 3258165 pcp1 2541455 pcp1 Schizosaccharomyces pombe 972h- pericentrin Pcp1 NP_594115.1 3254539 R 284812 CDS SPAC6G9.07c 19115028 2541767 complement(join(3258572..3258748,3258930..3259053,3259184..3259386,3259442..3259444)) 1 NC_003424.3 ARP2/3 actin-organizing complex subunit Arc4 3259444 arc4 2541767 arc4 Schizosaccharomyces pombe 972h- ARP2/3 actin-organizing complex subunit Arc4 NP_594116.1 3258572 R 284812 CDS SPAC6G9.08 19115029 2541819 3259704..3261107 1 NC_003424.3 ubiquitin C-terminal hydrolase Ubp6 3261107 ubp6 2541819 ubp6 Schizosaccharomyces pombe 972h- ubiquitin C-terminal hydrolase Ubp6 NP_594117.1 3259704 D 284812 CDS SPAC6G9.09c 19115030 2541570 complement(3261471..3261920) 1 NC_003424.3 60S ribosomal protein L24 3261920 rpl24 2541570 rpl24 Schizosaccharomyces pombe 972h- 60S ribosomal protein L24 NP_594118.1 3261471 R 284812 CDS SPAC6G9.10c 19115031 2541556 complement(3262462..3267525) 1 NC_003424.3 ATP-dependent 5' to 3' DNA/RNA helicase Sen1 3267525 sen1 2541556 sen1 Schizosaccharomyces pombe 972h- ATP-dependent 5' to 3' DNA/RNA helicase Sen1 NP_594119.1 3262462 R 284812 CDS SPAC6G9.11 19115032 2541731 join(3268311..3268512,3268577..3268740) 1 NC_003424.3 SNAP receptor, synaptobrevin family 3268740 syb1 2541731 syb1 Schizosaccharomyces pombe 972h- SNAP receptor, synaptobrevin family NP_594120.1 3268311 D 284812 CDS SPAC6G9.12 19115033 2541978 3270235..3272097 1 NC_003424.3 Chs five related protein Cfr1 3272097 cfr1 2541978 cfr1 Schizosaccharomyces pombe 972h- Chs five related protein Cfr1 NP_594121.1 3270235 D 284812 CDS SPAC6G9.13c 162312476 2541973 complement(join(3272150..3272265,3272417..3272699)) 1 NC_003424.3 bouquet formation protein Bqt1 3272699 bqt1 2541973 bqt1 Schizosaccharomyces pombe 972h- bouquet formation protein Bqt1 XP_001713078.1 3272150 R 284812 CDS SPAC6G9.14 19115035 2542056 join(3274135..3275874,3275925..3276230) 1 NC_003424.3 RNA-binding protein 3276230 2542056 SPAC6G9.14 Schizosaccharomyces pombe 972h- RNA-binding protein NP_594123.1 3274135 D 284812 CDS SPAC6G9.15c 19115036 2541960 complement(3276651..3278147) 1 NC_003424.3 sequence orphan 3278147 2541960 SPAC6G9.15c Schizosaccharomyces pombe 972h- sequence orphan NP_594124.1 3276651 R 284812 CDS SPAC6G9.16c 295443012 2541931 complement(join(3278951..3279367,3279420..3279539,3279683..3279819,3279865..3279985)) 1 NC_003424.3 gene prediciton extended by transcript data; sequence orphan 3279985 2541931 SPAC6G9.16c Schizosaccharomyces pombe 972h- sequence orphan NP_594125.2 3278951 R 284812 CDS SPAC652.01 19115038 2543566 join(3281408..3281514,3281584..3281803) 1 NC_003424.3 BC10 family protein 3281803 2543566 SPAC652.01 Schizosaccharomyces pombe 972h- BC10 family protein NP_594126.1 3281408 D 284812 CDS SPAPB1E7.01c 19115039 2543601 complement(3282214..3282705) 1 NC_003424.3 conserved fungal family 3282705 2543601 SPAPB1E7.01c Schizosaccharomyces pombe 972h- conserved fungal family NP_594127.1 3282214 R 284812 CDS SPAPB1E7.02c 19115040 2543387 complement(join(3283195..3285298,3285357..3285508,3285554..3285745)) 1 NC_003424.3 DNA polymerase alpha accessory factor Mcl1 3285745 mcl1 2543387 mcl1 Schizosaccharomyces pombe 972h- DNA polymerase alpha accessory factor Mcl1 NP_594128.1 3283195 R 284812 CDS SPAPB1E7.03 19115041 2543417 join(3286602..3286667,3286747..3288456) 1 NC_003424.3 DNA-directed RNA polymerase III complex subunit Rpc82 (predicted) 3288456 rpc82 2543417 rpc82 Schizosaccharomyces pombe 972h- DNA-directed RNA polymerase III complex subunit Rpc82 (predicted) NP_594129.1 3286602 D 284812 CDS SPAPB1E7.04c 19115042 2543683 complement(3288801..3292511) 1 NC_003424.3 chitinase (predicted) 3292511 2543683 SPAPB1E7.04c Schizosaccharomyces pombe 972h- chitinase (predicted) NP_594130.1 3288801 R 284812 CDS SPAPB1E7.05 19115043 2543677 3294111..3297341 1 NC_003424.3 glycerophosphoryl diester phosphodiesterase Gde1 3297341 gde1 2543677 gde1 Schizosaccharomyces pombe 972h- glycerophosphoryl diester phosphodiesterase Gde1 NP_594131.1 3294111 D 284812 CDS SPAPB1E7.06c 19115044 2543670 complement(join(3297520..3299548,3299633..3299724,3299772..3299867)) 1 NC_003424.3 Holliday junction resolvase subunit Eme1 3299867 eme1 2543670 eme1 Schizosaccharomyces pombe 972h- Holliday junction resolvase subunit Eme1 NP_594132.1 3297520 R 284812 CDS SPAPB1E7.07 19115045 2543509 3303630..3309965 1 NC_003424.3 glutamate synthase Glt1 (predicted) 3309965 glt1 2543509 glt1 Schizosaccharomyces pombe 972h- glutamate synthase Glt1 (predicted) NP_594133.1 3303630 D 284812 CDS SPAPB1E7.08c 19115046 2543660 complement(3310671..3312335) 1 NC_003424.3 membrane transporter 3312335 2543660 SPAPB1E7.08c Schizosaccharomyces pombe 972h- membrane transporter NP_594134.1 3310671 R 284812 CDS SPAPB1E7.09 19115047 2543657 3313641..3315860 1 NC_003424.3 protein O-mannosyltransferase Ogm2 3315860 ogm2 2543657 ogm2 Schizosaccharomyces pombe 972h- protein O-mannosyltransferase Ogm2 NP_594135.1 3313641 D 284812 CDS SPAPB1E7.10 19115048 2543653 3316924..3317313 1 NC_003424.3 DNA-directed RNA polymerase III complex subunit Rpc17 3317313 rpc17 2543653 rpc17 Schizosaccharomyces pombe 972h- DNA-directed RNA polymerase III complex subunit Rpc17 NP_594136.1 3316924 D 284812 CDS SPAPB1E7.11c 19115049 2543584 complement(3317673..3318632) 1 NC_003424.3 sequence orphan 3318632 2543584 SPAPB1E7.11c Schizosaccharomyces pombe 972h- sequence orphan NP_594137.1 3317673 R 284812 CDS SPAPB1E7.12 19115050 2543581 3319260..3319979 1 NC_003424.3 40S ribosomal protein S6 3319979 rps602 2543581 rps602 Schizosaccharomyces pombe 972h- 40S ribosomal protein S6 NP_594138.1 3319260 D 284812 CDS SPAPB1E7.14 295443014 9407262 join(3321979..3322018,3322071..3322331,3322379..3322512) 1 NC_003424.3 Ino80 complex subunit Iec5 3322512 iec5 9407262 iec5 Schizosaccharomyces pombe 972h- Ino80 complex subunit Iec5 XP_002742511.1 3321979 D 284812 CDS SPAC2E1P5.01c 63054593 2541719 complement(3322913..3324478) 1 NC_003424.3 mannosyl-oligosaccharide 1,2-alpha-mannosidase 3324478 mns1 2541719 mns1 Schizosaccharomyces pombe 972h- mannosyl-oligosaccharide 1,2-alpha-mannosidase NP_594139.2 3322913 R 284812 CDS SPAC2E1P5.02c 19115052 2541435 complement(3325647..3326138) 1 NC_003424.3 sequence orphan 3326138 mug109 2541435 mug109 Schizosaccharomyces pombe 972h- sequence orphan NP_594140.1 3325647 R 284812 CDS SPAC2E1P5.03 19115053 2541520 3326898..3327809 1 NC_003424.3 DNAJ domain protein Erj5 3327809 2541520 SPAC2E1P5.03 Schizosaccharomyces pombe 972h- DNAJ domain protein Erj5 NP_594141.1 3326898 D 284812 CDS SPAC2E1P5.04c 19115054 2541514 complement(3327940..3329007) 1 NC_003424.3 geranylgeranyltransferase I beta subunit Cwg2 3329007 cwg2 2541514 cwg2 Schizosaccharomyces pombe 972h- geranylgeranyltransferase I beta subunit Cwg2 NP_594142.1 3327940 R 284812 CDS SPAC2E1P5.05 19115055 2541476 3329362..3330936 1 NC_003424.3 U3 snoRNP-associated protein Rrp9 (predicted) 3330936 2541476 SPAC2E1P5.05 Schizosaccharomyces pombe 972h- U3 snoRNP-associated protein Rrp9 (predicted) NP_594143.1 3329362 D 284812 CDS SPAC26A3.01 162312478 3361468 3332669..3334270 1 NC_003424.3 does not appear to be a yapsin (PMID 11115118); aspartic protease Sxa1 3334270 sxa1 3361468 sxa1 Schizosaccharomyces pombe 972h- aspartic protease Sxa1 XP_001713079.1 3332669 D 284812 CDS SPAC26A3.02 19115057 2542727 join(3334992..3335587,3335687..3335880,3335924..3336519) 1 NC_003424.3 adenine DNA glycosylase Myh1 3336519 myh1 2542727 myh1 Schizosaccharomyces pombe 972h- adenine DNA glycosylase Myh1 NP_594145.1 3334992 D 284812 CDS SPAC26A3.03c 19115058 2542729 complement(3336520..3337227) 1 NC_003424.3 RecQ mediated genome instability protein Rmi1 3337227 rmi1 2542729 rmi1 Schizosaccharomyces pombe 972h- RecQ mediated genome instability protein Rmi1 NP_594146.1 3336520 R 284812 CDS SPAC26A3.04 19115059 2542093 3337748..3338278 1 NC_003424.3 60S ribosomal protein L20 3338278 rpl2002 2542093 rpl2002 Schizosaccharomyces pombe 972h- 60S ribosomal protein L20 NP_594147.1 3337748 D 284812 CDS SPAC26A3.05 19115060 2542078 join(3339136..3339177,3339218..3339291,3339348..3344232) 1 NC_003424.3 clathrin heavy chain Chc1 (predicted) 3344232 chc1 2542078 chc1 Schizosaccharomyces pombe 972h- clathrin heavy chain Chc1 (predicted) NP_594148.1 3339136 D 284812 CDS SPAC26A3.06 19115061 2542685 join(3344784..3344819,3344871..3344908,3345031..3345763) 1 NC_003424.3 methyltransferase (predicted) 3345763 2542685 SPAC26A3.06 Schizosaccharomyces pombe 972h- methyltransferase (predicted) NP_594149.1 3344784 D 284812 CDS SPAC26A3.07c 19115062 2541591 complement(3346335..3346859) 1 NC_003424.3 60S ribosomal protein L11 3346859 rpl1101 2541591 rpl1101 Schizosaccharomyces pombe 972h- 60S ribosomal protein L11 NP_594150.1 3346335 R 284812 CDS SPAC26A3.08 19115063 2542684 join(3347053..3347055,3347121..3347561) 1 NC_003424.3 Sm snRNP core protein Smb1 3347561 smb1 2542684 smb1 Schizosaccharomyces pombe 972h- Sm snRNP core protein Smb1 NP_594151.1 3347053 D 284812 CDS SPAC26A3.09c 19115064 2542682 complement(3348569..3352396) 1 NC_003424.3 Rho-type GTPase activating protein Rga2 3352396 rga2 2542682 rga2 Schizosaccharomyces pombe 972h- Rho-type GTPase activating protein Rga2 NP_594152.1 3348569 R 284812 CDS SPAC26A3.10 19115065 2542074 join(3352515..3352530,3352569..3352693,3352985..3355615) 1 NC_003424.3 SPAC26A3.09c and SPAC26A3.10 are convergent and very close, functionally related, perhaps co-regulated?; centaurin ADOP ribosylation factor GTPase activating protein family 3355615 cnt6 2542074 cnt6 Schizosaccharomyces pombe 972h- centaurin ADOP ribosylation factor GTPase activating protein family NP_594153.1 3352515 D 284812 CDS SPAC26A3.11 19115066 2542673 join(3356732..3357079,3357129..3357749) 1 NC_003424.3 amidohydrolase 3357749 2542673 SPAC26A3.11 Schizosaccharomyces pombe 972h- amidohydrolase NP_594154.1 3356732 D 284812 CDS SPAC26A3.12c 19115067 2542674 complement(3357917..3360892) 1 NC_003424.3 CARE dph1 is in same cosmid; 5'-3' exoribonuclease Dhp1 3360892 dhp1 2542674 dhp1 Schizosaccharomyces pombe 972h- 5'-3' exoribonuclease Dhp1 NP_594155.1 3357917 R 284812 CDS SPAC26A3.13c 19115068 2542672 complement(3361547..3365548) 1 NC_003424.3 retrotransposable element 3365548 Tf2-4 2542672 Tf2-4 Schizosaccharomyces pombe 972h- retrotransposable element NP_594156.1 3361547 R 284812 CDS SPAC26A3.14c 19115069 2541994 complement(join(3366743..3366872,3366932..3367020,3367054..3367056)) 1 NC_003424.3 DUF1748 family protein 3367056 2541994 SPAC26A3.14c Schizosaccharomyces pombe 972h- DUF1748 family protein NP_594157.1 3366743 R 284812 CDS SPAC26A3.15c 19115070 2542668 complement(join(3367657..3369449,3369516..3369519)) 1 NC_003424.3 nucleoporin Nsp1 3369519 nsp1 2542668 nsp1 Schizosaccharomyces pombe 972h- nucleoporin Nsp1 NP_594158.1 3367657 R 284812 CDS SPAC26A3.16 19115071 2542667 3369743..3370807 1 NC_003424.3 CARE dhp1 is in same cosmid; UBA domain protein Dph1 3370807 dph1 2542667 dph1 Schizosaccharomyces pombe 972h- UBA domain protein Dph1 NP_594159.1 3369743 D 284812 CDS SPAC26A3.17c 63054595 2542686 complement(3371409..3372482) 1 NC_003424.3 N-methyltransferase (predicted) 3372482 2542686 SPAC26A3.17c Schizosaccharomyces pombe 972h- N-methyltransferase (predicted) NP_594160.2 3371409 R 284812 CDS SPAC8E11.10 19115073 2543428 complement(3373217..3373984) 1 NC_003424.3 sorbose reductase (predicted) 3373984 2543428 SPAC8E11.10 Schizosaccharomyces pombe 972h- sorbose reductase (predicted) NP_594161.1 3373217 R 284812 CDS SPAC8E11.08c 162312482 5802913 3375516..3375818 1 NC_003424.3 dubious 3375818 5802913 SPAC8E11.08c Schizosaccharomyces pombe 972h- dubious XP_001713081.1 3375516 D 284812 CDS SPAC8E11.07c 19115074 2543341 join(3377148..3377216,3377280..3377366,3377519..3377722) 1 NC_003424.3 tubulin specific chaperone cofactor A, Alp31 3377722 alp31 2543341 alp31 Schizosaccharomyces pombe 972h- tubulin specific chaperone cofactor A, Alp31 NP_594162.1 3377148 D 284812 CDS SPAC8E11.06 19115075 2543132 complement(join(3377901..3377958,3378004..3378021,3378069..3378094)) 1 NC_003424.3 predicted from EST data; sequence orphan 3378094 2543132 SPAC8E11.06 Schizosaccharomyces pombe 972h- sequence orphan NP_594163.1 3377901 R 284812 CDS SPAC8E11.05c 19115076 2542654 3378272..3379288 1 NC_003424.3 conserved fungal protein 3379288 2542654 SPAC8E11.05c Schizosaccharomyces pombe 972h- conserved fungal protein NP_594164.1 3378272 D 284812 CDS SPAC8E11.04c 19115077 2542889 join(3380756..3380828,3380900..3380984,3381096..3381143,3381199..3381344,3381459..3381781) 1 NC_003424.3 orthologous to S. cerevisiae YLR118C; reciprocal best hit but possibly not ortholog due to probable lineage specific gene losses (is more divergent than higher eukaryotic orthologs); phospholipase (predicted) 3381781 2542889 SPAC8E11.04c Schizosaccharomyces pombe 972h- phospholipase (predicted) NP_594165.1 3380756 D 284812 CDS SPAC8E11.03c 19115078 2542106 join(3382332..3382404,3382479..3383404) 1 NC_003424.3 RecA family ATPase Dmc1 3383404 dmc1 2542106 dmc1 Schizosaccharomyces pombe 972h- RecA family ATPase Dmc1 NP_594166.1 3382332 D 284812 CDS SPAC8E11.02c 19115079 2542029 join(3384268..3384337,3384745..3385487) 1 NC_003424.3 14-3-3 protein Rad24 3385487 rad24 2542029 rad24 Schizosaccharomyces pombe 972h- 14-3-3 protein Rad24 NP_594167.1 3384268 D 284812 CDS SPAC8E11.01c 63054596 2542702 3386047..3387573 1 NC_003424.3 beta-fructofuranosidase-like protein 3387573 2542702 SPAC8E11.01c Schizosaccharomyces pombe 972h- beta-fructofuranosidase-like protein NP_594168.2 3386047 D 284812 CDS SPAC959.02 19115081 2543488 join(3388241..3388273,3388317..3388434,3388476..3388779,3388913..3389327) 1 NC_003424.3 alpha SNAP (predicted) 3389327 sec17 2543488 sec17 Schizosaccharomyces pombe 972h- alpha SNAP (predicted) NP_594169.1 3388241 D 284812 CDS SPAC959.03c 19115082 2543484 complement(3389828..3391390) 1 NC_003424.3 U3 snoRNP-associated protein Utp7 3391390 2543484 SPAC959.03c Schizosaccharomyces pombe 972h- U3 snoRNP-associated protein Utp7 NP_594170.1 3389828 R 284812 CDS SPAC959.10 68000226 3361466 3392259..3392690 1 NC_003424.3 tRNA-splicing endonuclease subunit Sen15 3392690 sen15 3361466 sen15 Schizosaccharomyces pombe 972h- tRNA-splicing endonuclease subunit Sen15 NP_001018260.1 3392259 D 284812 CDS SPAC959.04c 19115083 2543472 complement(join(3392886..3393028,3393125..3393411,3393483..3393949)) 1 NC_003424.3 mannosyltransferase (predicted) 3393949 2543472 SPAC959.04c Schizosaccharomyces pombe 972h- mannosyltransferase (predicted) NP_594171.1 3392886 R 284812 CDS SPAC959.05c 295443016 2543474 complement(join(3395685..3397327,3397383..3397579,3397681..3397852,3398029..3398701)) 1 NC_003424.3 gene stucture updated; merged SPAC959.06c & SPAC959.05c, pers. comm. Charly Chahwan, splicing is tentative; protein disulfide isomerase (predicted) 3398701 2543474 SPAC959.05c Schizosaccharomyces pombe 972h- protein disulfide isomerase (predicted) NP_594172.3 3395685 R 284812 CDS SPAC959.07 19115086 2543486 3399256..3400044 1 NC_003424.3 40S ribosomal protein S4 3400044 rps403 2543486 rps403 Schizosaccharomyces pombe 972h- 40S ribosomal protein S4 NP_594174.1 3399256 D 284812 CDS SPAC959.08 19115087 2543337 3400542..3401024 1 NC_003424.3 60S ribosomal protein L21 3401024 rpl2102 2543337 rpl2102 Schizosaccharomyces pombe 972h- 60S ribosomal protein L21 NP_594175.1 3400542 D 284812 CDS SPAC959.09c 162312484 2543355 complement(join(3401279..3401424,3401471..3401771,3401818..3401913,3401961..3402087,3402138..3402905,3402956..3403049,3403136..3403195,3403240..3403576,3403625..3403729,3403791..3403970)) 1 NC_003424.3 anaphase-promoting complex subunit Apc5 3403970 apc5 2543355 apc5 Schizosaccharomyces pombe 972h- anaphase-promoting complex subunit Apc5 XP_001713082.1 3401279 R 284812 CDS SPAP32A8.02 19115090 2541584 3406215..3407066 1 NC_003424.3 xylose and arabinose reductase (predicted) 3407066 2541584 SPAP32A8.02 Schizosaccharomyces pombe 972h- xylose and arabinose reductase (predicted) NP_594178.1 3406215 D 284812 CDS SPAP32A8.03c 19115091 2542072 complement(join(3407825..3409267,3409427..3409525)) 1 NC_003424.3 ubiquitin-protein ligase E3 (predicted) 3409525 2542072 SPAP32A8.03c Schizosaccharomyces pombe 972h- ubiquitin-protein ligase E3 (predicted) NP_594179.1 3407825 R 284812 CDS SPAC3H5.12c 19115092 2543642 3410951..3411835 1 NC_003424.3 60S ribosomal protein L5 3411835 rpl501 2543642 rpl501 Schizosaccharomyces pombe 972h- 60S ribosomal protein L5 NP_594180.1 3410951 D 284812 CDS SPAC3H5.11 19115093 2543649 complement(join(3413139..3413295,3413369..3413520,3413571..3414238,3414292..3414496)) 1 NC_003424.3 NAD/NADH kinase (predicted) 3414496 2543649 SPAC3H5.11 Schizosaccharomyces pombe 972h- NAD/NADH kinase (predicted) NP_594181.1 3413139 R 284812 CDS SPAC3H5.10 19115094 2543460 complement(3415658..3416041) 1 NC_003424.3 60S ribosomal protein L32 3416041 rpl3202 2543460 rpl3202 Schizosaccharomyces pombe 972h- 60S ribosomal protein L32 NP_594182.1 3415658 R 284812 CDS SPAC3H5.09c 19115095 2543405 3416764..3424821 1 NC_003424.3 conserved eukaryotic mitochondrial protein (predicted) 3424821 2543405 SPAC3H5.09c Schizosaccharomyces pombe 972h- conserved eukaryotic mitochondrial protein (predicted) NP_594183.1 3416764 D 284812 CDS SPAC3H5.08c 19115096 2543641 join(3426306..3428390,3428428..3428910) 1 NC_003424.3 WD repeat protein, human WDR44 family 3428910 2543641 SPAC3H5.08c Schizosaccharomyces pombe 972h- WD repeat protein, human WDR44 family NP_594184.1 3426306 D 284812 CDS SPAC3H5.07 19115097 2543448 complement(join(3429717..3430343,3430635..3430760)) 1 NC_003424.3 60S ribosomal protein L7 3430760 rpl702 2543448 rpl702 Schizosaccharomyces pombe 972h- 60S ribosomal protein L7 NP_594185.1 3429717 R 284812 CDS SPAC3H5.06c 19115098 2543629 join(3431089..3431389,3431481..3435397) 1 NC_003424.3 DNA polymerase alpha catalytic subunit 3435397 pol1 2543629 pol1 Schizosaccharomyces pombe 972h- DNA polymerase alpha catalytic subunit NP_594186.1 3431089 D 284812 CDS SPAC3H5.05c 19115099 2540817 3436287..3436706 1 NC_003424.3 40S ribosomal protein S14 3436706 rps1401 2540817 rps1401 Schizosaccharomyces pombe 972h- 40S ribosomal protein S14 NP_594187.1 3436287 D 284812 CDS SPAC3H5.04 19115100 2543611 complement(3437021..3438061) 1 NC_003424.3 U5 snRNP-associated protein Aar2 3438061 aar2 2543611 aar2 Schizosaccharomyces pombe 972h- U5 snRNP-associated protein Aar2 NP_594188.1 3437021 R 284812 CDS SPAC3A11.14c 19115101 2542655 join(3438933..3438944,3438987..3439620,3439674..3441361,3441487..3441651) 1 NC_003424.3 kinesin-like protein Pkl1 3441651 pkl1 2542655 pkl1 Schizosaccharomyces pombe 972h- kinesin-like protein Pkl1 NP_594189.1 3438933 D 284812 CDS SPAC3A11.13 19115102 2543106 complement(join(3441687..3441795,3441924..3442048,3442127..3442197,3442248..3442287)) 1 NC_003424.3 prefoldin subunit 6 3442287 2543106 SPAC3A11.13 Schizosaccharomyces pombe 972h- prefoldin subunit 6 NP_594190.1 3441687 R 284812 CDS SPAC3A11.12c 162312486 3361462 join(3443944..3444096,3444282..3445445) 1 NC_003424.3 19S proteasome regulatory subunit Rpt5 (predicted) 3445445 rpt5 3361462 rpt5 Schizosaccharomyces pombe 972h- 19S proteasome regulatory subunit Rpt5 (predicted) XP_001713083.1 3443944 D 284812 CDS SPAC3A11.11c 19115104 2543167 3446508..3447512 1 NC_003424.3 pyridoxal reductase (predicted) 3447512 2543167 SPAC3A11.11c Schizosaccharomyces pombe 972h- pyridoxal reductase (predicted) NP_594192.1 3446508 D 284812 CDS SPAC3A11.10c 19115105 2543080 3448364..3449593 1 NC_003424.3 dipeptidyl peptidase (predicted) 3449593 2543080 SPAC3A11.10c Schizosaccharomyces pombe 972h- dipeptidyl peptidase (predicted) NP_594193.1 3448364 D 284812 CDS SPAC3A11.09 19115106 2542509 complement(join(3450114..3452269,3452485..3452608)) 1 NC_003424.3 plasma membrane alkali metal cation/H+ antiporter Sod22 3452608 sod22 2542509 sod22 Schizosaccharomyces pombe 972h- plasma membrane alkali metal cation/H+ antiporter Sod22 NP_594194.1 3450114 R 284812 CDS SPAC3A11.08 19115107 2543116 3453056..3455260 1 NC_003424.3 cullin 4 3455260 pcu4 2543116 pcu4 Schizosaccharomyces pombe 972h- cullin 4 NP_594195.1 3453056 D 284812 CDS SPAC3A11.07 19115108 2543119 3457273..3458928 1 NC_003424.3 NADH dehydrogenase 3458928 2543119 SPAC3A11.07 Schizosaccharomyces pombe 972h- NADH dehydrogenase NP_594196.1 3457273 D 284812 CDS SPAC3A11.06 19115109 2543124 complement(join(3459233..3459436,3459492..3459665,3459705..3459897,3459941..3460185,3460234..3460364,3460425..3460442,3460508..3460560,3460642..3461263,3461323..3461583,3461766..3461859)) 1 NC_003424.3 sorting nexin Mvp1 3461859 mvp1 2543124 mvp1 Schizosaccharomyces pombe 972h- sorting nexin Mvp1 NP_594197.1 3459233 R 284812 CDS SPAC3A11.05c 19115110 2543069 join(3463065..3463127,3463259..3463698,3463745..3465065) 1 NC_003424.3 NAS from GO:0005816|GO:0003674; meiotic spindle pole body protein Kms1 3465065 kms1 2543069 kms1 Schizosaccharomyces pombe 972h- meiotic spindle pole body protein Kms1 NP_594198.1 3463065 D 284812 CDS SPAC3A11.04 19115111 2543056 complement(join(3465309..3465444,3465542..3466006,3466165..3466274)) 1 NC_003424.3 siepin homolog 3466274 2543056 SPAC3A11.04 Schizosaccharomyces pombe 972h- siepin homolog NP_594199.1 3465309 R 284812 CDS SPAC3A11.03 19115112 2543210 join(3466462..3466483,3466772..3467493) 1 NC_003424.3 orthology inference via Ashbya syntenic ortholog of YJR129C; methyltransferase (predicted) 3467493 2543210 SPAC3A11.03 Schizosaccharomyces pombe 972h- methyltransferase (predicted) NP_594200.1 3466462 D 284812 CDS SPAC3A11.02 19115113 2543054 complement(join(3468197..3469845,3469904..3470006)) 1 NC_003424.3 zinc finger protein Cps3 3470006 cps3 2543054 cps3 Schizosaccharomyces pombe 972h- zinc finger protein Cps3 NP_594201.1 3468197 R 284812 CDS SPAC328.01c 63054601 2542592 complement(join(3471020..3474631,3474715..3474807)) 1 NC_003424.3 karyopherin 3474807 2542592 SPAC328.01c Schizosaccharomyces pombe 972h- karyopherin NP_594202.2 3471020 R 284812 CDS SPAC328.02 19115116 2543148 3475561..3477075 1 NC_003424.3 human Ariadne homolog 3477075 2543148 SPAC328.02 Schizosaccharomyces pombe 972h- human Ariadne homolog NP_594204.1 3475561 D 284812 CDS SPAC328.03 19115117 2542660 3479314..3480855 1 NC_003424.3 alpha,alpha-trehalose-phosphate synthase [UDP-forming] 3480855 tps1 2542660 tps1 Schizosaccharomyces pombe 972h- alpha,alpha-trehalose-phosphate synthase [UDP-forming] NP_594205.1 3479314 D 284812 CDS SPAC328.04 19115118 2543208 3481909..3484134 1 NC_003424.3 AAA family ATPase, unknown biological role 3484134 2543208 SPAC328.04 Schizosaccharomyces pombe 972h- AAA family ATPase, unknown biological role NP_594206.1 3481909 D 284812 CDS SPAC328.05 295443018 2542567 join(3484695..3484698,3484752..3485065,3485241..3485342,3485382..3485528,3485582..3485974,3486056..3486502) 1 NC_003424.3 RNA-binding protein involved in export of mRNAs 3486502 2542567 SPAC328.05 Schizosaccharomyces pombe 972h- RNA-binding protein involved in export of mRNAs NP_594207.2 3484695 D 284812 CDS SPAC328.06 19115120 2542059 join(3487325..3490684,3490769..3490834) 1 NC_003424.3 ubiquitin C-terminal hydrolase Ubp2 3490834 ubp2 2542059 ubp2 Schizosaccharomyces pombe 972h- ubiquitin C-terminal hydrolase Ubp2 NP_594208.1 3487325 D 284812 CDS SPAC328.07c 19115121 2543206 complement(join(3491583..3492398,3492467..3492484)) 1 NC_003424.3 heavy metal ion homeostasis protein (predicted) 3492484 2543206 SPAC328.07c Schizosaccharomyces pombe 972h- heavy metal ion homeostasis protein (predicted) NP_594209.1 3491583 R 284812 CDS SPAC328.08c 19115122 2543188 complement(join(3493092..3493274,3493506..3494071,3494153..3494183)) 1 NC_003424.3 tubulin specific chaperone cofactor C (predicted) 3494183 2543188 SPAC328.08c Schizosaccharomyces pombe 972h- tubulin specific chaperone cofactor C (predicted) NP_594210.1 3493092 R 284812 CDS SPAC328.09 19115123 2543171 join(3494710..3494775,3495047..3495877) 1 NC_003424.3 mitochondrial 2-oxoadipate and 2-oxoglutarate transporter (predicted) 3495877 2543171 SPAC328.09 Schizosaccharomyces pombe 972h- mitochondrial 2-oxoadipate and 2-oxoglutarate transporter (predicted) NP_594211.1 3494710 D 284812 CDS SPAC328.10c 19115124 2541712 complement(join(3496487..3496988,3497277..3497386)) 1 NC_003424.3 40S ribosomal protein S5 3497386 rps502 2541712 rps502 Schizosaccharomyces pombe 972h- 40S ribosomal protein S5 NP_594212.1 3496487 R 284812 CDS SPAC16E8.01 19115125 2542338 join(3499049..3499282,3499429..3503457) 1 NC_003424.3 cytoskeletal protein binding protein Sla1 family, Shd1 (predicted) 3503457 shd1 2542338 shd1 Schizosaccharomyces pombe 972h- cytoskeletal protein binding protein Sla1 family, Shd1 (predicted) NP_594213.1 3499049 D 284812 CDS SPAC16E8.02 19115126 2542322 join(3504261..3504269,3504311..3504377,3504422..3505014) 1 NC_003424.3 DUF962 family protein 3505014 2542322 SPAC16E8.02 Schizosaccharomyces pombe 972h- DUF962 family protein NP_594214.1 3504261 D 284812 CDS SPAC16E8.03 19115127 2542332 join(3505144..3505209,3505311..3505580) 1 NC_003424.3 glucosamine-phosphate N-acetyltransferase 3505580 gna1 2542332 gna1 Schizosaccharomyces pombe 972h- glucosamine-phosphate N-acetyltransferase NP_594215.1 3505144 D 284812 CDS SPAC16E8.04c 19115128 2542334 complement(join(3506031..3506093,3506153..3506845)) 1 NC_003424.3 chorismate mutase (predicted) 3506845 2542334 SPAC16E8.04c Schizosaccharomyces pombe 972h- chorismate mutase (predicted) NP_594216.1 3506031 R 284812 CDS SPAC16E8.05c 19115129 2542324 complement(join(3507605..3508050,3508094..3508277)) 1 NC_003424.3 sequence orphan 3508277 mde1 2542324 mde1 Schizosaccharomyces pombe 972h- sequence orphan NP_594217.1 3507605 R 284812 CDS SPAC16E8.06c 19115130 2542314 complement(join(3508646..3509854,3509900..3510007)) 1 NC_003424.3 RNA-binding protein Nop12 3510007 nop12 2542314 nop12 Schizosaccharomyces pombe 972h- RNA-binding protein Nop12 NP_594218.1 3508646 R 284812 CDS SPAC16E8.07c 19115131 2542310 complement(join(3510419..3512794,3512848..3512889)) 1 NC_003424.3 V-type ATPase subunit a 3512889 vph1 2542310 vph1 Schizosaccharomyces pombe 972h- V-type ATPase subunit a NP_594219.1 3510419 R 284812 CDS SPAC16E8.08 19115132 2542328 join(3514029..3514130,3514187..3514894) 1 NC_003424.3 sequence orphan 3514894 2542328 SPAC16E8.08 Schizosaccharomyces pombe 972h- sequence orphan NP_594220.1 3514029 D 284812 CDS SPAC16E8.09 19115133 2542337 join(3515830..3515854,3515933..3518526) 1 NC_003424.3 RhoGEF Scd1 3518526 scd1 2542337 scd1 Schizosaccharomyces pombe 972h- RhoGEF Scd1 NP_594221.1 3515830 D 284812 CDS SPAC16E8.10c 63054602 2542330 complement(join(3518894..3519139,3519227..3519760)) 1 NC_003424.3 extended to include potential mitochondrial signal peptide 11-08-04; mitochondrial ribosomal protein subunit S7 3519760 2542330 SPAC16E8.10c Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit S7 NP_594222.2 3518894 R 284812 CDS SPAC16E8.11c 19115135 2542336 complement(join(3520542..3520619,3520663..3521206,3521264..3521447,3521493..3522120)) 1 NC_003424.3 transcription factor TFIIH complex subunit Tfb1 3522120 tfb1 2542336 tfb1 Schizosaccharomyces pombe 972h- transcription factor TFIIH complex subunit Tfb1 NP_594223.1 3520542 R 284812 CDS SPAC16E8.18 19115136 2542343 complement(3522650..3522973) 1 NC_003424.3 previously annotated as dubious, but has localization signal; sequence orphan 3522973 2542343 SPAC16E8.18 Schizosaccharomyces pombe 972h- sequence orphan NP_594224.1 3522650 R 284812 CDS SPAC16E8.12c 295443020 2542335 complement(join(3523136..3523644,3523925..3523996,3524044..3524098)) 1 NC_003424.3 sequence orphan 3524098 2542335 SPAC16E8.12c Schizosaccharomyces pombe 972h- sequence orphan NP_594225.2 3523136 R 284812 CDS SPAC16E8.13 19115138 2542333 3525304..3526947 1 NC_003424.3 ubiquitin-protein ligase E3 (predicted) 3526947 2542333 SPAC16E8.13 Schizosaccharomyces pombe 972h- ubiquitin-protein ligase E3 (predicted) NP_594226.1 3525304 D 284812 CDS SPAC16E8.14c 19115139 2542340 complement(join(3527156..3527341,3527384..3527493,3527595..3527862,3528009..3528069,3528107..3528141)) 1 NC_003424.3 methyltransferase implicated in translation (predicted) 3528141 2542340 SPAC16E8.14c Schizosaccharomyces pombe 972h- methyltransferase implicated in translation (predicted) NP_594227.1 3527156 R 284812 CDS SPAC16E8.15 19115140 2541706 join(3528159..3528385,3528454..3528628,3528763..3529017) 1 NC_003424.3 translation initiation factor eIF4E, 4F complex subunit 3529017 tif45 2541706 tif45 Schizosaccharomyces pombe 972h- translation initiation factor eIF4E, 4F complex subunit NP_594228.1 3528159 D 284812 CDS SPAC16E8.16 19115141 2542339 join(3530337..3530470,3530615..3531503) 1 NC_003424.3 transcription factor TFIIB 3531503 2542339 SPAC16E8.16 Schizosaccharomyces pombe 972h- transcription factor TFIIB NP_594229.1 3530337 D 284812 CDS SPAC16E8.17c 19115142 2542341 complement(3532418..3533413) 1 NC_003424.3 due to inconsistencies between the annotation of the proposed S. cerevisiae ortholog LSC1 in SWISSPROT:P53598 and SGD:S0005668 succinate-CoA ligase (GDP-forming)/6.2.1.4 and succinate-CoA ligase (ADP-forming) repectively, conservatively annotated to EC 6.2.1.- and GO:0004774, succinate-CoA ligase activity; succinate-CoA ligase alpha subunit 3533413 2542341 SPAC16E8.17c Schizosaccharomyces pombe 972h- succinate-CoA ligase alpha subunit NP_594230.1 3532418 R 284812 CDS SPAC1B1.01 19115143 2542539 join(3536627..3537788,3537985..3538259) 1 NC_003424.3 transcription factor Rdp1 3538259 2542539 SPAC1B1.01 Schizosaccharomyces pombe 972h- transcription factor Rdp1 NP_594231.1 3536627 D 284812 CDS SPAC1B1.02c 19115144 2542533 complement(3539025..3540638) 1 NC_003424.3 NAD/NADH kinase (predicted) 3540638 2542533 SPAC1B1.02c Schizosaccharomyces pombe 972h- NAD/NADH kinase (predicted) NP_594232.1 3539025 R 284812 CDS SPAC1B1.03c 19115145 2542496 complement(3541490..3544081) 1 NC_003424.3 karyopherin Kap95 3544081 kap95 2542496 kap95 Schizosaccharomyces pombe 972h- karyopherin Kap95 NP_594233.1 3541490 R 284812 CDS SPAC1B1.04c 19115146 2542552 complement(join(3544813..3544920,3544971..3545250,3545315..3546741)) 1 NC_003424.3 poly(A)-specific ribonuclease complex subunit Pan3 (predicted) 3546741 2542552 SPAC1B1.04c Schizosaccharomyces pombe 972h- poly(A)-specific ribonuclease complex subunit Pan3 (predicted) NP_594234.1 3544813 R 284812 CDS SPAC17A2.01 162312488 3361460 3550152..3551732 1 NC_003424.3 high-affinity import carrier for pyridoxine, pyridoxal, and pyridoxamine Bsu1 3551732 bsu1 3361460 bsu1 Schizosaccharomyces pombe 972h- high-affinity import carrier for pyridoxine, pyridoxal, and pyridoxamine Bsu1 XP_001713084.1 3550152 D 284812 CDS SPAC17A2.02c 19115148 2542376 complement(3552867..3553739) 1 NC_003424.3 DUF887 family protein 3553739 2542376 SPAC17A2.02c Schizosaccharomyces pombe 972h- DUF887 family protein NP_594236.1 3552867 R 284812 CDS SPAC17A2.03c 19115149 2542384 complement(join(3555271..3556282,3556326..3556345)) 1 NC_003424.3 V-type ATPase subunit d 3556345 vma6 2542384 vma6 Schizosaccharomyces pombe 972h- V-type ATPase subunit d NP_594237.1 3555271 R 284812 CDS SPAC17A2.04c 19115150 2542172 complement(3557047..3558123) 1 NC_003424.3 HSP chaperone complex subunit (predicted) 3558123 2542172 SPAC17A2.04c Schizosaccharomyces pombe 972h- HSP chaperone complex subunit (predicted) NP_594238.1 3557047 R 284812 CDS SPAC17A2.05 19115151 2542206 join(3560731..3560941,3561257..3562587) 1 NC_003424.3 fumerate reductase 3562587 osm1 2542206 osm1 Schizosaccharomyces pombe 972h- fumerate reductase NP_594239.1 3560731 D 284812 CDS SPAC17A2.06c 19115152 2542136 complement(3563011..3566829) 1 NC_003424.3 WD repeat protein Vps8 3566829 vps8 2542136 vps8 Schizosaccharomyces pombe 972h- WD repeat protein Vps8 NP_594240.1 3563011 R 284812 CDS SPAC17A2.07c 19115153 2542282 complement(join(3567223..3567638,3567741..3567858)) 1 NC_003424.3 sequence orphan 3567858 2542282 SPAC17A2.07c Schizosaccharomyces pombe 972h- sequence orphan NP_594241.1 3567223 R 284812 CDS SPAC17A2.08c 19115154 2542263 complement(3568267..3569079) 1 NC_003424.3 sequence orphan 3569079 2542263 SPAC17A2.08c Schizosaccharomyces pombe 972h- sequence orphan NP_594242.1 3568267 R 284812 CDS SPAC17A2.15 162312490 5802916 join(3569155..3569235,3569383..3569511) 1 NC_003424.3 dubious 3569511 5802916 SPAC17A2.15 Schizosaccharomyces pombe 972h- dubious XP_001713085.1 3569155 D 284812 CDS SPAC17A2.09c 19115155 2542151 complement(3570447..3572345) 1 NC_003424.3 RNA-binding protein Csx1 3572345 csx1 2542151 csx1 Schizosaccharomyces pombe 972h- RNA-binding protein Csx1 NP_594243.1 3570447 R 284812 CDS SPAC17A2.10c 19115156 2542210 complement(3574995..3575687) 1 NC_003424.3 previously annotated as dubious, but has localization signal; largish ORF in compositionally biased region, probably not real. has odd translation. this is in region where botton strand is T rich, so lots of LLLFFFFLLFFLSFSFSFS; see comment on SPAC17A2.11, this region is the same but inverted orientation; sequence orphan 3575687 2542210 SPAC17A2.10c Schizosaccharomyces pombe 972h- sequence orphan NP_594244.1 3574995 R 284812 CDS SPAC17A2.11 19115157 2542117 3577109..3577762 1 NC_003424.3 previously annotated as dubious, but has localization signal; see comment on SPAC17A2.10, this region is the same but inverted orientation; largish ORF in compositionally biased region, probably not real. has odd translation. this is in region where botton strand is T rich, so lots of LLLFFFFLLFFLSFSFSFS; sequence orphan 3577762 2542117 SPAC17A2.11 Schizosaccharomyces pombe 972h- sequence orphan NP_594245.1 3577109 D 284812 CDS SPAC17A2.12 19115158 2542440 3580223..3582916 1 NC_003424.3 ATP-dependent DNA helicase (predicted) 3582916 2542440 SPAC17A2.12 Schizosaccharomyces pombe 972h- ATP-dependent DNA helicase (predicted) NP_594246.1 3580223 D 284812 CDS SPAC17A2.13c 19115159 2542252 complement(join(3583250..3583995,3584713..3584779)) 1 NC_003424.3 NOT transcription initiation factor TFIIH subunit-?; 14-3-3 protein Rad25 3584779 rad25 2542252 rad25 Schizosaccharomyces pombe 972h- 14-3-3 protein Rad25 NP_594247.1 3583250 R 284812 CDS SPAC17A2.14 162312492 5802917 3586435..3588288 1 NC_003424.3 CorA family magnesium ion transporter 3588288 5802917 SPAC17A2.14 Schizosaccharomyces pombe 972h- CorA family magnesium ion transporter XP_001713086.1 3586435 D 284812 CDS SPAC17G6.02c 19115161 2542288 complement(3588975..3589949) 1 NC_003424.3 WARNING: in the current viewer tco1 gene is hidden behind SPNCRNA.600 non coding transcript, to see the feature please use the Artemis or Gbrowse links; RTA1-like protein 3589949 tco1 2542288 tco1 Schizosaccharomyces pombe 972h- RTA1-like protein NP_594249.1 3588975 R 284812 CDS SPAC17G6.03 19115162 2542289 3593055..3594962 1 NC_003424.3 phosphoprotein phosphatase (predicted) 3594962 2542289 SPAC17G6.03 Schizosaccharomyces pombe 972h- phosphoprotein phosphatase (predicted) NP_594250.1 3593055 D 284812 CDS SPAC17G6.04c 19115163 2542380 complement(3595197..3596345) 1 NC_003424.3 protein farnesyltransferase beta subunit Cpp1 3596345 cpp1 2542380 cpp1 Schizosaccharomyces pombe 972h- protein farnesyltransferase beta subunit Cpp1 NP_594251.1 3595197 R 284812 CDS SPAC17G6.05c 19115164 2542419 complement(3596472..3598799) 1 NC_003424.3 Rhophilin-2 homolog 3598799 2542419 SPAC17G6.05c Schizosaccharomyces pombe 972h- Rhophilin-2 homolog NP_594252.1 3596472 R 284812 CDS SPAC17G6.06 19115165 2542430 join(3599103..3599171,3599241..3599576) 1 NC_003424.3 40S ribosomal protein S24 3599576 rps2401 2542430 rps2401 Schizosaccharomyces pombe 972h- 40S ribosomal protein S24 NP_594253.1 3599103 D 284812 CDS SPAC17G6.07c 19115166 2542397 complement(3600187..3600855) 1 NC_003424.3 SNARE Slt1 (predicted) 3600855 2542397 SPAC17G6.07c Schizosaccharomyces pombe 972h- SNARE Slt1 (predicted) NP_594254.1 3600187 R 284812 CDS SPAC17G6.08 19115167 2542423 3601879..3603489 1 NC_003424.3 prevacuole/endosomal FYVE tethering component Pep7 (predicted) 3603489 pep7 2542423 pep7 Schizosaccharomyces pombe 972h- prevacuole/endosomal FYVE tethering component Pep7 (predicted) NP_594255.1 3601879 D 284812 CDS SPAC17G6.09 19115168 2542396 3604092..3604913 1 NC_003424.3 ER protein translocation subcomplex subunit Sec62 (predicted) 3604913 sec62 2542396 sec62 Schizosaccharomyces pombe 972h- ER protein translocation subcomplex subunit Sec62 (predicted) NP_594256.1 3604092 D 284812 CDS SPAC17G6.10 19115169 2542400 3605798..3607381 1 NC_003424.3 SWI/SNF and RSC complex subunit Ssr1 3607381 ssr1 2542400 ssr1 Schizosaccharomyces pombe 972h- SWI/SNF and RSC complex subunit Ssr1 NP_594257.1 3605798 D 284812 CDS SPAC17G6.11c 19115170 2542171 complement(3607829..3609739) 1 NC_003424.3 glucosidase (predicted) 3609739 2542171 SPAC17G6.11c Schizosaccharomyces pombe 972h- glucosidase (predicted) NP_594258.1 3607829 R 284812 CDS SPAC17G6.12 19115171 2542393 join(3612124..3612191,3612237..3612323,3612422..3612486,3612598..3612674,3612877..3614883) 1 NC_003424.3 cullin 1 3614883 cul1 2542393 cul1 Schizosaccharomyces pombe 972h- cullin 1 NP_594259.1 3612124 D 284812 CDS SPAC17G6.13 19115172 2542443 3615626..3616927 1 NC_003424.3 sequence orphan 3616927 2542443 SPAC17G6.13 Schizosaccharomyces pombe 972h- sequence orphan NP_594260.1 3615626 D 284812 CDS SPAC17G6.14c 19115173 2542433 complement(3617541..3618845) 1 NC_003424.3 ATP-dependent RNA helicase Uap56 3618845 uap56 2542433 uap56 Schizosaccharomyces pombe 972h- ATP-dependent RNA helicase Uap56 NP_594261.1 3617541 R 284812 CDS SPAC17G6.15c 19115174 2542199 complement(join(3619344..3619703,3619808..3620143,3620184..3620257,3620371..3620480,3620529..3620626)) 1 NC_003424.3 MTC tricarboxylate transporter 3620626 2542199 SPAC17G6.15c Schizosaccharomyces pombe 972h- MTC tricarboxylate transporter NP_594262.1 3619344 R 284812 CDS SPAC17G6.16c 19115175 2542258 complement(join(3621007..3621470,3621514..3622060,3622105..3623005,3623047..3623175,3623309..3623406,3623456..3623644)) 1 NC_003424.3 mRNA cleavage and polyadenylation specificity factor complex subunit Ysh1 3623644 ysh1 2542258 ysh1 Schizosaccharomyces pombe 972h- mRNA cleavage and polyadenylation specificity factor complex subunit Ysh1 NP_594263.1 3621007 R 284812 CDS SPAC17G6.17 19115176 2542194 3623869..3625077 1 NC_003424.3 Pof8 F-box is very degenerate, but is detectable by sequence similarty and confirmed by Skp1 binding assay PMID:15147268; F-box protein Pof8 3625077 pof8 2542194 pof8 Schizosaccharomyces pombe 972h- F-box protein Pof8 NP_594264.1 3623869 D 284812 CDS SPAC1142.01 295443022 2542197 3625574..3627544 1 NC_003424.3 DUF654 family protein 3627544 2542197 SPAC1142.01 Schizosaccharomyces pombe 972h- DUF654 family protein NP_594265.2 3625574 D 284812 CDS SPAC1142.02c 162312494 2542401 complement(join(3627845..3628074,3628123..3628743,3628784..3628886)) 1 NC_003424.3 TPR repeat protein, SGT family 3628886 2542401 SPAC1142.02c Schizosaccharomyces pombe 972h- TPR repeat protein, SGT family XP_001713087.1 3627845 R 284812 CDS SPAC1142.03c 68000325 3361456 complement(3629173..3631341) 1 NC_003424.3 Swi5 complex subunit Swi2 3631341 swi2 3361456 swi2 Schizosaccharomyces pombe 972h- Swi5 complex subunit Swi2 NP_001018264.1 3629173 R 284812 CDS SPAC1142.04 19115180 2542666 3631536..3633659 1 NC_003424.3 Noc complex subunit Noc2 family (predicted) 3633659 2542666 SPAC1142.04 Schizosaccharomyces pombe 972h- Noc complex subunit Noc2 family (predicted) NP_594268.1 3631536 D 284812 CDS SPAC1142.05 19115181 2542949 3635765..3636286 1 NC_003424.3 copper transporter complex subunit Ctr5 (predicted) 3636286 ctr5 2542949 ctr5 Schizosaccharomyces pombe 972h- copper transporter complex subunit Ctr5 (predicted) NP_594269.1 3635765 D 284812 CDS SPAC1142.06 19115182 2542928 3637102..3638091 1 NC_003424.3 GET complex ATPase subunit Get3 (predicted) 3638091 get3 2542928 get3 Schizosaccharomyces pombe 972h- GET complex ATPase subunit Get3 (predicted) NP_594270.1 3637102 D 284812 CDS SPAC1142.07c 19115183 2542922 complement(join(3638771..3639264,3639386..3639560)) 1 NC_003424.3 vacuolar sorting protein Vps32 3639560 vps32 2542922 vps32 Schizosaccharomyces pombe 972h- vacuolar sorting protein Vps32 NP_594271.1 3638771 R 284812 CDS SPAC1142.08 19115184 2541552 3639988..3642219 1 NC_003424.3 similarity pers. comm. Richard Bulmer; fork head transcription factor Fhl1 3642219 fhl1 2541552 fhl1 Schizosaccharomyces pombe 972h- fork head transcription factor Fhl1 NP_594272.1 3639988 D 284812 CDS SPAC1142.09 63054606 2543033 3642498..3642845 1 NC_003424.3 dubious 3642845 2543033 SPAC1142.09 Schizosaccharomyces pombe 972h- dubious NP_594273.2 3642498 D 284812 CDS SPAC8C9.03 19115186 2543351 join(3643239..3643368,3643634..3644742) 1 NC_003424.3 cAMP-dependent protein kinase regulatory subunit Cgs1 3644742 cgs1 2543351 cgs1 Schizosaccharomyces pombe 972h- cAMP-dependent protein kinase regulatory subunit Cgs1 NP_594274.1 3643239 D 284812 CDS SPAC8C9.04 19115187 2543236 3646275..3648218 1 NC_003424.3 sequence orphan 3648218 2543236 SPAC8C9.04 Schizosaccharomyces pombe 972h- sequence orphan NP_594275.1 3646275 D 284812 CDS SPAC8C9.05 19115188 2543253 join(3649559..3649601,3649716..3649749,3649799..3649827,3649939..3650058,3650117..3650260,3650338..3650341,3650390..3650465) 1 NC_003424.3 D-Tyr-tRNA deacylase (predicted) 3650465 2543253 SPAC8C9.05 Schizosaccharomyces pombe 972h- D-Tyr-tRNA deacylase (predicted) NP_594276.1 3649559 D 284812 CDS SPAC8C9.06c 19115189 2543312 complement(3650640..3653435) 1 NC_003424.3 this homology was assigned from recipriocal blast hits; mitochondrial translation regulator (predicted) 3653435 2543312 SPAC8C9.06c Schizosaccharomyces pombe 972h- mitochondrial translation regulator (predicted) NP_594277.1 3650640 R 284812 CDS SPAC8C9.07 19115190 2543022 3654280..3654714 1 NC_003424.3 previously annotated as dubious; rRNA processing protein Fyv7 (predicted) 3654714 2543022 SPAC8C9.07 Schizosaccharomyces pombe 972h- rRNA processing protein Fyv7 (predicted) NP_594278.1 3654280 D 284812 CDS SPAC8C9.08 19115191 2542939 join(3655144..3655253,3655470..3655971) 1 NC_003424.3 40S ribosomal protein S5 3655971 rps5 2542939 rps5 Schizosaccharomyces pombe 972h- 40S ribosomal protein S5 NP_594279.1 3655144 D 284812 CDS SPAC8C9.09c 19115192 2542860 complement(3656449..3657357) 1 NC_003424.3 sequence orphan 3657357 mug129 2542860 mug129 Schizosaccharomyces pombe 972h- sequence orphan NP_594280.1 3656449 R 284812 CDS SPAC8C9.10c 19115193 2542305 complement(join(3658467..3658832,3658878..3658961,3659007..3659021)) 1 NC_003424.3 ribosome biogenesis protein Rrp14-N 3659021 2542305 SPAC8C9.10c Schizosaccharomyces pombe 972h- ribosome biogenesis protein Rrp14-N NP_594281.1 3658467 R 284812 CDS SPAC8C9.11 19115194 2542160 join(3659132..3659191,3659271..3659453) 1 NC_003424.3 BolA domain protein 3659453 2542160 SPAC8C9.11 Schizosaccharomyces pombe 972h- BolA domain protein NP_594282.1 3659132 D 284812 CDS SPAC8C9.19 295443024 5802920 join(3660430..3660438,3660491..3660556,3660607..3660717) 1 NC_003424.3 conserved fungal protein 3660717 5802920 SPAC8C9.19 Schizosaccharomyces pombe 972h- conserved fungal protein XP_001713088.2 3660430 D 284812 CDS SPAC8C9.12c 19115195 2542566 complement(3661488..3662399) 1 NC_003424.3 mitochondrial iron ion transporter (predicted) 3662399 2542566 SPAC8C9.12c Schizosaccharomyces pombe 972h- mitochondrial iron ion transporter (predicted) NP_594283.1 3661488 R 284812 CDS SPAC8C9.14 19115196 2541756 join(3666007..3666036,3666134..3666223,3666980..3667059,3667113..3667170,3667314..3668675) 1 NC_003424.3 transcription factor Prr1 3668675 prr1 2541756 prr1 Schizosaccharomyces pombe 972h- transcription factor Prr1 NP_594284.1 3666007 D 284812 CDS SPAC8C9.15c 19115197 2542017 complement(join(3669305..3671096,3671166..3671290,3671334..3671395,3671440..3671497)) 1 NC_003424.3 translation initiation factor eIF2B epsilon subunit 3671497 tif225 2542017 tif225 Schizosaccharomyces pombe 972h- translation initiation factor eIF2B epsilon subunit NP_594285.1 3669305 R 284812 CDS SPAC8C9.16c 19115198 2541938 complement(3672533..3673099) 1 NC_003424.3 TLDc domain protein 1 3673099 mug63 2541938 mug63 Schizosaccharomyces pombe 972h- TLDc domain protein 1 NP_594286.1 3672533 R 284812 CDS SPAC8C9.17c 19115199 2542102 complement(3674300..3674794) 1 NC_003424.3 DASH complex subunit Spc34 3674794 spc34 2542102 spc34 Schizosaccharomyces pombe 972h- DASH complex subunit Spc34 NP_594287.1 3674300 R 284812 CDS SPAC15A10.01 63054607 2542779 3675526..3677607 1 NC_003424.3 probably regulates cellular iron homeostasis through the transport of mitochondrially synthesised Fe/S clusters (PMID:11493598); ABC family iron transporter Atm1 3677607 atm1 2542779 atm1 Schizosaccharomyces pombe 972h- ABC family iron transporter Atm1 NP_594288.2 3675526 D 284812 CDS SPAC15A10.02 19115201 2542785 3678085..3679437 1 NC_003424.3 transcription factor TFIID complex subunit A/ SAGA complex subunit (predicted) 3679437 taf12 2542785 taf12 Schizosaccharomyces pombe 972h- transcription factor TFIID complex subunit A/ SAGA complex subunit (predicted) NP_594289.1 3678085 D 284812 CDS SPAC15A10.03c 19115202 2542749 complement(3680587..3683145) 1 NC_003424.3 Rad54 homolog Rhp54 3683145 rhp54 2542749 rhp54 Schizosaccharomyces pombe 972h- Rad54 homolog Rhp54 NP_594290.1 3680587 R 284812 CDS SPAC15A10.04c 19115203 2542778 complement(3683722..3685101) 1 NC_003424.3 EF-1 alpha binding zinc finger protein Zpr1 (predicted) 3685101 zpr1 2542778 zpr1 Schizosaccharomyces pombe 972h- EF-1 alpha binding zinc finger protein Zpr1 (predicted) NP_594291.1 3683722 R 284812 CDS SPAC15A10.05c 19115204 2542742 complement(join(3685760..3685989,3686074..3686489,3686530..3686600,3686710..3686721)) 1 NC_003424.3 YjeF family protein 3686721 mug182 2542742 mug182 Schizosaccharomyces pombe 972h- YjeF family protein NP_594292.1 3685760 R 284812 CDS SPAC15A10.06 19115205 2542747 join(3689230..3689260,3689322..3689638,3689722..3690441,3690484..3691125) 1 NC_003424.3 CPA1 sodium ion/proton antiporter 3691125 2542747 SPAC15A10.06 Schizosaccharomyces pombe 972h- CPA1 sodium ion/proton antiporter NP_594293.1 3689230 D 284812 CDS SPAC15A10.07 19115206 2542786 3691307..3691879 1 NC_003424.3 sequence orphan 3691879 2542786 SPAC15A10.07 Schizosaccharomyces pombe 972h- sequence orphan NP_594294.1 3691307 D 284812 CDS SPAC15A10.08 19115207 2542805 join(3692835..3692884,3692936..3693162,3693303..3694891) 1 NC_003424.3 alpha-actinin 3694891 ain1 2542805 ain1 Schizosaccharomyces pombe 972h- alpha-actinin NP_594295.1 3692835 D 284812 CDS SPAC15A10.09c 19115208 2542748 complement(3695162..3696028) 1 NC_003424.3 this is not in the current release of Pfam, but should be built into SUR7 family shortly; SUR7 family protein 3696028 2542748 SPAC15A10.09c Schizosaccharomyces pombe 972h- SUR7 family protein NP_594296.1 3695162 R 284812 CDS SPAC15A10.10 295443026 2542769 join(3697508..3697752,3697795..3698368,3698421..3698527,3698570..3699310,3699359..3699538,3699582..3699837) 1 NC_003424.3 Muskelin homolog 3699837 mde6 2542769 mde6 Schizosaccharomyces pombe 972h- Muskelin homolog NP_594297.2 3697508 D 284812 CDS SPAC15A10.11 19115210 2542809 3702795..3708953 1 NC_003424.3 N-end-recognizing protein (predicted) 3708953 ubr11 2542809 ubr11 Schizosaccharomyces pombe 972h- N-end-recognizing protein (predicted) NP_594298.1 3702795 D 284812 CDS SPAC15A10.12c 295443028 2542766 complement(join(3709206..3709346,3709499..3709804)) 1 NC_003424.3 TRAPP complex subunit subunit2-like (predicted) 3709804 2542766 SPAC15A10.12c Schizosaccharomyces pombe 972h- TRAPP complex subunit subunit2-like (predicted) NP_594299.2 3709206 R 284812 CDS SPAC15A10.13 19115212 2542741 join(3711546..3711671,3711721..3711861,3711913..3712014,3712067..3712927,3712968..3713096,3713147..3713319,3713379..3713760) 1 NC_003424.3 aminotransferase for S. cerevisiae YOR112W looks like a false positive. see Pfam for correct inference; serine/threonine protein kinase Ppk3 3713760 ppk3 2542741 ppk3 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Ppk3 NP_594300.1 3711546 D 284812 CDS SPAC15A10.15 19115213 2542788 join(3714187..3714223,3714262..3714301,3714352..3714584,3714628..3714695,3714748..3716313) 1 NC_003424.3 ShuGOshin 2 (Japanese meaning guardian spirit); shugoshin Sgo2 3716313 sgo2 2542788 sgo2 Schizosaccharomyces pombe 972h- shugoshin Sgo2 NP_594301.1 3714187 D 284812 CDS SPAC15A10.16 63054608 2542756 3716806..3720963 1 NC_003424.3 localization depends on vesicular traffic and and requires Tea1; actin interacting protein 3 homolog Bud6 3720963 bud6 2542756 bud6 Schizosaccharomyces pombe 972h- actin interacting protein 3 homolog Bud6 NP_594302.2 3716806 D 284812 CDS SPAC15E1.02c 19115215 2542758 complement(3721310..3721756) 1 NC_003424.3 DUF1761 family protein 3721756 2542758 SPAC15E1.02c Schizosaccharomyces pombe 972h- DUF1761 family protein NP_594303.1 3721310 R 284812 CDS SPAC15E1.03 19115216 2542789 join(3722509..3722808,3722999..3723019) 1 NC_003424.3 60S ribosomal protein L36/L42 3723019 rpl42 2542789 rpl42 Schizosaccharomyces pombe 972h- 60S ribosomal protein L36/L42 NP_594304.1 3722509 D 284812 CDS SPAC15E1.04 19115217 2542801 3723833..3725710 1 NC_003424.3 SPAC15E1.04 is similar to YOR074 at the C-term, but has an N-terminal flavoprotein domain; thymidylate synthase (predicted) 3725710 2542801 SPAC15E1.04 Schizosaccharomyces pombe 972h- thymidylate synthase (predicted) NP_594305.1 3723833 D 284812 CDS SPAC15E1.05c 19115218 2542775 complement(join(3725922..3726952,3727008..3727074)) 1 NC_003424.3 ethanolamine-phosphate cytidylyltransferase (predicted) 3727074 2542775 SPAC15E1.05c Schizosaccharomyces pombe 972h- ethanolamine-phosphate cytidylyltransferase (predicted) NP_594306.1 3725922 R 284812 CDS SPAC15E1.06 19115219 2542802 join(3727463..3727525,3727604..3728104) 1 NC_003424.3 retromer complex subunit Vps29 3728104 vps29 2542802 vps29 Schizosaccharomyces pombe 972h- retromer complex subunit Vps29 NP_594307.1 3727463 D 284812 CDS SPAC15E1.07c 19115220 2542808 complement(3728516..3729034) 1 NC_003424.3 meiotic cohesin complex associated protein Moa1 3729034 moa1 2542808 moa1 Schizosaccharomyces pombe 972h- meiotic cohesin complex associated protein Moa1 NP_594308.1 3728516 R 284812 CDS SPAC15E1.08 19115221 2542765 join(3729807..3729897,3729984..3730178,3730494..3730596,3730644..3730700,3730904..3730991) 1 NC_003424.3 NatA N-acetyltransferase complex subunit Ard1 (predicted) 3730991 2542765 SPAC15E1.08 Schizosaccharomyces pombe 972h- NatA N-acetyltransferase complex subunit Ard1 (predicted) NP_594309.1 3729807 D 284812 CDS SPAC15E1.09 19115222 2542807 join(3731271..3731424,3731672..3731692,3731740..3731808,3731893..3731981) 1 NC_003424.3 glutaredoxin Grx2 3731981 grx2 2542807 grx2 Schizosaccharomyces pombe 972h- glutaredoxin Grx2 NP_594310.1 3731271 D 284812 CDS SPAC15E1.10 63054609 2542764 3732443..3733240 1 NC_003424.3 PI31 proteasome regulator related 3733240 2542764 SPAC15E1.10 Schizosaccharomyces pombe 972h- PI31 proteasome regulator related NP_594311.2 3732443 D 284812 CDS SPAP7G5.02c 19115224 2542573 complement(join(3733737..3735276,3735477..3735517,3735561..3735599)) 1 NC_003424.3 inferred from genetic map position; GMP synthase [glutamine-hydrolyzing] (predicted) 3735599 gua2 2542573 gua2 Schizosaccharomyces pombe 972h- GMP synthase [glutamine-hydrolyzing] (predicted) NP_594312.1 3733737 R 284812 CDS SPAP7G5.03 19115225 2542800 join(3736955..3738464,3738505..3739106) 1 NC_003424.3 conjugation protein (predicted) 3739106 2542800 SPAP7G5.03 Schizosaccharomyces pombe 972h- conjugation protein (predicted) NP_594313.1 3736955 D 284812 CDS SPAP7G5.04c 19115226 2542079 complement(3739162..3743421) 1 NC_003424.3 aminoadipate-semialdehyde dehydrogenase 3743421 lys1 2542079 lys1 Schizosaccharomyces pombe 972h- aminoadipate-semialdehyde dehydrogenase NP_594314.1 3739162 R 284812 CDS SPAP7G5.05 19115227 2541678 3744164..3744829 1 NC_003424.3 60S ribosomal protein L10 3744829 rpl1002 2541678 rpl1002 Schizosaccharomyces pombe 972h- 60S ribosomal protein L10 NP_594315.1 3744164 D 284812 CDS SPAP7G5.06 19115228 2541596 3749695..3751446 1 NC_003424.3 amino acid permease, unknown 4 3751446 2541596 SPAP7G5.06 Schizosaccharomyces pombe 972h- amino acid permease, unknown 4 NP_594316.1 3749695 D 284812 CDS SPAP4C9.02 295443030 9407237 join(3790980..3791111,3791154..3791342) 1 NC_003424.3 conserved fungal protein 3791342 9407237 SPAP4C9.02 Schizosaccharomyces pombe 972h- conserved fungal protein XP_002742512.1 3790980 D 284812 CDS SPAC1556.01c 295443032 2541635 complement(join(3791831..3791851,3791891..3792229,3792267..3795557,3795601..3795684,3795734..3795856)) 1 NC_003424.3 DNA repair protein Rad50 3795856 rad50 2541635 rad50 Schizosaccharomyces pombe 972h- DNA repair protein Rad50 XP_001713090.2 3791831 R 284812 CDS SPAC1556.02c 19115231 2541690 complement(join(3796400..3798226,3798348..3798446)) 1 NC_003424.3 succinate dehydrogenase Sdh1 3798446 sdh1 2541690 sdh1 Schizosaccharomyces pombe 972h- succinate dehydrogenase Sdh1 NP_594319.1 3796400 R 284812 CDS SPAC1556.03 295443034 2541589 join(3799244..3799680,3799731..3800135,3800184..3800241) 1 NC_003424.3 serine/threonine protein phosphatase Azr1 3800241 azr1 2541589 azr1 Schizosaccharomyces pombe 972h- serine/threonine protein phosphatase Azr1 NP_594320.2 3799244 D 284812 CDS SPAC1556.04c 19115233 2541551 complement(join(3800313..3800351,3800393..3800471,3800535..3800617,3800686..3800747,3800800..3800938)) 1 NC_003424.3 care not azr1; cytidine deaminase Ccd1 3800938 cdd1 2541551 cdd1 Schizosaccharomyces pombe 972h- cytidine deaminase Ccd1 NP_594321.1 3800313 R 284812 CDS SPAC1556.05c 19115234 2541698 complement(join(3801248..3801391,3801442..3801589,3801634..3801643,3801684..3801717)) 1 NC_003424.3 second intron branch site deviates from consensus; CGR1 family 3801717 2541698 SPAC1556.05c Schizosaccharomyces pombe 972h- CGR1 family NP_594322.1 3801248 R 284812 CDS SPAC1556.06.1 162312502 5802927 join(3802551..3804587,3804661..3804954) 1 NC_003424.3 sequence orphan 3804954 meu1 5802927 meu1 Schizosaccharomyces pombe 972h- sequence orphan XP_001713091.1 3802551 D 284812 CDS SPAC1556.06.2 162312504 5802928 join(3804582..3804587,3804661..3804954) 1 NC_003424.3 sequence orphan 3804954 meu2 5802928 meu2 Schizosaccharomyces pombe 972h- sequence orphan XP_001713092.1 3804582 D 284812 CDS SPAC1556.07 19115237 2541674 join(3805844..3805930,3806163..3806849) 1 NC_003424.3 phosphomannomutase Pmm1 3806849 pmm1 2541674 pmm1 Schizosaccharomyces pombe 972h- phosphomannomutase Pmm1 NP_594325.1 3805844 D 284812 CDS SPAC1556.08c 162312506 5802929 complement(join(3807447..3807775,3807831..3807987,3808035..3808393,3808448..3808571,3808635..3808670)) 1 NC_003424.3 protein kinase activator (predicted) 3808670 cbs2 5802929 cbs2 Schizosaccharomyces pombe 972h- protein kinase activator (predicted) XP_001713093.1 3807447 R 284812 CDS SPAC1F12.02c 19115240 2542475 complement(3809528..3810034) 1 NC_003424.3 NAS from PMID:16806052, not yet curated at SGD; translationally controlled tumor protein homolog 3810034 p23fy 2542475 p23fy Schizosaccharomyces pombe 972h- translationally controlled tumor protein homolog NP_594328.1 3809528 R 284812 CDS SPAC1F12.03c 19115241 2542460 complement(join(3810367..3810458,3810639..3810660)) 1 NC_003424.3 dubious 3810660 2542460 SPAC1F12.03c Schizosaccharomyces pombe 972h- dubious NP_594329.1 3810367 R 284812 CDS SPAC1F12.04c 19115242 2542499 complement(3811066..3811641) 1 NC_003424.3 conserved fungal protein 3811641 2542499 SPAC1F12.04c Schizosaccharomyces pombe 972h- conserved fungal protein NP_594330.1 3811066 R 284812 CDS SPAC1F12.05 19115243 2542260 3813122..3814255 1 NC_003424.3 endocytosis regulator (predicted) 3814255 2542260 SPAC1F12.05 Schizosaccharomyces pombe 972h- endocytosis regulator (predicted) NP_594331.1 3813122 D 284812 CDS SPAC1F12.06c 19115244 2542434 complement(join(3814549..3814940,3815027..3815393)) 1 NC_003424.3 DNA repair endonuclease (predicted) 3815393 2542434 SPAC1F12.06c Schizosaccharomyces pombe 972h- DNA repair endonuclease (predicted) NP_594332.1 3814549 R 284812 CDS SPAC1F12.07 19115245 2542269 3815853..3817022 1 NC_003424.3 phosphoserine aminotransferase (predicted) 3817022 2542269 SPAC1F12.07 Schizosaccharomyces pombe 972h- phosphoserine aminotransferase (predicted) NP_594333.1 3815853 D 284812 CDS SPAC1F12.08 295443036 2541427 join(3817464..3817803,3817851..3817991,3818035..3818130,3818170..3818543) 1 NC_003424.3 splice prediction is tentative; cytidylyltransferase (predicted) 3818543 2541427 SPAC1F12.08 Schizosaccharomyces pombe 972h- cytidylyltransferase (predicted) NP_594334.2 3817464 D 284812 CDS SPAC1F12.09 19115247 2542284 join(3818668..3818907,3818954..3819677,3819720..3820420) 1 NC_003424.3 pig-S 3820420 gpi17 2542284 gpi17 Schizosaccharomyces pombe 972h- pig-S NP_594335.1 3818668 D 284812 CDS SPAC1F12.10c 19115248 2541641 complement(join(3820727..3820794,3820856..3821033,3821188..3821385)) 1 NC_003424.3 NADPH-hemoprotein reductase (predicted) 3821385 2541641 SPAC1F12.10c Schizosaccharomyces pombe 972h- NADPH-hemoprotein reductase (predicted) NP_594336.1 3820727 R 284812 CDS SPAC4H3.01 19115249 2543672 join(3822935..3823020,3823059..3823131,3823216..3823886,3823932..3824280) 1 NC_003424.3 DNAJ domain protein Caj1/Djp1 type 3824280 2543672 SPAC4H3.01 Schizosaccharomyces pombe 972h- DNAJ domain protein Caj1/Djp1 type NP_594337.1 3822935 D 284812 CDS SPAC4H3.02c 19115250 2543667 complement(join(3824487..3825495,3825553..3825719)) 1 NC_003424.3 Swr1 complex subunit Swc3 3825719 swc3 2543667 swc3 Schizosaccharomyces pombe 972h- Swr1 complex subunit Swc3 NP_594338.1 3824487 R 284812 CDS SPAC4H3.03c 19115251 2543652 complement(3826640..3828589) 1 NC_003424.3 glucan 1,4-alpha-glucosidase (predicted) 3828589 2543652 SPAC4H3.03c Schizosaccharomyces pombe 972h- glucan 1,4-alpha-glucosidase (predicted) NP_594339.1 3826640 R 284812 CDS SPAC4H3.04c 19115252 2543654 complement(join(3831070..3831683,3831775..3831956,3832016..3832149)) 1 NC_003424.3 in some organisms this domain is present with ammecr1 which interacts with mediator complex and is implicated in transcription; UPF0103 family 3832149 2543654 SPAC4H3.04c Schizosaccharomyces pombe 972h- UPF0103 family NP_594340.1 3831070 R 284812 CDS SPAC4H3.05 19115253 2543577 join(3832775..3833136,3833202..3833466,3833512..3833942,3833988..3835593) 1 NC_003424.3 ATP-dependent DNA helicase, UvrD subfamily 3835593 srs2 2543577 srs2 Schizosaccharomyces pombe 972h- ATP-dependent DNA helicase, UvrD subfamily NP_594341.1 3832775 D 284812 CDS SPAC4H3.06 162312508 2543582 join(3837449..3837519,3837568..3837751,3837811..3837890,3837940..3838000) 1 NC_003424.3 sequence orphan 3838000 2543582 SPAC4H3.06 Schizosaccharomyces pombe 972h- sequence orphan NP_594342.2 3837449 D 284812 CDS SPAC4H3.07c 19115255 2543423 complement(join(3838713..3838770,3838837..3839056,3839106..3839157,3839195..3839380)) 1 NC_003424.3 protein phosphatase Fmp31 (predicted) 3839380 2543423 SPAC4H3.07c Schizosaccharomyces pombe 972h- protein phosphatase Fmp31 (predicted) NP_594343.1 3838713 R 284812 CDS SPAC4H3.08 19115256 2543366 3841581..3842441 1 NC_003424.3 3-hydroxyacyl-CoA dehydrogenase (predicted) 3842441 2543366 SPAC4H3.08 Schizosaccharomyces pombe 972h- 3-hydroxyacyl-CoA dehydrogenase (predicted) NP_594344.1 3841581 D 284812 CDS SPAC4H3.09 19115257 2543562 join(3843416..3843577,3843766..3843934,3844015..3844022) 1 NC_003424.3 mitochondrial type II fatty acid synthase component 3844022 2543562 SPAC4H3.09 Schizosaccharomyces pombe 972h- mitochondrial type II fatty acid synthase component NP_594345.1 3843416 D 284812 CDS SPAC4H3.10c 19115258 2543557 complement(3845013..3846542) 1 NC_003424.3 pyruvate kinase (predicted) 3846542 pyk1 2543557 pyk1 Schizosaccharomyces pombe 972h- pyruvate kinase (predicted) NP_594346.1 3845013 R 284812 CDS SPAC4H3.11c 19115259 2543554 complement(3848133..3850484) 1 NC_003424.3 spindle pole body protein Ppc89 3850484 ppc89 2543554 ppc89 Schizosaccharomyces pombe 972h- spindle pole body protein Ppc89 NP_594347.1 3848133 R 284812 CDS SPAC4H3.12c 19115260 2543552 complement(3851914..3852219) 1 NC_003424.3 previously annotated as dubious, may not be protein coding; reverted to dubious based on transcriptome data 08-01-08; dubious 3852219 2543552 SPAC4H3.12c Schizosaccharomyces pombe 972h- dubious NP_594348.1 3851914 R 284812 CDS SPAC4H3.13 19115261 2543415 join(3853081..3853112,3853190..3853424) 1 NC_003424.3 transcription factor Pcc1 (predicted) 3853424 2543415 SPAC4H3.13 Schizosaccharomyces pombe 972h- transcription factor Pcc1 (predicted) NP_594349.1 3853081 D 284812 CDS SPAC4H3.14c 19115262 2543546 complement(join(3853769..3854745,3854800..3854860)) 1 NC_003424.3 sequence orphan 3854860 2543546 SPAC4H3.14c Schizosaccharomyces pombe 972h- sequence orphan NP_594350.1 3853769 R 284812 CDS SPAC1071.01c 63054612 2543538 complement(3855780..3857792) 1 NC_003424.3 mRNA cleavage and polyadenylation specificity factor complex subunit Pta1 3857792 pta1 2543538 pta1 Schizosaccharomyces pombe 972h- mRNA cleavage and polyadenylation specificity factor complex subunit Pta1 NP_594351.2 3855780 R 284812 CDS SPAC1071.02 19115264 2541536 join(3858423..3858891,3858935..3859077,3859124..3859227,3859273..3861564,3861631..3861679) 1 NC_003424.3 TFIIH regulator (predicted) 3861679 2541536 SPAC1071.02 Schizosaccharomyces pombe 972h- TFIIH regulator (predicted) NP_594352.1 3858423 D 284812 CDS SPAC1071.03c 19115265 2542963 complement(3861719..3862735) 1 NC_003424.3 sequence orphan 3862735 2542963 SPAC1071.03c Schizosaccharomyces pombe 972h- sequence orphan NP_594353.1 3861719 R 284812 CDS SPAC1071.04c 19115266 2541694 complement(3863001..3863504) 1 NC_003424.3 signal peptidase subunit (predicted) 3863504 2541694 SPAC1071.04c Schizosaccharomyces pombe 972h- signal peptidase subunit (predicted) NP_594354.1 3863001 R 284812 CDS SPAC1071.05 19115267 2542951 3864523..3865542 1 NC_003424.3 S-adenosylmethionine-dependent methyltransferase (predicted) 3865542 2542951 SPAC1071.05 Schizosaccharomyces pombe 972h- S-adenosylmethionine-dependent methyltransferase (predicted) NP_594355.1 3864523 D 284812 CDS SPAC1071.06 19115268 2541540 3866588..3868159 1 NC_003424.3 SWI/SNF and RSC complex subunit Arp9 3868159 arp9 2541540 arp9 Schizosaccharomyces pombe 972h- SWI/SNF and RSC complex subunit Arp9 NP_594356.1 3866588 D 284812 CDS SPAC1071.07c 19115269 2542912 complement(3868496..3868960) 1 NC_003424.3 40S ribosomal protein S15 3868960 rps1502 2542912 rps1502 Schizosaccharomyces pombe 972h- 40S ribosomal protein S15 NP_594357.1 3868496 R 284812 CDS SPAC1071.08 19115270 2543051 join(3869145..3869453,3869548..3869571) 1 NC_003424.3 60S acidic ribosomal protein P2C subunit 3869571 rpp203 2543051 rpp203 Schizosaccharomyces pombe 972h- 60S acidic ribosomal protein P2C subunit NP_594358.1 3869145 D 284812 CDS SPAC1071.09c 19115271 2542992 complement(3870660..3871508) 1 NC_003424.3 DNAJ domain protein, DNAJC9 family 3871508 2542992 SPAC1071.09c Schizosaccharomyces pombe 972h- DNAJ domain protein, DNAJC9 family NP_594359.1 3870660 R 284812 CDS SPAC1071.10c 19115272 2542664 complement(3871920..3874679) 1 NC_003424.3 P-type proton ATPase Pma1 3874679 pma1 2542664 pma1 Schizosaccharomyces pombe 972h- P-type proton ATPase Pma1 NP_594360.1 3871920 R 284812 CDS SPAC1071.11 19115273 2542931 3882527..3883261 1 NC_003424.3 NADH-dependent flavin oxidoreductase (predicted) 3883261 2542931 SPAC1071.11 Schizosaccharomyces pombe 972h- NADH-dependent flavin oxidoreductase (predicted) NP_594361.1 3882527 D 284812 CDS SPAC1071.12c 162312510 3361433 complement(3883621..3884091) 1 NC_003424.3 dual specificity phosphatase Stp1 3884091 stp1 3361433 stp1 Schizosaccharomyces pombe 972h- dual specificity phosphatase Stp1 XP_001713094.1 3883621 R 284812 CDS SPAC926.02 19115275 2543547 join(3884544..3884687,3884844..3886031) 1 NC_003424.3 conserved fungal protein 3886031 2543547 SPAC926.02 Schizosaccharomyces pombe 972h- conserved fungal protein NP_594363.1 3884544 D 284812 CDS SPAC926.03 19115276 2543545 3887570..3888124 1 NC_003424.3 myosin II regulatory light chain Rlc1 3888124 rlc1 2543545 rlc1 Schizosaccharomyces pombe 972h- myosin II regulatory light chain Rlc1 NP_594364.1 3887570 D 284812 CDS SPAC926.04c 19115277 2543539 complement(3888774..3890888) 1 NC_003424.3 Hsp90 chaperone 3890888 hsp90 2543539 hsp90 Schizosaccharomyces pombe 972h- Hsp90 chaperone NP_594365.1 3888774 R 284812 CDS SPAC926.05c 19115278 2543534 complement(join(3892300..3892505,3892545..3892758)) 1 NC_003424.3 diphthamide biosynthesis protein Dph4 (predicted) 3892758 2543534 SPAC926.05c Schizosaccharomyces pombe 972h- diphthamide biosynthesis protein Dph4 (predicted) NP_594366.1 3892300 R 284812 CDS SPAC926.06c 19115279 2543531 complement(3893322..3895187) 1 NC_003424.3 leucine-rich repeat protein, unknown 3895187 2543531 SPAC926.06c Schizosaccharomyces pombe 972h- leucine-rich repeat protein, unknown NP_594367.1 3893322 R 284812 CDS SPAC926.07c 19115280 2543530 complement(join(3896632..3896696,3896767..3896863,3896937..3896971,3897018..3897051,3897102..3897128)) 1 NC_003424.3 dynein light chain Dlc2 3897128 dlc2 2543530 dlc2 Schizosaccharomyces pombe 972h- dynein light chain Dlc2 NP_594368.1 3896632 R 284812 CDS SPAC926.08c 19115281 2543500 complement(join(3898584..3899153,3899257..3899626,3899674..3899687)) 1 NC_003424.3 Brix domain protein Rpf2 (predicted) 3899687 2543500 SPAC926.08c Schizosaccharomyces pombe 972h- Brix domain protein Rpf2 (predicted) NP_594369.1 3898584 R 284812 CDS SPAC926.09c 19115282 2543497 complement(3900367..3906588) 1 NC_003424.3 fatty acid synthase beta subunit Fas1 3906588 fas1 2543497 fas1 Schizosaccharomyces pombe 972h- fatty acid synthase beta subunit Fas1 NP_594370.1 3900367 R 284812 CDS SPAC323.01c 19115283 2543173 complement(join(3907586..3908550,3908675..3908795)) 1 NC_003424.3 splicing may be incorrect, possibly frameshift, intron unsupported; mitochondrial NADH kinase (predicted) 3908795 2543173 SPAC323.01c Schizosaccharomyces pombe 972h- mitochondrial NADH kinase (predicted) NP_594371.1 3907586 R 284812 CDS SPAC323.02c 19115284 2543205 complement(join(3909389..3909568,3909632..3909734,3909873..3910314,3910353..3910371)) 1 NC_003424.3 20S proteasome component alpha 5, Pup2 (predicted) 3910371 pup2 2543205 pup2 Schizosaccharomyces pombe 972h- 20S proteasome component alpha 5, Pup2 (predicted) NP_594372.1 3909389 R 284812 CDS SPAC323.03c 19115285 2543101 complement(join(3910740..3911784,3911828..3911964,3912017..3912500,3912543..3912604)) 1 NC_003424.3 sequence orphan 3912604 2543101 SPAC323.03c Schizosaccharomyces pombe 972h- sequence orphan NP_594373.1 3910740 R 284812 CDS SPAC323.04 19115286 2543203 join(3912773..3912916,3913097..3913481,3913544..3914055,3914102..3914524) 1 NC_003424.3 mitochondrial ATPase (predicted) 3914524 2543203 SPAC323.04 Schizosaccharomyces pombe 972h- mitochondrial ATPase (predicted) NP_594374.1 3912773 D 284812 CDS SPAC323.05c 19115287 2542476 complement(join(3914605..3914790,3914838..3915124,3915166..3915227,3915267..3915360,3915405..3915471)) 1 NC_003424.3 prorein methyltransferase Mtq2 (predicted) 3915471 2542476 SPAC323.05c Schizosaccharomyces pombe 972h- prorein methyltransferase Mtq2 (predicted) NP_594375.1 3914605 R 284812 CDS SPAC323.06c 19115288 2543075 complement(join(3915615..3915698,3915746..3915821,3915865..3916021,3916108..3916298,3916340..3916527,3916569..3916873,3916913..3917102,3917140..3917303,3917347..3917459,3917497..3917531)) 1 NC_003424.3 NEDD8 activating enzyme (predicted) 3917531 uba5 2543075 uba5 Schizosaccharomyces pombe 972h- NEDD8 activating enzyme (predicted) NP_594376.1 3915615 R 284812 CDS SPAC323.07c 19115289 2541632 complement(join(3918201..3919140,3919203..3919864)) 1 NC_003424.3 MatE family transporter 3919864 2541632 SPAC323.07c Schizosaccharomyces pombe 972h- MatE family transporter NP_594377.1 3918201 R 284812 CDS SPAC323.08 19115290 2543088 3921076..3921711 1 NC_003424.3 ribonuclease MRP complex subunit (predicted) 3921711 2543088 SPAC323.08 Schizosaccharomyces pombe 972h- ribonuclease MRP complex subunit (predicted) NP_594378.1 3921076 D 284812 CDS SPAC2F3.01 162312512 3361432 3922354..3923313 1 NC_003424.3 mannosyltransferase complex subunit (predicted) 3923313 3361432 SPAC2F3.01 Schizosaccharomyces pombe 972h- mannosyltransferase complex subunit (predicted) XP_001713095.1 3922354 D 284812 CDS SPAC2F3.17c 19115292 2541997 complement(join(3923693..3923721,3923772..3923885,3923995..3924079)) 1 NC_003424.3 U6 snRNP-associated protein Lsm6 3924079 lsm6 2541997 lsm6 Schizosaccharomyces pombe 972h- U6 snRNP-associated protein Lsm6 NP_594380.1 3923693 R 284812 CDS SPAC2F3.02 19115293 2541463 3924753..3925331 1 NC_003424.3 ER protein translocation subcomplex subunit Sec72 (predicted) 3925331 2541463 SPAC2F3.02 Schizosaccharomyces pombe 972h- ER protein translocation subcomplex subunit Sec72 (predicted) NP_594381.1 3924753 D 284812 CDS SPAC2F3.03c 19115294 2541914 complement(3925983..3927260) 1 NC_003424.3 DNA-directed RNA polymerase I complex subunit Rpa49 3927260 rpa49 2541914 rpa49 Schizosaccharomyces pombe 972h- DNA-directed RNA polymerase I complex subunit Rpa49 NP_594382.1 3925983 R 284812 CDS SPAC2F3.04c 19115295 2541933 complement(join(3927781..3927884,3927969..3928317)) 1 NC_003424.3 mitochondrial single-stranded DNA binding protein Rim1 3928317 rim1 2541933 rim1 Schizosaccharomyces pombe 972h- mitochondrial single-stranded DNA binding protein Rim1 NP_594383.1 3927781 R 284812 CDS SPAC2F3.05c 19115296 2541958 complement(3928809..3929636) 1 NC_003424.3 xylose and arabinose reductase (predicted) 3929636 2541958 SPAC2F3.05c Schizosaccharomyces pombe 972h- xylose and arabinose reductase (predicted) NP_594384.1 3928809 R 284812 CDS SPAC2F3.06c 19115297 2542046 complement(join(3931214..3933838,3933961..3934068)) 1 NC_003424.3 karyopherin Kap104 3934068 kap104 2542046 kap104 Schizosaccharomyces pombe 972h- karyopherin Kap104 NP_594385.1 3931214 R 284812 CDS SPAC2F3.07c 19115298 2542053 complement(3935528..3935833) 1 NC_003424.3 sequence orphan 3935833 2542053 SPAC2F3.07c Schizosaccharomyces pombe 972h- sequence orphan NP_594386.1 3935528 R 284812 CDS SPAC2F3.08 19115299 2541964 join(3936053..3936530,3936597..3937780) 1 NC_003424.3 alpha-glucoside transporter Sut1 3937780 sut1 2541964 sut1 Schizosaccharomyces pombe 972h- alpha-glucoside transporter Sut1 NP_594387.1 3936053 D 284812 CDS SPAC2F3.09 19115300 2542028 3940263..3941939 1 NC_003424.3 5-aminolevulinate synthase 3941939 hem1 2542028 hem1 Schizosaccharomyces pombe 972h- 5-aminolevulinate synthase NP_594388.1 3940263 D 284812 CDS SPAC2F3.18c 295443038 3361431 complement(join(3942299..3942364,3942506..3942730)) 1 NC_003424.3 ORF added after genome completion for consistency but didn't realise SPAC2F3.17c was already used by lsm6; same strand as plr48 (misc RNA); hypothetical protein 3942730 3361431 SPAC2F3.18c Schizosaccharomyces pombe 972h- hypothetical protein NP_001018267.2 3942299 R 284812 CDS SPAC2F3.10 19115301 2541725 3943194..3946043 1 NC_003424.3 GARP complex subunit Vps54 (predicted) 3946043 2541725 SPAC2F3.10 Schizosaccharomyces pombe 972h- GARP complex subunit Vps54 (predicted) NP_594389.1 3943194 D 284812 CDS SPAC2F3.11 19115302 2541853 join(3946578..3946695,3946738..3947774) 1 NC_003424.3 exopolyphosphatase (predicted) 3947774 2541853 SPAC2F3.11 Schizosaccharomyces pombe 972h- exopolyphosphatase (predicted) NP_594390.1 3946578 D 284812 CDS SPAC2F3.12c 68000538 3361430 complement(join(3947930..3948241,3948283..3948358,3948407..3948493,3948538..3948690,3948735..3948946)) 1 NC_003424.3 31.06.02 created from the C-terminal of SPAC2F3.13c; thioredoxin fold protein, human TXNCD9 ortholog 3948946 3361430 SPAC2F3.12c Schizosaccharomyces pombe 972h- thioredoxin fold protein, human TXNCD9 ortholog NP_001018268.1 3947930 R 284812 CDS SPAC2F3.13c 63054617 2541749 complement(join(3949057..3949921,3949997..3950178)) 1 NC_003424.3 31.06.02 split to create SPAC2F3.13c and SPAC2F3.12c; queuine tRNA-ribosyltransferase (predicted) 3950178 2541749 SPAC2F3.13c Schizosaccharomyces pombe 972h- queuine tRNA-ribosyltransferase (predicted) NP_594391.2 3949057 R 284812 CDS SPAC2F3.14c 19115304 2541616 complement(3950520..3951515) 1 NC_003424.3 conserved fungal protein 3951515 2541616 SPAC2F3.14c Schizosaccharomyces pombe 972h- conserved fungal protein NP_594392.1 3950520 R 284812 CDS SPAC2F3.15 19115305 2541672 join(3954471..3955418,3955465..3955555,3955622..3956300,3956352..3956415) 1 NC_003424.3 P-TEFb-associated cyclin-dependent protein kinase Lsk1 3956415 lsk1 2541672 lsk1 Schizosaccharomyces pombe 972h- P-TEFb-associated cyclin-dependent protein kinase Lsk1 NP_594393.1 3954471 D 284812 CDS SPAC2F3.16 19115306 2541608 join(3957143..3957442,3957512..3957844,3957900..3958004,3958067..3958606) 1 NC_003424.3 ubiquitin-protein ligase E3 (predicted) 3958606 2541608 SPAC2F3.16 Schizosaccharomyces pombe 972h- ubiquitin-protein ligase E3 (predicted) NP_594394.1 3957143 D 284812 CDS SPAC11G7.01 19115307 2543029 3959898..3961508 1 NC_003424.3 sequence orphan 3961508 2543029 SPAC11G7.01 Schizosaccharomyces pombe 972h- sequence orphan NP_594395.1 3959898 D 284812 CDS SPAC11G7.02 19115308 2541818 join(3963323..3963339,3963391..3963413,3963465..3963609,3963752..3965870) 1 NC_003424.3 deletion of pub1 suppresses the mislocalization of cat1 in tsc2-delta PMID:18219492; HECT-type ubiquitin-protein ligase Pub1 3965870 pub1 2541818 pub1 Schizosaccharomyces pombe 972h- HECT-type ubiquitin-protein ligase Pub1 NP_594396.1 3963323 D 284812 CDS SPAC11G7.03 19115309 2541894 3966835..3967905 1 NC_003424.3 isocitrate dehydrogenase (NAD+) subunit 1 Idh1 3967905 idh1 2541894 idh1 Schizosaccharomyces pombe 972h- isocitrate dehydrogenase (NAD+) subunit 1 Idh1 NP_594397.1 3966835 D 284812 CDS SPAC11G7.04 19115310 2541768 3969009..3969395 1 NC_003424.3 ribosomal-ubiquitin fusion protein Ubi1 3969395 ubi1 2541768 ubi1 Schizosaccharomyces pombe 972h- ribosomal-ubiquitin fusion protein Ubi1 NP_594398.1 3969009 D 284812 CDS SPAC11G7.05c 19115311 2541662 complement(3969833..3970789) 1 NC_003424.3 [acyl-carrier protein] S-malonyltransferase Mct1 (predicted) 3970789 2541662 SPAC11G7.05c Schizosaccharomyces pombe 972h- [acyl-carrier protein] S-malonyltransferase Mct1 (predicted) NP_594399.1 3969833 R 284812 CDS SPAC11G7.06c 19115312 2543018 complement(3971942..3973234) 1 NC_003424.3 S. pombe specific UPF0300 family protein 3 3973234 mug132 2543018 mug132 Schizosaccharomyces pombe 972h- S. pombe specific UPF0300 family protein 3 NP_594400.1 3971942 R 284812 CDS SPAPB18E9.01 295443040 3361429 join(3974310..3974485,3974541..3974629,3974674..3974775,3974879..3975132,3975193..3975429,3975485..3975832,3975882..3975962,3976014..3976079) 1 NC_003424.3 tRNA (guanine) methyltransferase Trm5 (predicted) 3976079 trm5 3361429 trm5 Schizosaccharomyces pombe 972h- tRNA (guanine) methyltransferase Trm5 (predicted) NP_001018269.2 3974310 D 284812 CDS SPAPB18E9.02c 68000572 3361535 complement(join(3976370..3980189,3980559..3980689)) 1 NC_003424.3 serine/threonine protein kinase Ppk18 (predicted) 3980689 ppk18 3361535 ppk18 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Ppk18 (predicted) NP_001018270.1 3976370 R 284812 CDS SPAPB18E9.04c 68000578 3361427 complement(3982702..3985104) 1 NC_003424.3 sequence orphan 3985104 3361427 SPAPB18E9.04c Schizosaccharomyces pombe 972h- sequence orphan NP_001018272.1 3982702 R 284812 CDS SPAPB18E9.05c 68000582 3361424 complement(3986648..3986920) 1 NC_003424.3 dubious 3986920 3361424 SPAPB18E9.05c Schizosaccharomyces pombe 972h- dubious NP_001018273.1 3986648 R 284812 CDS SPAPB15E9.01c 162312514 5802937 complement(3987239..3990349) 1 NC_003424.3 sequence orphan 3990349 5802937 SPAPB15E9.01c Schizosaccharomyces pombe 972h- sequence orphan XP_001713096.1 3987239 R 284812 CDS SPAPB15E9.02c 68000592 3361426 complement(3991878..3992444) 1 NC_003424.3 has transcript on microarray; sequence composition; dubious 3992444 3361426 SPAPB15E9.02c Schizosaccharomyces pombe 972h- dubious NP_001018275.1 3991878 R 284812 CDS SPAPB15E9.03c 68000596 3361422 complement(3996423..4000424) 1 NC_003424.3 retrotransposable element 4000424 Tf2-5 3361422 Tf2-5 Schizosaccharomyces pombe 972h- retrotransposable element NP_001018276.1 3996423 R 284812 CDS SPAC27E2.01 19115313 2542681 join(4001886..4002860,4002964..4003416,4003467..4003514) 1 NC_003424.3 alpha-amylase homolog (predicted) 4003514 2542681 SPAC27E2.01 Schizosaccharomyces pombe 972h- alpha-amylase homolog (predicted) NP_594401.1 4001886 D 284812 CDS SPAC27E2.02 19115314 2541824 join(4004507..4005061,4005154..4005273,4005341..4005508) 1 NC_003424.3 IMPACT homolog 4005508 2541824 SPAC27E2.02 Schizosaccharomyces pombe 972h- IMPACT homolog NP_594402.1 4004507 D 284812 CDS SPAC27E2.03c 19115315 2541434 complement(4005850..4007028) 1 NC_003424.3 GTP binding protein (predicted) 4007028 2541434 SPAC27E2.03c Schizosaccharomyces pombe 972h- GTP binding protein (predicted) NP_594403.1 4005850 R 284812 CDS SPAC27E2.13 162312516 5802942 4008511..4008693 1 NC_003424.3 dubious 4008693 5802942 SPAC27E2.13 Schizosaccharomyces pombe 972h- dubious XP_001713097.1 4008511 D 284812 CDS SPAC27E2.11c 19115316 2541842 complement(4009573..4009818) 1 NC_003424.3 possibly not coding; sequence orphan 4009818 2541842 SPAC27E2.11c Schizosaccharomyces pombe 972h- sequence orphan NP_594404.1 4009573 R 284812 CDS SPAC27E2.04c 19115317 2542034 complement(4010686..4011249) 1 NC_003424.3 unusual GC plot and composition; previously annotated as dubious, but has localization signal; based on transcriptome data it appears that the ORF on the opposite strand is real, so this has been changed back to dubious; dubious 4011249 mug155 2542034 mug155 Schizosaccharomyces pombe 972h- dubious NP_594405.1 4010686 R 284812 CDS SPAC27E2.12 162312518 5802943 join(4010913..4010930,4011105..4011317) 1 NC_003424.3 was previously annotated as dubious but transcriptome data indicated regulated splicing; sequence orphan 4011317 5802943 SPAC27E2.12 Schizosaccharomyces pombe 972h- sequence orphan XP_001713098.1 4010913 D 284812 CDS SPAC27E2.14 295443042 9407256 complement(join(4012522..4012611,4012663..4012677)) 1 NC_003424.3 intron from Solexa transread data; sequence orphan 4012677 9407256 SPAC27E2.14 Schizosaccharomyces pombe 972h- sequence orphan XP_002742513.1 4012522 R 284812 CDS SPAC27E2.05 19115318 2542083 join(4015050..4016190,4016240..4016487) 1 NC_003424.3 DNA polymerase delta small subunit Cdc1 4016487 cdc1 2542083 cdc1 Schizosaccharomyces pombe 972h- DNA polymerase delta small subunit Cdc1 NP_594406.1 4015050 D 284812 CDS SPAC27E2.06c 19115319 2541577 complement(4016578..4018197) 1 NC_003424.3 mitochondrial methionine-tRNA ligase 4018197 2541577 SPAC27E2.06c Schizosaccharomyces pombe 972h- mitochondrial methionine-tRNA ligase NP_594407.1 4016578 R 284812 CDS SPAC27E2.07 19115320 2541902 4020082..4021251 1 NC_003424.3 galactose residue biosynthesis protein Pvg2 4021251 pvg2 2541902 pvg2 Schizosaccharomyces pombe 972h- galactose residue biosynthesis protein Pvg2 NP_594408.1 4020082 D 284812 CDS SPAC27E2.08 19115321 2541991 4022492..4026493 1 NC_003424.3 retrotransposable element 4026493 Tf2-6 2541991 Tf2-6 Schizosaccharomyces pombe 972h- retrotransposable element NP_594409.1 4022492 D 284812 CDS SPAC27E2.09 19115322 2542041 4027114..4034046 1 NC_003424.3 histidine kinase Mak2 4034046 mak2 2542041 mak2 Schizosaccharomyces pombe 972h- histidine kinase Mak2 NP_594410.1 4027114 D 284812 CDS SPAC27E2.10c 162312520 2541493 complement(join(4034287..4034516,4034578..4034949,4035091..4035164,4035216..4035429,4035479..4035543,4035709..4035782)) 1 NC_003424.3 DNA replication factor C complex subunit Rfc3 4035782 rfc3 2541493 rfc3 Schizosaccharomyces pombe 972h- DNA replication factor C complex subunit Rfc3 XP_001713099.1 4034287 R 284812 CDS SPAPJ698.02c 19115325 2543293 complement(4036723..4037586) 1 NC_003424.3 40S ribosomal protein S0B 4037586 rps002 2543293 rps002 Schizosaccharomyces pombe 972h- 40S ribosomal protein S0B NP_594413.1 4036723 R 284812 CDS SPAPJ698.03c 19115326 2543278 complement(4038144..4041764) 1 NC_003424.3 U2 snRNP-associated protein Sap130 (predicted) 4041764 prp12 2543278 prp12 Schizosaccharomyces pombe 972h- U2 snRNP-associated protein Sap130 (predicted) NP_594414.1 4038144 R 284812 CDS SPAC19G12.01c 162312522 2542615 complement(join(4042034..4043554,4043600..4043657,4043749..4043871,4043914..4044133,4044182..4044419)) 1 NC_003424.3 anaphase-promoting complex subunit Apc4 4044419 cut20 2542615 cut20 Schizosaccharomyces pombe 972h- anaphase-promoting complex subunit Apc4 XP_001713100.1 4042034 R 284812 CDS SPAC19G12.02c 19115329 2542582 complement(join(4044900..4045135,4045177..4046433,4046505..4046970,4047073..4047498)) 1 NC_003424.3 MutL family mismatch-repair protein Pms1 4047498 pms1 2542582 pms1 Schizosaccharomyces pombe 972h- MutL family mismatch-repair protein Pms1 NP_594417.1 4044900 R 284812 CDS SPAC19G12.03 19115330 2542224 4048141..4049103 1 NC_003424.3 chitin deacetylase Cda1 4049103 cda1 2542224 cda1 Schizosaccharomyces pombe 972h- chitin deacetylase Cda1 NP_594418.1 4048141 D 284812 CDS SPAC19G12.04 19115331 2542470 4049619..4050194 1 NC_003424.3 ureidoglycolate hydrolase (predicted) 4050194 2542470 SPAC19G12.04 Schizosaccharomyces pombe 972h- ureidoglycolate hydrolase (predicted) NP_594419.1 4049619 D 284812 CDS SPAC19G12.05 19115332 2542456 4051128..4052003 1 NC_003424.3 mitochondrial citrate transporter 4052003 2542456 SPAC19G12.05 Schizosaccharomyces pombe 972h- mitochondrial citrate transporter NP_594420.1 4051128 D 284812 CDS SPAC19G12.06c 19115333 2542226 complement(4052852..4053247) 1 NC_003424.3 histone H2A beta 4053247 hta2 2542226 hta2 Schizosaccharomyces pombe 972h- histone H2A beta NP_594421.1 4052852 R 284812 CDS SPAC19G12.07c 19115334 2542545 complement(join(4053810..4054068,4054110..4054187,4054234..4054554,4054627..4054800,4054848..4054985,4055082..4055872,4055964..4056017)) 1 NC_003424.3 RNA-binding protein Rsd1 4056017 rsd1 2542545 rsd1 Schizosaccharomyces pombe 972h- RNA-binding protein Rsd1 NP_594422.1 4053810 R 284812 CDS SPAC19G12.08 19115335 2542519 join(4056958..4057015,4057304..4058289) 1 NC_003424.3 sphingosine hydroxylase (predicted) 4058289 2542519 SPAC19G12.08 Schizosaccharomyces pombe 972h- sphingosine hydroxylase (predicted) NP_594423.1 4056958 D 284812 CDS SPAC19G12.09 19115336 2542483 4060252..4061106 1 NC_003424.3 NADH/NADPH dependent indole-3-acetaldehyde reductase AKR3C2 4061106 2542483 SPAC19G12.09 Schizosaccharomyces pombe 972h- NADH/NADPH dependent indole-3-acetaldehyde reductase AKR3C2 NP_594424.1 4060252 D 284812 CDS SPAC19G12.10c 19115337 2542465 complement(4061510..4064518) 1 NC_003424.3 vacuolar carboxypeptidase Y 4064518 cpy1 2542465 cpy1 Schizosaccharomyces pombe 972h- vacuolar carboxypeptidase Y NP_594425.1 4061510 R 284812 CDS SPAC19G12.11 19115338 2542605 4067434..4068186 1 NC_003424.3 ubiquinone biosynthesis protein Coq9 (predicted) 4068186 coq9 2542605 coq9 Schizosaccharomyces pombe 972h- ubiquinone biosynthesis protein Coq9 (predicted) NP_594426.1 4067434 D 284812 CDS SPAC19G12.12 19115339 2542608 4068756..4069640 1 NC_003424.3 decaprenyl diphosphate synthase subunit 2 Dlp1 4069640 dlp1 2542608 dlp1 Schizosaccharomyces pombe 972h- decaprenyl diphosphate synthase subunit 2 Dlp1 NP_594427.1 4068756 D 284812 CDS SPAC19G12.13c 19115340 2542244 complement(join(4069876..4070172,4070267..4070613,4070651..4070756)) 1 NC_003424.3 Pot1 associated protein Poz1 4070756 poz1 2542244 poz1 Schizosaccharomyces pombe 972h- Pot1 associated protein Poz1 NP_594428.1 4069876 R 284812 CDS SPAC19G12.14 19115341 2542231 join(4072376..4074126,4074180..4074291,4074388..4074753) 1 NC_003424.3 1-phosphatidylinositol-4-phosphate 5-kinase Its3 4074753 its3 2542231 its3 Schizosaccharomyces pombe 972h- 1-phosphatidylinositol-4-phosphate 5-kinase Its3 NP_594429.1 4072376 D 284812 CDS SPAC19G12.15c 19115342 2542577 complement(4075267..4077720) 1 NC_003424.3 trehalose-6-phosphate phosphatase Tpp1 4077720 tpp1 2542577 tpp1 Schizosaccharomyces pombe 972h- trehalose-6-phosphate phosphatase Tpp1 NP_594430.1 4075267 R 284812 CDS SPAC19G12.16c 162312524 5802945 complement(4078938..4080950) 1 NC_003424.3 4.5 copies of 53AA repeat; consensus ATFTSSPPFYSNSSVIPTSVPSSVSSFTSSNSSYTTTLTASNTTVTFTGTGTGS; ace2 dependent gene; conserved fungal protein 4080950 adg2 5802945 adg2 Schizosaccharomyces pombe 972h- conserved fungal protein XP_001713101.1 4078938 R 284812 CDS SPAC23A1.02c 19115344 2541744 complement(4081483..4082775) 1 NC_003424.3 phosphoprotein phosphatase (predicted) 4082775 2541744 SPAC23A1.02c Schizosaccharomyces pombe 972h- phosphoprotein phosphatase (predicted) NP_594432.1 4081483 R 284812 CDS SPAC23A1.03 19115345 2542022 join(4083686..4083769,4083948..4084430) 1 NC_003424.3 adenine phosphoribosyltransferase (APRT) (predicted) 4084430 apt1 2542022 apt1 Schizosaccharomyces pombe 972h- adenine phosphoribosyltransferase (APRT) (predicted) NP_594433.1 4083686 D 284812 CDS SPAC23A1.04c 19115346 2541981 complement(join(4085020..4087276,4087334..4087440)) 1 NC_003424.3 May use an alternative initiation met at codon 32; alpha mannosidase-like protein 4087440 mnl1 2541981 mnl1 Schizosaccharomyces pombe 972h- alpha mannosidase-like protein NP_594434.1 4085020 R 284812 CDS SPAC23A1.05 19115347 2541988 4088871..4089176 1 NC_003424.3 previously annotated as dubious, but has localization signal; sequence orphan 4089176 2541988 SPAC23A1.05 Schizosaccharomyces pombe 972h- sequence orphan NP_594435.1 4088871 D 284812 CDS SPAC23A1.06c 19115348 2541982 complement(join(4090158..4091357,4091660..4091756,4091822..4092024,4092065..4092079)) 1 NC_003424.3 MAPK-activated protein kinase Cmk2 4092079 cmk2 2541982 cmk2 Schizosaccharomyces pombe 972h- MAPK-activated protein kinase Cmk2 NP_594436.1 4090158 R 284812 CDS SPAC23A1.07 19115349 2541979 4092329..4093084 1 NC_003424.3 ubiquitin-protein ligase E3 (predicted) 4093084 2541979 SPAC23A1.07 Schizosaccharomyces pombe 972h- ubiquitin-protein ligase E3 (predicted) NP_594437.1 4092329 D 284812 CDS SPAC23A1.08c 19115350 2541989 complement(4093429..4093767) 1 NC_003424.3 60S ribosomal protein L34 4093767 rpl3401 2541989 rpl3401 Schizosaccharomyces pombe 972h- 60S ribosomal protein L34 NP_594438.1 4093429 R 284812 CDS SPAC23A1.09 19115351 2541998 4094177..4094542 1 NC_003424.3 NAS (pers. comm. J.A. Potashkin); RNA-binding protein 4094542 2541998 SPAC23A1.09 Schizosaccharomyces pombe 972h- RNA-binding protein NP_594439.1 4094177 D 284812 CDS SPAC23A1.10 19115352 2541984 4095202..4096584 1 NC_003424.3 translation elongation factor EF-1 alpha Ef1a-b 4096584 ef1a-b 2541984 ef1a-b Schizosaccharomyces pombe 972h- translation elongation factor EF-1 alpha Ef1a-b NP_594440.1 4095202 D 284812 CDS SPAC23A1.11 19115353 2542006 join(4097334..4097374,4097430..4097982) 1 NC_003424.3 60S ribosomal protein L13/L16 4097982 rpl1602 2542006 rpl1602 Schizosaccharomyces pombe 972h- 60S ribosomal protein L13/L16 NP_594441.1 4097334 D 284812 CDS SPAC23A1.12c 19115354 2541974 complement(join(4098303..4100014,4100066..4100123)) 1 NC_003424.3 phenylalanine-tRNA ligase beta subunit Frs1 (predicted) 4100123 frs1 2541974 frs1 Schizosaccharomyces pombe 972h- phenylalanine-tRNA ligase beta subunit Frs1 (predicted) NP_594442.1 4098303 R 284812 CDS SPAC23A1.14c 19115355 2542042 complement(4101759..4102955) 1 NC_003424.3 uncharacterised trans-sulfuration enzyme (predicted) 4102955 2542042 SPAC23A1.14c Schizosaccharomyces pombe 972h- uncharacterised trans-sulfuration enzyme (predicted) NP_594443.1 4101759 R 284812 CDS SPAC23A1.15c 19115356 2541996 complement(4103942..4104622) 1 NC_003424.3 SNARE Sec20 4104622 sec20 2541996 sec20 Schizosaccharomyces pombe 972h- SNARE Sec20 NP_594444.1 4103942 R 284812 CDS SPAC23A1.16c 19115357 2542005 complement(4105116..4105709) 1 NC_003424.3 RNA polymerase II-associated protein Rtr1 (predicted) 4105709 2542005 SPAC23A1.16c Schizosaccharomyces pombe 972h- RNA polymerase II-associated protein Rtr1 (predicted) NP_594445.1 4105116 R 284812 CDS SPAC23A1.17 19115358 2542019 4106827..4111662 1 NC_003424.3 WIP (Wiskott-Aldrich syndrome protein-Interacting Protein) homolog 4111662 2542019 SPAC23A1.17 Schizosaccharomyces pombe 972h- WIP (Wiskott-Aldrich syndrome protein-Interacting Protein) homolog NP_594446.1 4106827 D 284812 CDS SPAC23A1.18c 19115359 2542037 complement(4112685..4113560) 1 NC_003424.3 mitochondrial ribosomal protein subunit L51-b (predicted) 4113560 mrp51 2542037 mrp51 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit L51-b (predicted) NP_594447.1 4112685 R 284812 CDS SPAC23A1.19c 63054629 2542036 complement(join(4113815..4113933,4114109..4117181)) 1 NC_003424.3 RecQ type DNA helicase Hrq1 (predicted) 4117181 2542036 SPAC23A1.19c Schizosaccharomyces pombe 972h- RecQ type DNA helicase Hrq1 (predicted) NP_594448.2 4113815 R 284812 CDS SPAC26H5.02c 162312526 2542096 complement(join(4117287..4117385,4117426..4118200,4118245..4118262,4118308..4118338,4118382..4118973)) 1 NC_003424.3 updated sequence to add 4th intron 2133,2174 at (changed frame of final exon) (pers. comm. Stuart MacNeill) date=20050419; DNA replication ATPase 4118973 2542096 SPAC26H5.02c Schizosaccharomyces pombe 972h- DNA replication ATPase NP_594449.2 4117287 R 284812 CDS SPAC26H5.03 19115362 2542071 join(4119899..4120030,4120126..4120228,4120270..4120512,4120578..4121638) 1 NC_003424.3 CAF assembly factor (CAF-1) complex subunit B, Pcf2 4121638 pcf2 2542071 pcf2 Schizosaccharomyces pombe 972h- CAF assembly factor (CAF-1) complex subunit B, Pcf2 NP_594450.1 4119899 D 284812 CDS SPAC26H5.04 295443044 2542081 4122149..4124518 1 NC_003424.3 possible in frame splice at 4123354,4123535, improved homology, but unsupproted; vacuolar import and degradation protein Vid28 4124518 2542081 SPAC26H5.04 Schizosaccharomyces pombe 972h- vacuolar import and degradation protein Vid28 NP_594451.2 4122149 D 284812 CDS SPAC26H5.05 19115364 2542701 4125212..4128667 1 NC_003424.3 IPT/TIG ankyrin repeat protein 4128667 2542701 SPAC26H5.05 Schizosaccharomyces pombe 972h- IPT/TIG ankyrin repeat protein NP_594452.1 4125212 D 284812 CDS SPAC26H5.06 19115365 2542703 join(4129529..4129597,4129644..4129764,4129837..4131314) 1 NC_003424.3 telomere end-binding protein Pot1 4131314 pot1 2542703 pot1 Schizosaccharomyces pombe 972h- telomere end-binding protein Pot1 NP_594453.1 4129529 D 284812 CDS SPAC26H5.07c 19115366 2542691 complement(join(4131566..4132923,4133227..4133299,4133377..4133463)) 1 NC_003424.3 seven transmembrane receptor-like protein 4133463 2542691 SPAC26H5.07c Schizosaccharomyces pombe 972h- seven transmembrane receptor-like protein NP_594454.1 4131566 R 284812 CDS SPAC26H5.08c 19115367 2542700 complement(4134622..4135587) 1 NC_003424.3 glucan 1,3-beta-glucosidase Bgl2 4135587 bgl2 2542700 bgl2 Schizosaccharomyces pombe 972h- glucan 1,3-beta-glucosidase Bgl2 NP_594455.1 4134622 R 284812 CDS SPAC26H5.09c 19115368 2542698 complement(4137573..4138682) 1 NC_003424.3 GFO/IDH/MocA family oxidoreductase 4138682 2542698 SPAC26H5.09c Schizosaccharomyces pombe 972h- GFO/IDH/MocA family oxidoreductase NP_594456.1 4137573 R 284812 CDS SPAC26H5.10c 19115369 2542694 complement(4141740..4142213) 1 NC_003424.3 translation elongation factor eIF5A (predicted) 4142213 tif51 2542694 tif51 Schizosaccharomyces pombe 972h- translation elongation factor eIF5A (predicted) NP_594457.1 4141740 R 284812 CDS SPAC26H5.11 19115370 2542692 join(4144166..4146978,4147029..4147113) 1 NC_003424.3 spore wall assembly protein (predicted) 4147113 mug56 2542692 mug56 Schizosaccharomyces pombe 972h- spore wall assembly protein (predicted) NP_594458.1 4144166 D 284812 CDS SPAC26H5.12 19115371 2542687 4147841..4151203 1 NC_003424.3 mitochondrial RNA polymerase 4151203 rpo41 2542687 rpo41 Schizosaccharomyces pombe 972h- mitochondrial RNA polymerase NP_594459.1 4147841 D 284812 CDS SPAC26H5.13c 19115372 2541523 complement(join(4151695..4152345,4152435..4152494)) 1 NC_003424.3 DUF1753 family protein 4152494 2541523 SPAC26H5.13c Schizosaccharomyces pombe 972h- DUF1753 family protein NP_594460.1 4151695 R 284812 CDS SPAC25B8.01 19115373 2542688 4155473..4155973 1 NC_003424.3 cytochrome P450 regulator Dap1 4155973 dap1 2542688 dap1 Schizosaccharomyces pombe 972h- cytochrome P450 regulator Dap1 NP_594461.1 4155473 D 284812 CDS SPAC25B8.02 19115374 2541697 4156539..4157342 1 NC_003424.3 Clr6 histone deacetylase complex subunit Sds3 4157342 sds3 2541697 sds3 Schizosaccharomyces pombe 972h- Clr6 histone deacetylase complex subunit Sds3 NP_594462.1 4156539 D 284812 CDS SPAC25B8.03 19115375 2541447 4158828..4160378 1 NC_003424.3 phosphatidylserine decarboxylase 4160378 2541447 SPAC25B8.03 Schizosaccharomyces pombe 972h- phosphatidylserine decarboxylase NP_594463.1 4158828 D 284812 CDS SPAC25B8.04c 19115376 2541593 complement(4160852..4161988) 1 NC_003424.3 mitochondrial splicing suppressor (predicted) 4161988 2541593 SPAC25B8.04c Schizosaccharomyces pombe 972h- mitochondrial splicing suppressor (predicted) NP_594464.1 4160852 R 284812 CDS SPAC25B8.05 19115377 2541578 4162800..4164152 1 NC_003424.3 tRNA-pseudouridine synthase (predicted) 4164152 2541578 SPAC25B8.05 Schizosaccharomyces pombe 972h- tRNA-pseudouridine synthase (predicted) NP_594465.1 4162800 D 284812 CDS SPAC25B8.06c 19115378 2541567 complement(join(4164278..4164599,4164657..4165699)) 1 NC_003424.3 mitochondrial serine-tRNA ligase 4165699 2541567 SPAC25B8.06c Schizosaccharomyces pombe 972h- mitochondrial serine-tRNA ligase NP_594466.1 4164278 R 284812 CDS SPAC25B8.07c 19115379 2542662 complement(4167311..4167652) 1 NC_003424.3 hypoxia induced family protein 4167652 2542662 SPAC25B8.07c Schizosaccharomyces pombe 972h- hypoxia induced family protein NP_594467.1 4167311 R 284812 CDS SPAC25B8.08 19115380 2542659 4168212..4169984 1 NC_003424.3 possibly conserved in metazoa also; conserved fungal protein 4169984 2542659 SPAC25B8.08 Schizosaccharomyces pombe 972h- conserved fungal protein NP_594468.1 4168212 D 284812 CDS SPAC25B8.09 19115381 2541658 4170714..4171469 1 NC_003424.3 trans-aconitate 3-methyltransferase (predicted) 4171469 2541658 SPAC25B8.09 Schizosaccharomyces pombe 972h- trans-aconitate 3-methyltransferase (predicted) NP_594469.1 4170714 D 284812 CDS SPAC25B8.10 19115382 2541626 4172176..4172946 1 NC_003424.3 trans-aconitate 3-methyltransferase (predicted) 4172946 2541626 SPAC25B8.10 Schizosaccharomyces pombe 972h- trans-aconitate 3-methyltransferase (predicted) NP_594470.1 4172176 D 284812 CDS SPAC25B8.11 19115383 2541574 join(4174059..4175508,4175555..4176069) 1 NC_003424.3 transcription factor (predicted) 4176069 2541574 SPAC25B8.11 Schizosaccharomyces pombe 972h- transcription factor (predicted) NP_594471.1 4174059 D 284812 CDS SPAC25B8.12c 19115384 2541651 complement(4177021..4177932) 1 NC_003424.3 nucleotide-sugar phosphatase (predicted) 4177932 2541651 SPAC25B8.12c Schizosaccharomyces pombe 972h- nucleotide-sugar phosphatase (predicted) NP_594472.1 4177021 R 284812 CDS SPAC25B8.13c 19115385 2542728 complement(4180541..4181734) 1 NC_003424.3 2-OG-Fe(II) oxygenase superfamily protein 4181734 isp7 2542728 isp7 Schizosaccharomyces pombe 972h- 2-OG-Fe(II) oxygenase superfamily protein NP_594473.1 4180541 R 284812 CDS SPAC25B8.14 19115386 2542737 4185523..4186434 1 NC_003424.3 kinetochore protein Mal2 4186434 mal2 2542737 mal2 Schizosaccharomyces pombe 972h- kinetochore protein Mal2 NP_594474.1 4185523 D 284812 CDS SPAC25B8.15c 19115387 2542730 complement(4186512..4187225) 1 NC_003424.3 wybutosine biosynthesis protein Tyw3 4187225 2542730 SPAC25B8.15c Schizosaccharomyces pombe 972h- wybutosine biosynthesis protein Tyw3 NP_594475.1 4186512 R 284812 CDS SPAC25B8.16 19115388 2541548 4187547..4189643 1 NC_003424.3 RNase P and RNase MRP subunit (predicted) 4189643 2541548 SPAC25B8.16 Schizosaccharomyces pombe 972h- RNase P and RNase MRP subunit (predicted) NP_594476.1 4187547 D 284812 CDS SPAC25B8.17 19115389 2542712 4190353..4191240 1 NC_003424.3 peptidase family A22 4191240 2542712 SPAC25B8.17 Schizosaccharomyces pombe 972h- peptidase family A22 NP_594477.1 4190353 D 284812 CDS SPAC25B8.18 19115390 2542735 4191613..4191978 1 NC_003424.3 mitochondrial electron carrier (predicted) 4191978 2542735 SPAC25B8.18 Schizosaccharomyces pombe 972h- mitochondrial electron carrier (predicted) NP_594478.1 4191613 D 284812 CDS SPAC25B8.19c 63054630 2542738 complement(4192642..4194210) 1 NC_003424.3 transcription factor zf-C2H2 type (predicted) 4194210 2542738 SPAC25B8.19c Schizosaccharomyces pombe 972h- transcription factor zf-C2H2 type (predicted) NP_594479.2 4192642 R 284812 CDS SPAC683.03 19115392 2543487 4195642..4195959 1 NC_003424.3 previously annotated as dubious, but has localization signal; sequence orphan 4195959 2543487 SPAC683.03 Schizosaccharomyces pombe 972h- sequence orphan NP_594480.1 4195642 D 284812 CDS SPAC683.02c 19115393 2543491 complement(4197659..4198315) 1 NC_003424.3 zf-CCHC type zinc finger protein 4198315 2543491 SPAC683.02c Schizosaccharomyces pombe 972h- zf-CCHC type zinc finger protein NP_594481.1 4197659 R 284812 CDS SPAC694.02 19115394 2543333 4200185..4205338 1 NC_003424.3 DEAD/DEAH box helicase 4205338 2543333 SPAC694.02 Schizosaccharomyces pombe 972h- DEAD/DEAH box helicase NP_594482.1 4200185 D 284812 CDS SPAC694.03 19115395 2543057 join(4205765..4205870,4205937..4206580) 1 NC_003424.3 conserved fungal protein 4206580 2543057 SPAC694.03 Schizosaccharomyces pombe 972h- conserved fungal protein NP_594483.1 4205765 D 284812 CDS SPAC694.04c 19115396 2543308 complement(join(4206795..4207714,4208058..4208112)) 1 NC_003424.3 conserved eukaryotic protein 4208112 2543308 SPAC694.04c Schizosaccharomyces pombe 972h- conserved eukaryotic protein NP_594484.1 4206795 R 284812 CDS SPAC694.05c 19115397 2543307 complement(join(4208475..4208500,4208554..4208794,4208845..4208847)) 1 NC_003424.3 40S ribosomal protein S25 4208847 rps2502 2543307 rps2502 Schizosaccharomyces pombe 972h- 40S ribosomal protein S25 NP_594485.1 4208475 R 284812 CDS SPAC694.06c 19115398 2543240 complement(4209284..4212343) 1 NC_003424.3 mediator of replication checkpoint 1 4212343 mrc1 2543240 mrc1 Schizosaccharomyces pombe 972h- mediator of replication checkpoint 1 NP_594486.1 4209284 R 284812 CDS SPAC1F7.01c 63054631 2541605 complement(4212706..4216803) 1 NC_003424.3 transcription elongation factor Spt6 4216803 spt6 2541605 spt6 Schizosaccharomyces pombe 972h- transcription elongation factor Spt6 NP_594487.2 4212706 R 284812 CDS SPAC1F7.02c 19115400 2541668 complement(4217418..4219154) 1 NC_003424.3 ATP-dependent RNA helicase Has1 (predicted) 4219154 has1 2541668 has1 Schizosaccharomyces pombe 972h- ATP-dependent RNA helicase Has1 (predicted) NP_594488.1 4217418 R 284812 CDS SPAC1F7.03 19115401 2541613 4220001..4222133 1 NC_003424.3 TRP-like ion channel Pkd2 4222133 pkd2 2541613 pkd2 Schizosaccharomyces pombe 972h- TRP-like ion channel Pkd2 NP_594489.1 4220001 D 284812 CDS SPAC1F7.04 19115402 2541612 join(4224180..4224250,4224582..4225119) 1 NC_003424.3 Rho family GTPase Rho1 4225119 rho1 2541612 rho1 Schizosaccharomyces pombe 972h- Rho family GTPase Rho1 NP_594490.1 4224180 D 284812 CDS SPAC1F7.05 19115403 2541695 join(4226982..4227000,4227317..4229733) 1 NC_003424.3 ribonucleoside reductase large subunit Cdc22 4229733 cdc22 2541695 cdc22 Schizosaccharomyces pombe 972h- ribonucleoside reductase large subunit Cdc22 NP_594491.1 4226982 D 284812 CDS SPAC1F7.06 19115404 2541687 4230850..4231605 1 NC_003424.3 ThiJ domain protein 4231605 2541687 SPAC1F7.06 Schizosaccharomyces pombe 972h- ThiJ domain protein NP_594492.1 4230850 D 284812 CDS SPAC1F7.07c 19115405 2541557 complement(4233303..4234496) 1 NC_003424.3 iron permease Fip1 4234496 fip1 2541557 fip1 Schizosaccharomyces pombe 972h- iron permease Fip1 NP_594493.1 4233303 R 284812 CDS SPAC1F7.08 19115406 2541558 4235639..4237507 1 NC_003424.3 iron transport multicopper oxidase Fio1 4237507 fio1 2541558 fio1 Schizosaccharomyces pombe 972h- iron transport multicopper oxidase Fio1 NP_594494.1 4235639 D 284812 CDS SPAC1F7.09c 19115407 2541441 complement(4242016..4243044) 1 NC_003424.3 allantoicase (predicted) 4243044 2541441 SPAC1F7.09c Schizosaccharomyces pombe 972h- allantoicase (predicted) NP_594495.1 4242016 R 284812 CDS SPAC1F7.10 19115408 2541822 4243969..4244685 1 NC_003424.3 hydantoin racemase family (predicted) 4244685 2541822 SPAC1F7.10 Schizosaccharomyces pombe 972h- hydantoin racemase family (predicted) NP_594496.1 4243969 D 284812 CDS SPAC1F7.11c 19115409 2541541 complement(join(4245302..4247474,4247532..4247614,4247705..4247797)) 1 NC_003424.3 transcription factor, zf-fungal binuclear cluster type (predicted) 4247797 2541541 SPAC1F7.11c Schizosaccharomyces pombe 972h- transcription factor, zf-fungal binuclear cluster type (predicted) NP_594497.1 4245302 R 284812 CDS SPAC1F7.12 19115410 2541648 4249066..4250088 1 NC_003424.3 aldose reductase YakC 4250088 yak3 2541648 yak3 Schizosaccharomyces pombe 972h- aldose reductase YakC NP_594498.1 4249066 D 284812 CDS SPAC1F7.13c 162312528 5802952 complement(4250657..4251418) 1 NC_003424.3 60S ribosomal protein L8 4251418 rpl801 5802952 rpl801 Schizosaccharomyces pombe 972h- 60S ribosomal protein L8 XP_001713102.1 4250657 R 284812 CDS SPAC21E11.03c 19115412 2542047 complement(4252403..4252918) 1 NC_003424.3 transcription factor Pcr1 4252918 pcr1 2542047 pcr1 Schizosaccharomyces pombe 972h- transcription factor Pcr1 NP_594500.1 4252403 R 284812 CDS SPAC21E11.04 19115413 2541963 4254860..4255489 1 NC_003424.3 is similar to SGD:S0007536 MPR1 not found in the S288C strain; L-azetidine-2-carboxylic acid acetyltransferase 4255489 ppr1 2541963 ppr1 Schizosaccharomyces pombe 972h- L-azetidine-2-carboxylic acid acetyltransferase NP_594501.1 4254860 D 284812 CDS SPAC21E11.05c 162312530 2541969 complement(join(4255729..4256152,4256218..4257132,4257273..4257484)) 1 NC_003424.3 seq change GAGT[G]GCA; cyclophilin family peptidyl-prolyl cis-trans isomerase Cyp8 4257484 cyp8 2541969 cyp8 Schizosaccharomyces pombe 972h- cyclophilin family peptidyl-prolyl cis-trans isomerase Cyp8 NP_594502.2 4255729 R 284812 CDS SPAC21E11.06 19115415 2542064 4257736..4259139 1 NC_003424.3 translation initiation factor eIF2B delta subunit 4259139 tif224 2542064 tif224 Schizosaccharomyces pombe 972h- translation initiation factor eIF2B delta subunit NP_594503.1 4257736 D 284812 CDS SPAC21E11.07 19115416 2541968 join(4260101..4260295,4260351..4261133) 1 NC_003424.3 iron-sulphur cluster biogenesis protein (predicted) 4261133 2541968 SPAC21E11.07 Schizosaccharomyces pombe 972h- iron-sulphur cluster biogenesis protein (predicted) NP_594504.1 4260101 D 284812 CDS SPAC21E11.08 162312532 3361415 4261888..4263699 1 NC_003424.3 serine palmitoyltransferase Lcb2 (predicted) 4263699 lcb2 3361415 lcb2 Schizosaccharomyces pombe 972h- serine palmitoyltransferase Lcb2 (predicted) XP_001713103.1 4261888 D 284812 CDS SPAC2C4.03c 19115418 2542480 complement(join(4264024..4264152,4264214..4264326,4264387..4264487,4264545..4264549)) 1 NC_003424.3 Sm snRNP core protein Smd2 4264549 smd2 2542480 smd2 Schizosaccharomyces pombe 972h- Sm snRNP core protein Smd2 NP_594506.1 4264024 R 284812 CDS SPAC2C4.04c 19115419 2542455 complement(4265722..4266099) 1 NC_003424.3 conserved eukaryotic protein 4266099 2542455 SPAC2C4.04c Schizosaccharomyces pombe 972h- conserved eukaryotic protein NP_594507.1 4265722 R 284812 CDS SPAC2C4.05 19115420 2542639 join(4267113..4267233,4267321..4267604) 1 NC_003424.3 cornichon family protein 4267604 2542639 SPAC2C4.05 Schizosaccharomyces pombe 972h- cornichon family protein NP_594508.1 4267113 D 284812 CDS SPAC2C4.06c 295443046 2542630 complement(join(4269367..4270554,4270631..4270674,4270736..4270871)) 1 NC_003424.3 splicing possibly incorrect; rRNA methyltransferase (predicted) 4270871 2542630 SPAC2C4.06c Schizosaccharomyces pombe 972h- rRNA methyltransferase (predicted) NP_594509.2 4269367 R 284812 CDS SPAC2C4.07c 19115422 2542643 complement(4271297..4274080) 1 NC_003424.3 ribonuclease II (RNB) family 4274080 2542643 SPAC2C4.07c Schizosaccharomyces pombe 972h- ribonuclease II (RNB) family NP_594510.1 4271297 R 284812 CDS SPAC2C4.08 19115423 2542648 4275171..4275902 1 NC_003424.3 conserved fungal protein 4275902 2542648 SPAC2C4.08 Schizosaccharomyces pombe 972h- conserved fungal protein NP_594511.1 4275171 D 284812 CDS SPAC2C4.09 19115424 2542033 join(4276024..4276244,4276294..4276680,4276744..4276786) 1 NC_003424.3 DUF1640 family protein 4276786 2542033 SPAC2C4.09 Schizosaccharomyces pombe 972h- DUF1640 family protein NP_594512.1 4276024 D 284812 CDS SPAC2C4.10c 19115425 2542650 complement(join(4277153..4277317,4277370..4277582,4277652..4277774)) 1 NC_003424.3 sequence orphan 4277774 2542650 SPAC2C4.10c Schizosaccharomyces pombe 972h- sequence orphan NP_594513.1 4277153 R 284812 CDS SPAC2C4.11c 295443048 2541679 complement(join(4278729..4279405,4279457..4279505)) 1 NC_003424.3 ribosome-nucleus export from GO:0006913 and GO:0006364; RNA-binding protein Rbp28 4279505 rbp28 2541679 rbp28 Schizosaccharomyces pombe 972h- RNA-binding protein Rbp28 NP_594514.2 4278729 R 284812 CDS SPAC2C4.12c 19115427 2541572 complement(4279873..4280958) 1 NC_003424.3 tRNA 2'-phosphotransferase Tpt1 (predicted) 4280958 2541572 SPAC2C4.12c Schizosaccharomyces pombe 972h- tRNA 2'-phosphotransferase Tpt1 (predicted) NP_594515.1 4279873 R 284812 CDS SPAC2C4.13 19115428 2541999 4281493..4282092 1 NC_003424.3 V-type ATPase subunit c'' 4282092 vma16 2541999 vma16 Schizosaccharomyces pombe 972h- V-type ATPase subunit c'' NP_594516.1 4281493 D 284812 CDS SPAC2C4.14c 19115429 2541473 complement(4283515..4284453) 1 NC_003424.3 PAK-related kinase Ppk11 4284453 ppk11 2541473 ppk11 Schizosaccharomyces pombe 972h- PAK-related kinase Ppk11 NP_594517.1 4283515 R 284812 CDS SPAC2C4.15c 19115430 2541532 complement(4284918..4286201) 1 NC_003424.3 UBX domain protein Ubx2 4286201 ubx2 2541532 ubx2 Schizosaccharomyces pombe 972h- UBX domain protein Ubx2 NP_594518.1 4284918 R 284812 CDS SPAC2C4.16c 19115431 2541491 complement(4286813..4287415) 1 NC_003424.3 40S ribosomal protein S8 4287415 rps801 2541491 rps801 Schizosaccharomyces pombe 972h- 40S ribosomal protein S8 NP_594519.1 4286813 R 284812 CDS SPAC2C4.17c 19115432 2541425 complement(4288401..4290923) 1 NC_003424.3 MS ion channel protein 2 4290923 2541425 SPAC2C4.17c Schizosaccharomyces pombe 972h- MS ion channel protein 2 NP_594520.1 4288401 R 284812 CDS SPAC25G10.01 162312534 3361412 4295376..4296269 1 NC_003424.3 RNA-binding protein 4296269 3361412 SPAC25G10.01 Schizosaccharomyces pombe 972h- RNA-binding protein XP_001713104.1 4295376 D 284812 CDS SPAC25G10.02 19115434 2542736 complement(4297129..4297905) 1 NC_003424.3 mitochondrial cruciform cutting endonuclease Cce1 4297905 cce1 2542736 cce1 Schizosaccharomyces pombe 972h- mitochondrial cruciform cutting endonuclease Cce1 NP_594522.1 4297129 R 284812 CDS SPAC25G10.03 19115435 2542707 4300066..4301058 1 NC_003424.3 transcription factor Zip1 4301058 zip1 2542707 zip1 Schizosaccharomyces pombe 972h- transcription factor Zip1 NP_594523.1 4300066 D 284812 CDS SPAC25G10.04c 19115436 2541688 complement(4301402..4303777) 1 NC_003424.3 orthology prediction from; meiotic recombination protein Rec10 4303777 rec10 2541688 rec10 Schizosaccharomyces pombe 972h- meiotic recombination protein Rec10 NP_594524.1 4301402 R 284812 CDS SPAC25G10.05c 19115437 2542720 complement(join(4304689..4305569,4305729..4305780)) 1 NC_003424.3 ATP phosphoribosyltransferase 4305780 his1 2542720 his1 Schizosaccharomyces pombe 972h- ATP phosphoribosyltransferase NP_594525.1 4304689 R 284812 CDS SPAC25G10.06 19115438 2542751 join(4305971..4306038,4306188..4306326) 1 NC_003424.3 40S ribosomal protein S28 4306326 rps2801 2542751 rps2801 Schizosaccharomyces pombe 972h- 40S ribosomal protein S28 NP_594526.1 4305971 D 284812 CDS SPAC25G10.07c 19115439 2542732 complement(4306719..4309976) 1 NC_003424.3 kinesin-like protein Cut7 4309976 cut7 2542732 cut7 Schizosaccharomyces pombe 972h- kinesin-like protein Cut7 NP_594527.1 4306719 R 284812 CDS SPAC25G10.08 19115440 2542090 4310579..4312756 1 NC_003424.3 translation initiation factor eIF3b (p84) 4312756 2542090 SPAC25G10.08 Schizosaccharomyces pombe 972h- translation initiation factor eIF3b (p84) NP_594528.1 4310579 D 284812 CDS SPAC25G10.09c 162312536 5802955 complement(4313221..4318605) 1 NC_003424.3 actin cortical patch component, with EF hand and WH2 motif Panl (predicted) 4318605 pan1 5802955 pan1 Schizosaccharomyces pombe 972h- actin cortical patch component, with EF hand and WH2 motif Panl (predicted) XP_001713105.1 4313221 R 284812 CDS SPAC27F1.02c 19115442 2541940 complement(join(4319660..4320127,4320187..4320204)) 1 NC_003424.3 tropomyosin 4320204 cdc8 2541940 cdc8 Schizosaccharomyces pombe 972h- tropomyosin NP_594530.1 4319660 R 284812 CDS SPAC27F1.03c 19115443 2541733 complement(4320807..4321475) 1 NC_003424.3 ubiquitin C-terminal hydrolase Uch1 4321475 uch1 2541733 uch1 Schizosaccharomyces pombe 972h- ubiquitin C-terminal hydrolase Uch1 NP_594531.1 4320807 R 284812 CDS SPAC27F1.04c 19115444 2542004 complement(4321882..4323207) 1 NC_003424.3 spindle pole body protein Nuf2 4323207 nuf2 2542004 nuf2 Schizosaccharomyces pombe 972h- spindle pole body protein Nuf2 NP_594532.1 4321882 R 284812 CDS SPAC27F1.05c 19115445 2541971 complement(4323652..4325106) 1 NC_003424.3 aminotransferase class-III, unknown specificty 4325106 2541971 SPAC27F1.05c Schizosaccharomyces pombe 972h- aminotransferase class-III, unknown specificty NP_594533.1 4323652 R 284812 CDS SPAC27F1.10 19115446 2542562 complement(4326488..4326793) 1 NC_003424.3 previously annotated as dubious, but has localization signal; sequence orphan 4326793 2542562 SPAC27F1.10 Schizosaccharomyces pombe 972h- sequence orphan NP_594534.1 4326488 R 284812 CDS SPAC27F1.06c 19115447 2541479 complement(4327283..4328371) 1 NC_003424.3 FKBP-type peptidyl-prolyl cis-trans isomerase (predicted) 4328371 2541479 SPAC27F1.06c Schizosaccharomyces pombe 972h- FKBP-type peptidyl-prolyl cis-trans isomerase (predicted) NP_594535.1 4327283 R 284812 CDS SPAC27F1.07 19115448 2541636 4329104..4330456 1 NC_003424.3 dolichyl-diphospho-oligosaccharide-protein glycosyltransferase (predicted) 4330456 2541636 SPAC27F1.07 Schizosaccharomyces pombe 972h- dolichyl-diphospho-oligosaccharide-protein glycosyltransferase (predicted) NP_594536.1 4329104 D 284812 CDS SPAC27F1.08 19115449 2542283 4331339..4332904 1 NC_003424.3 Nramp family manganese ion transporter 4332904 pdt1 2542283 pdt1 Schizosaccharomyces pombe 972h- Nramp family manganese ion transporter NP_594537.1 4331339 D 284812 CDS SPAC27F1.09c 19115450 2541619 complement(join(4333170..4336726,4336778..4336787)) 1 NC_003424.3 U2 snRNP-associated protein Sap155 4336787 prp10 2541619 prp10 Schizosaccharomyces pombe 972h- U2 snRNP-associated protein Sap155 NP_594538.1 4333170 R 284812 CDS SPAC23D3.01 19115451 2542067 4337248..4338471 1 NC_003424.3 PWWP domain protein 4338471 2542067 SPAC23D3.01 Schizosaccharomyces pombe 972h- PWWP domain protein NP_594539.1 4337248 D 284812 CDS SPAC23D3.02 19115452 2541908 join(4338742..4338815,4338868..4339816) 1 NC_003424.3 DNA replication factor C complex subunit Rfc2 4339816 rfc2 2541908 rfc2 Schizosaccharomyces pombe 972h- DNA replication factor C complex subunit Rfc2 NP_594540.1 4338742 D 284812 CDS SPAC23D3.03c 19115453 2541482 complement(4340146..4341564) 1 NC_003424.3 GTPase activating protein (predicted) 4341564 2541482 SPAC23D3.03c Schizosaccharomyces pombe 972h- GTPase activating protein (predicted) NP_594541.1 4340146 R 284812 CDS SPAC23D3.04c 19115454 2541502 complement(4342487..4343608) 1 NC_003424.3 glycerol-3-phosphate dehydrogenase Gpd2 4343608 gpd2 2541502 gpd2 Schizosaccharomyces pombe 972h- glycerol-3-phosphate dehydrogenase Gpd2 NP_594542.1 4342487 R 284812 CDS SPAC23D3.06c 19115455 2541507 complement(join(4346602..4350480,4350522..4350620)) 1 NC_003424.3 nucleoporin Nup146 4350620 nup146 2541507 nup146 Schizosaccharomyces pombe 972h- nucleoporin Nup146 NP_594543.1 4346602 R 284812 CDS SPAC23D3.07 19115456 2541805 join(4351018..4351067,4351133..4351278,4351327..4351934) 1 NC_003424.3 20S proteasome component beta 2 4351934 pup1 2541805 pup1 Schizosaccharomyces pombe 972h- 20S proteasome component beta 2 NP_594544.1 4351018 D 284812 CDS SPAC23D3.08 295443051 2541487 join(4352514..4353359,4353410..4353577) 1 NC_003424.3 U1 snRNP-associated protein Usp108 4353577 usp108 2541487 usp108 Schizosaccharomyces pombe 972h- U1 snRNP-associated protein Usp108 NP_594545.2 4352514 D 284812 CDS SPAC23D3.09 19115458 2541496 complement(4353826..4355118) 1 NC_003424.3 SWI/SNF and RSC complex subunit Arp42 4355118 arp42 2541496 arp42 Schizosaccharomyces pombe 972h- SWI/SNF and RSC complex subunit Arp42 NP_594546.1 4353826 R 284812 CDS SPAC23D3.10c 19115459 2541480 complement(4355703..4357823) 1 NC_003424.3 endo-1,3-beta-glucanase Eng2 4357823 eng2 2541480 eng2 Schizosaccharomyces pombe 972h- endo-1,3-beta-glucanase Eng2 NP_594547.1 4355703 R 284812 CDS SPAC23D3.11 19115460 2541489 4358849..4359739 1 NC_003424.3 1-acyldihydroxyacetone phosphate reductase (predicted) 4359739 ayr1 2541489 ayr1 Schizosaccharomyces pombe 972h- 1-acyldihydroxyacetone phosphate reductase (predicted) NP_594548.1 4358849 D 284812 CDS SPAC23D3.12 19115461 2541484 4362901..4364580 1 NC_003424.3 inorganic phosphate transporter (predicted) 4364580 2541484 SPAC23D3.12 Schizosaccharomyces pombe 972h- inorganic phosphate transporter (predicted) NP_594549.1 4362901 D 284812 CDS SPAC23D3.16 295443053 9407207 join(4365700..4365734,4365789..4365852) 1 NC_003424.3 intron from Solexa transread data; sequence orphan 4365852 9407207 SPAC23D3.16 Schizosaccharomyces pombe 972h- sequence orphan XP_002742514.1 4365700 D 284812 CDS SPAC23D3.17 295443055 9407075 complement(join(4366509..4366563,4366611..4366753)) 1 NC_003424.3 conserved fungal protein 4366753 9407075 SPAC23D3.17 Schizosaccharomyces pombe 972h- conserved fungal protein XP_002742515.1 4366509 R 284812 CDS SPAC23D3.13c 19115462 2541486 complement(join(4367707..4372284,4372347..4372471,4372524..4372590,4372632..4372712)) 1 NC_003424.3 guanyl-nucleotide exchange factor (predicted) 4372712 2541486 SPAC23D3.13c Schizosaccharomyces pombe 972h- guanyl-nucleotide exchange factor (predicted) NP_594550.1 4367707 R 284812 CDS SPAC23D3.14c 19115463 2541501 complement(join(4373039..4373326,4373371..4374258,4374377..4374691,4374733..4374987)) 1 NC_003424.3 alpha-amylase homolog Aah2 4374987 aah2 2541501 aah2 Schizosaccharomyces pombe 972h- alpha-amylase homolog Aah2 NP_594551.1 4373039 R 284812 CDS SPAC1527.01 68001020 3361410 4375499..4382692 1 NC_003424.3 alpha-1,3-glucan synthase Mok11 4382692 mok11 3361410 mok11 Schizosaccharomyces pombe 972h- alpha-1,3-glucan synthase Mok11 NP_001018282.1 4375499 D 284812 CDS SPAC1527.02 19115465 2541611 join(4383203..4383211,4383265..4383593,4383750..4384017) 1 NC_003424.3 Golgi transport protein Sft2 (predicted) 4384017 sft2 2541611 sft2 Schizosaccharomyces pombe 972h- Golgi transport protein Sft2 (predicted) NP_594553.1 4383203 D 284812 CDS SPAC1527.03 19115466 2541645 4384659..4386086 1 NC_003424.3 RNA-binding protein 4386086 2541645 SPAC1527.03 Schizosaccharomyces pombe 972h- RNA-binding protein NP_594554.1 4384659 D 284812 CDS SPAC30.01c 19115467 2542107 complement(4386956..4392424) 1 NC_003424.3 Sec7 domain protein, ARF GEF (predicted) 4392424 sec72 2542107 sec72 Schizosaccharomyces pombe 972h- Sec7 domain protein, ARF GEF (predicted) NP_594555.1 4386956 R 284812 CDS SPAC30.02c 19115468 2542458 complement(join(4392899..4393572,4393718..4393889)) 1 NC_003424.3 elongator complex associated protein Kti2 (predicted) 4393889 2542458 SPAC30.02c Schizosaccharomyces pombe 972h- elongator complex associated protein Kti2 (predicted) NP_594556.1 4392899 R 284812 CDS SPAC30.03c 295443057 2541714 complement(join(4394707..4394741,4394799..4394967,4395010..4395092,4395131..4395367,4395416..4395491,4395530..4395592)) 1 NC_003424.3 translin 4395592 tsn1 2541714 tsn1 Schizosaccharomyces pombe 972h- translin NP_594557.2 4394707 R 284812 CDS SPAC30.04c 19115470 2543059 complement(4395932..4400341) 1 NC_003424.3 glutathione S-conjugate-exporting ATPase Abc4 4400341 abc4 2543059 abc4 Schizosaccharomyces pombe 972h- glutathione S-conjugate-exporting ATPase Abc4 NP_594558.1 4395932 R 284812 CDS SPAC29E6.01 19115471 2541707 join(4402017..4402143,4402219..4402313,4402365..4403663) 1 NC_003424.3 F-box protein Pof11 4403663 pof11 2541707 pof11 Schizosaccharomyces pombe 972h- F-box protein Pof11 NP_594559.1 4402017 D 284812 CDS SPAC29E6.02 19115472 2541686 join(4404087..4404167,4404218..4404376,4404423..4405082,4405125..4405435,4405519..4405936) 1 NC_003424.3 U4/U6 x U5 tri-snRNP complex subunit Prp3 (predicted) 4405936 prp3 2541686 prp3 Schizosaccharomyces pombe 972h- U4/U6 x U5 tri-snRNP complex subunit Prp3 (predicted) NP_594560.1 4404087 D 284812 CDS SPAC29E6.03c 295443059 2542708 complement(join(4405990..4407375,4407447..4409096,4409171..4409338)) 1 NC_003424.3 last exon my be incorrect; NAS needs updating when annotated in SGD; ER to Golgi tethering factor Uso1 (predicted) 4409338 uso1 2542708 uso1 Schizosaccharomyces pombe 972h- ER to Golgi tethering factor Uso1 (predicted) NP_594561.2 4405990 R 284812 CDS SPAC29E6.04 162312538 2541667 join(4409773..4410192,4410194..4410391) 1 NC_003424.3 WARNING: The genomic sequence appears to contain an extra 'G' at position 4410193. This needs to be verified by resequencing. The presumed sequence would lead to a C-term extension to Nnf1 see PMID:17035632. This is represented in the current entry by a frameshift at 4410192, and an N terminal extension from 4410194..4410391 to give the correct translation; term=likely sequence error is represented as short intron; kinetochore protein Nnf1 4410391 nnf1 2541667 nnf1 Schizosaccharomyces pombe 972h- kinetochore protein Nnf1 NP_594562.2 4409773 D 284812 CDS SPAC29E6.05c 19115475 2542181 complement(join(4410605..4410633,4410689..4411172)) 1 NC_003424.3 peptide methionine sulfoxide reductase (predicted) 4411172 2542181 SPAC29E6.05c Schizosaccharomyces pombe 972h- peptide methionine sulfoxide reductase (predicted) NP_594563.1 4410605 R 284812 CDS SPAC29E6.06c 19115476 2542721 complement(4411655..4413919) 1 NC_003424.3 cytoplasmic cysteine-tRNA ligase Crs1 (predicted) 4413919 2542721 SPAC29E6.06c Schizosaccharomyces pombe 972h- cytoplasmic cysteine-tRNA ligase Crs1 (predicted) NP_594564.1 4411655 R 284812 CDS SPAC29E6.07 19115477 2541692 4414824..4415174 1 NC_003424.3 previously annotated as dubious; sequence orphan 4415174 2541692 SPAC29E6.07 Schizosaccharomyces pombe 972h- sequence orphan NP_594565.1 4414824 D 284812 CDS SPAC29E6.08 19115478 2541582 join(4415547..4415749,4416005..4416065,4416118..4416378,4416449..4416619) 1 NC_003424.3 TATA-binding protein (TBP) 4416619 tbp1 2541582 tbp1 Schizosaccharomyces pombe 972h- TATA-binding protein (TBP) NP_594566.1 4415547 D 284812 CDS SPAC29E6.09 19115479 2541597 4417470..4418489 1 NC_003424.3 sequence orphan 4418489 2541597 SPAC29E6.09 Schizosaccharomyces pombe 972h- sequence orphan NP_594567.1 4417470 D 284812 CDS SPAC29E6.10c 19115480 2542488 complement(4418954..4422211) 1 NC_003424.3 conserved fungal protein 4422211 2542488 SPAC29E6.10c Schizosaccharomyces pombe 972h- conserved fungal protein NP_594568.1 4418954 R 284812 CDS SPAC16.01 19115481 2542773 join(4423002..4423027,4423112..4423190,4423307..4423312,4423366..4423404,4423517..4423557,4423626..4423644,4423693..4423785,4423830..4423964,4424012..4424176) 1 NC_003424.3 Rho family GTPase Rho2 4424176 rho2 2542773 rho2 Schizosaccharomyces pombe 972h- Rho family GTPase Rho2 NP_594569.1 4423002 D 284812 CDS SPAC16.02c 19115482 2542772 complement(join(4425250..4425837,4425893..4425992,4426037..4426110,4426199..4426268,4426459..4426527,4426577..4426601,4426654..4426659,4426700..4426736,4426793..4426878,4426923..4426965)) 1 NC_003424.3 mRNA export factor Srp2 4426965 srp2 2542772 srp2 Schizosaccharomyces pombe 972h- mRNA export factor Srp2 NP_594570.1 4425250 R 284812 CDS SPAC16.03c 19115483 2542745 complement(join(4427715..4428611,4428689..4428805)) 1 NC_003424.3 dihydroorotase Ura2 (predicted) 4428805 ura2 2542745 ura2 Schizosaccharomyces pombe 972h- dihydroorotase Ura2 (predicted) NP_594571.1 4427715 R 284812 CDS SPAC16.04 19115484 2541573 join(4429684..4429724,4429773..4431585) 1 NC_003424.3 tRNA dihydrouridine synthase Dus3 (predicted) 4431585 dus3 2541573 dus3 Schizosaccharomyces pombe 972h- tRNA dihydrouridine synthase Dus3 (predicted) NP_594572.1 4429684 D 284812 CDS SPAC16.05c 19115485 2541598 complement(4432304..4433632) 1 NC_003424.3 transcription factor Sfp1 (predicted) 4433632 sfp1 2541598 sfp1 Schizosaccharomyces pombe 972h- transcription factor Sfp1 (predicted) NP_594573.1 4432304 R 284812 CDS SPAC9E9.01 19115486 2543299 join(4434861..4434897,4434939..4435201) 1 NC_003424.3 dubious 4435201 2543299 SPAC9E9.01 Schizosaccharomyces pombe 972h- dubious NP_594574.1 4434861 D 284812 CDS SPAC9E9.02 162312541 5802957 complement(4435617..4435913) 1 NC_003424.3 dubious 4435913 5802957 SPAC9E9.02 Schizosaccharomyces pombe 972h- dubious XP_001713106.1 4435617 R 284812 CDS SPAC9E9.17c 162312543 2542866 complement(join(4437311..4437401,4437606..4437648,4437732..4437813,4437860..4437862)) 1 NC_003424.3 has a good correlation score and good consensus intron; gene prediction extended 29-08-05; dubious 4437862 2542866 SPAC9E9.17c Schizosaccharomyces pombe 972h- dubious NP_594575.2 4437311 R 284812 CDS SPAC9E9.03 19115488 2543296 4440096..4442372 1 NC_003424.3 3-isopropylmalate dehydratase Leu2 (predicted) 4442372 leu2 2543296 leu2 Schizosaccharomyces pombe 972h- 3-isopropylmalate dehydratase Leu2 (predicted) NP_594576.1 4440096 D 284812 CDS SPAC9E9.04 19115489 2543291 join(4443078..4443233,4443519..4443929) 1 NC_003424.3 bcap family homolog 4443929 2543291 SPAC9E9.04 Schizosaccharomyces pombe 972h- bcap family homolog NP_594577.1 4443078 D 284812 CDS SPAC9E9.05 19115490 2543287 4444461..4445402 1 NC_003424.3 candidate ortholog of S. cerevisiae YPR171W, similarity is low but reciprocal best hits; sequence orphan 4445402 2543287 SPAC9E9.05 Schizosaccharomyces pombe 972h- sequence orphan NP_594578.1 4444461 D 284812 CDS SPAC9E9.06c 19115491 2542653 complement(join(4445866..4447341,4447400..4447468)) 1 NC_003424.3 threonine synthase (predicted) 4447468 2542653 SPAC9E9.06c Schizosaccharomyces pombe 972h- threonine synthase (predicted) NP_594579.1 4445866 R 284812 CDS SPAC9E9.07c 19115492 2543280 complement(4448915..4449517) 1 NC_003424.3 GTPase Ypt2 4449517 ypt2 2543280 ypt2 Schizosaccharomyces pombe 972h- GTPase Ypt2 NP_594580.1 4448915 R 284812 CDS SPAC9E9.08 19115493 2543289 join(4451115..4451864,4451920..4452585,4452641..4453069) 1 NC_003424.3 ATRIP 4453069 rad26 2543289 rad26 Schizosaccharomyces pombe 972h- ATRIP NP_594581.1 4451115 D 284812 CDS SPAC9E9.09c 19115494 2542976 complement(4453560..4455071) 1 NC_003424.3 aldehyde dehydrogenase (predicted) 4455071 2542976 SPAC9E9.09c Schizosaccharomyces pombe 972h- aldehyde dehydrogenase (predicted) NP_594582.1 4453560 R 284812 CDS SPAC9E9.10c 19115495 2543290 complement(4459225..4460769) 1 NC_003424.3 CENP-B homolog Cbh1 4460769 cbh1 2543290 cbh1 Schizosaccharomyces pombe 972h- CENP-B homolog Cbh1 NP_594583.1 4459225 R 284812 CDS SPAC9E9.11 19115496 2542917 4461784..4462785 1 NC_003424.3 pyridoxal reductase Plr1 4462785 plr1 2542917 plr1 Schizosaccharomyces pombe 972h- pyridoxal reductase Plr1 NP_594584.1 4461784 D 284812 CDS SPAC9E9.12c 19115497 2542640 complement(4463079..4467362) 1 NC_003424.3 abc1 is the primary name for SPBC2D10.18; ABC transporter Ybt1 4467362 ybt1 2542640 ybt1 Schizosaccharomyces pombe 972h- ABC transporter Ybt1 NP_594585.1 4463079 R 284812 CDS SPAC9E9.13 19115498 2542472 complement(join(4468236..4468768,4468968..4468995)) 1 NC_003424.3 alternative polyadenylation sites in 3' UTR results in the production of the 3 differently sized transcripts (PMID 12207226); p23 homolog Wos2 4468995 wos2 2542472 wos2 Schizosaccharomyces pombe 972h- p23 homolog Wos2 NP_594586.1 4468236 R 284812 CDS SPAC9E9.14 19115499 2542234 4469661..4470356 1 NC_003424.3 vacuolar sorting protein Vps24 4470356 vps24 2542234 vps24 Schizosaccharomyces pombe 972h- vacuolar sorting protein Vps24 NP_594587.1 4469661 D 284812 CDS SPAC9E9.15 19115500 2542323 4470681..4471340 1 NC_003424.3 CIA30 family protein 4471340 2542323 SPAC9E9.15 Schizosaccharomyces pombe 972h- CIA30 family protein NP_594588.1 4470681 D 284812 CDS SPAC17C9.16c 162312545 2542190 join(4472611..4473271,4473325..4474259) 1 NC_003424.3 MFS family transmembrane transporter Mfs1 4474259 2542190 SPAC17C9.16c Schizosaccharomyces pombe 972h- MFS family transmembrane transporter Mfs1 XP_001713107.1 4472611 D 284812 CDS SPAC17C9.15c 19115503 2542202 4475290..4475574 1 NC_003424.3 previously annotated as dubious, but has localization signal; sequence orphan 4475574 2542202 SPAC17C9.15c Schizosaccharomyces pombe 972h- sequence orphan NP_594591.1 4475290 D 284812 CDS SPAC17C9.14 19115504 2542186 complement(join(4475870..4476474,4476617..4476710)) 1 NC_003424.3 Pex19 protein family 4476710 2542186 SPAC17C9.14 Schizosaccharomyces pombe 972h- Pex19 protein family NP_594592.1 4475870 R 284812 CDS SPAC17C9.13c 19115505 2542184 4477850..4478638 1 NC_003424.3 tethering factor for nuclear proteasome Cut8 4478638 cut8 2542184 cut8 Schizosaccharomyces pombe 972h- tethering factor for nuclear proteasome Cut8 NP_594593.1 4477850 D 284812 CDS SPAC17C9.12 19115506 2542179 complement(join(4478642..4479295,4479377..4479492,4479722..4479911)) 1 NC_003424.3 MSP domain 4479911 2542179 SPAC17C9.12 Schizosaccharomyces pombe 972h- MSP domain NP_594594.1 4478642 R 284812 CDS SPAC17C9.11c 19115507 2542167 join(4480905..4481012,4481158..4481734,4481893..4481930) 1 NC_003424.3 zf-C2H2 type zinc finger protein/UBA domain protein 4481930 2542167 SPAC17C9.11c Schizosaccharomyces pombe 972h- zf-C2H2 type zinc finger protein/UBA domain protein NP_594595.1 4480905 D 284812 CDS SPAC17C9.10 19115508 2542262 complement(4481960..4482775) 1 NC_003424.3 G-protein coupled receptor Stm1 4482775 stm1 2542262 stm1 Schizosaccharomyces pombe 972h- G-protein coupled receptor Stm1 NP_594596.1 4481960 R 284812 CDS SPAC17C9.09c 19115509 2542145 join(4484078..4484194,4484253..4484321,4484365..4484466) 1 NC_003424.3 TIM22 inner membrane protein import complex subunit Tim13 4484466 tim13 2542145 tim13 Schizosaccharomyces pombe 972h- TIM22 inner membrane protein import complex subunit Tim13 NP_594597.1 4484078 D 284812 CDS SPAC17C9.08 295443061 2542291 complement(join(4484835..4485274,4485350..4485596,4485713..4485994)) 1 NC_003424.3 mitochondrial endodeoxyribonuclease Pnu1 4485994 pnu1 2542291 pnu1 Schizosaccharomyces pombe 972h- mitochondrial endodeoxyribonuclease Pnu1 NP_594598.2 4484835 R 284812 CDS SPAC17C9.07 19115511 2542143 complement(4486562..4488067) 1 NC_003424.3 glucosyltransferase Alg8 4488067 alg8 2542143 alg8 Schizosaccharomyces pombe 972h- glucosyltransferase Alg8 NP_594599.1 4486562 R 284812 CDS SPAC17C9.06 19115512 2542441 complement(join(4488784..4490106,4490188..4490292)) 1 NC_003424.3 SAM complex subunit Sam50 (predicted) 4490292 sam50 2542441 sam50 Schizosaccharomyces pombe 972h- SAM complex subunit Sam50 (predicted) NP_594600.1 4488784 R 284812 CDS SPAC17C9.05c 19115513 2542141 join(4490536..4490610,4490648..4490711,4490837..4490914,4490961..4491382,4491432..4491614) 1 NC_003424.3 Pombe Mediator Component 3; mediator complex subunit Pmc3 4491614 pmc3 2542141 pmc3 Schizosaccharomyces pombe 972h- mediator complex subunit Pmc3 NP_594601.1 4490536 D 284812 CDS SPAC17C9.03 19115514 2542290 complement(4492093..4496304) 1 NC_003424.3 translation initiation factor eIF4G 4496304 tif471 2542290 tif471 Schizosaccharomyces pombe 972h- translation initiation factor eIF4G NP_594602.1 4492093 R 284812 CDS SPAC17C9.02c 19115515 2542118 join(4496970..4497032,4497076..4497789) 1 NC_003424.3 alpha-aminoadipate reductase phosphopantetheinyl transferase Lys7 4497789 lys7 2542118 lys7 Schizosaccharomyces pombe 972h- alpha-aminoadipate reductase phosphopantetheinyl transferase Lys7 NP_594603.1 4496970 D 284812 CDS SPAC17C9.01c 63054637 2542438 join(4498132..4498435,4498481..4498651,4498758..4500280) 1 NC_003424.3 anaphase-promoting complex subunit Apc3 4500280 nuc2 2542438 nuc2 Schizosaccharomyces pombe 972h- anaphase-promoting complex subunit Apc3 NP_594604.2 4498132 D 284812 CDS SPAC1851.02 19115517 2542560 join(4500634..4500959,4501023..4501536) 1 NC_003424.3 1-acylglycerol-3-phosphate O-acyltransferase (predicted) 4501536 2542560 SPAC1851.02 Schizosaccharomyces pombe 972h- 1-acylglycerol-3-phosphate O-acyltransferase (predicted) NP_594605.1 4500634 D 284812 CDS SPAC1851.03 19115518 2542564 join(4502408..4502430,4502510..4502789,4502995..4503387) 1 NC_003424.3 CK2 family regulatory subunit Ckb1 4503387 ckb1 2542564 ckb1 Schizosaccharomyces pombe 972h- CK2 family regulatory subunit Ckb1 NP_594606.1 4502408 D 284812 CDS SPAC1851.04c 63054638 2542510 complement(4503683..4506841) 1 NC_003424.3 guanyl-nucleotide exchange factor (predicted) 4506841 2542510 SPAC1851.04c Schizosaccharomyces pombe 972h- guanyl-nucleotide exchange factor (predicted) NP_594607.2 4503683 R 284812 CDS SPAC27D7.02c 19115520 2541525 complement(4507598..4509850) 1 NC_003424.3 GRIP domain protein 4509850 2541525 SPAC27D7.02c Schizosaccharomyces pombe 972h- GRIP domain protein NP_594608.1 4507598 R 284812 CDS SPAC27D7.03c 19115521 2542080 complement(4511040..4513292) 1 NC_003424.3 RNA-binding protein involved in meiosis Mei2 4513292 mei2 2542080 mei2 Schizosaccharomyces pombe 972h- RNA-binding protein involved in meiosis Mei2 NP_594609.1 4511040 R 284812 CDS SPAC27D7.04 19115522 2541617 4517542..4517832 1 NC_003424.3 4-alpha-hydroxytetrahydrobiopterin dehydratase (predicted) 4517832 omt2 5802960 omt2 Schizosaccharomyces pombe 972h- 4-alpha-hydroxytetrahydrobiopterin dehydratase (predicted) NP_594610.1 4517542 D 284812 CDS SPAC27D7.05c 19115523 2542211 complement(4517973..4518296) 1 NC_003424.3 anaphase-promoting complex subunit Apc14 4518296 apc14 2542211 apc14 Schizosaccharomyces pombe 972h- anaphase-promoting complex subunit Apc14 NP_594611.1 4517973 R 284812 CDS SPAC27D7.06 19115524 2542075 4519046..4520071 1 NC_003424.3 electron transfer flavoprotein alpha subunit 4520071 2542075 SPAC27D7.06 Schizosaccharomyces pombe 972h- electron transfer flavoprotein alpha subunit NP_594612.1 4519046 D 284812 CDS SPAC27D7.07c 19115525 2542690 complement(join(4520538..4520827,4520884..4520933,4520977..4520990)) 1 NC_003424.3 Sm snRNP core protein Smd1 4520990 smd1 2542690 smd1 Schizosaccharomyces pombe 972h- Sm snRNP core protein Smd1 NP_594613.1 4520538 R 284812 CDS SPAC27D7.08c 19115526 2542223 complement(join(4521472..4521846,4521903..4521992,4522040..4522416,4522465..4522619,4522666..4522676,4522755..4522830,4522877..4522950)) 1 NC_003424.3 DUF890 family protein 4522950 2542223 SPAC27D7.08c Schizosaccharomyces pombe 972h- DUF890 family protein NP_594614.1 4521472 R 284812 CDS SPAC27D7.09c 19115527 2542693 complement(4523388..4524539) 1 NC_003424.3 WARNING: the sequence previously referred to as SPAC27D7.10c was a duplication caused by missassembly of the cosmid. In future releases this region will be removed and SPAC27D7.10c will merge into SPAC27D7.09c.Therefore SPAC27D7.09c and SPAC27D7.10c refer to the same CDS; But2 family protein 4524539 2542693 SPAC27D7.09c Schizosaccharomyces pombe 972h- But2 family protein NP_594615.1 4523388 R 284812 CDS SPAC27D7.11c 19115529 2541615 complement(4529462..4530853) 1 NC_003424.3 But2 family protein 4530853 2541615 SPAC27D7.11c Schizosaccharomyces pombe 972h- But2 family protein NP_594617.1 4529462 R 284812 CDS SPAC27D7.12c 68001206 3361403 complement(4533517..4534248) 1 NC_003424.3 neddylation pathway protein But1 4534248 but1 3361403 but1 Schizosaccharomyces pombe 972h- neddylation pathway protein But1 NP_001018283.1 4533517 R 284812 CDS SPAC27D7.13c 19115531 2542069 complement(4534674..4536686) 1 NC_003424.3 p150-Glued 4536686 ssm4 2542069 ssm4 Schizosaccharomyces pombe 972h- p150-Glued NP_594619.1 4534674 R 284812 CDS SPAC27D7.14c 19115532 2542077 complement(4537135..4540254) 1 NC_003424.3 RNA polymerase II associated Paf1 complex subunit Tpr1 4540254 tpr1 2542077 tpr1 Schizosaccharomyces pombe 972h- RNA polymerase II associated Paf1 complex subunit Tpr1 NP_594620.1 4537135 R 284812 CDS SPAC637.03 19115533 2543340 4542554..4543363 1 NC_003424.3 conserved fungal protein 4543363 2543340 SPAC637.03 Schizosaccharomyces pombe 972h- conserved fungal protein NP_594621.1 4542554 D 284812 CDS SPAC637.04 19115534 2543221 join(4544074..4544082,4544122..4544233,4544290..4546757) 1 NC_003424.3 cargo-transport protein Ypp1 (predicted) 4546757 2543221 SPAC637.04 Schizosaccharomyces pombe 972h- cargo-transport protein Ypp1 (predicted) NP_594622.1 4544074 D 284812 CDS SPAC637.05c 19115535 2543408 complement(join(4547080..4547579,4547625..4548474,4548568..4548616,4548675..4548746,4548788..4548828)) 1 NC_003424.3 V-type ATPase V1 subunit B 4548828 vma2 2543408 vma2 Schizosaccharomyces pombe 972h- V-type ATPase V1 subunit B NP_594623.1 4547080 R 284812 CDS SPAC637.06 19115536 2543384 4549926..4550969 1 NC_003424.3 alpha-1,2-galactosyltransferase (predicted) 4550969 2543384 SPAC637.06 Schizosaccharomyces pombe 972h- alpha-1,2-galactosyltransferase (predicted) NP_594624.1 4549926 D 284812 CDS SPAC637.07 19115537 2543412 4551851..4553554 1 NC_003424.3 translation initiation factor eIF3d Moe1 4553554 moe1 2543412 moe1 Schizosaccharomyces pombe 972h- translation initiation factor eIF3d Moe1 NP_594625.1 4551851 D 284812 CDS SPAC637.08 19115538 2543416 4554115..4555068 1 NC_003424.3 iron-sulfur cluster assembly ATPase Nbp35 4555068 2543416 SPAC637.08 Schizosaccharomyces pombe 972h- iron-sulfur cluster assembly ATPase Nbp35 NP_594626.1 4554115 D 284812 CDS SPAC637.09 19115539 2543505 4555423..4557294 1 NC_003424.3 ribonuclease H70 (predicted) 4557294 2543505 SPAC637.09 Schizosaccharomyces pombe 972h- ribonuclease H70 (predicted) NP_594627.1 4555423 D 284812 CDS SPAC637.10c 19115540 2543682 complement(join(4557721..4557955,4558019..4558342,4558422..4558568,4558611..4558636)) 1 NC_003424.3 19S proteasome regulatory subunit Rpn10 4558636 rpn10 2543682 rpn10 Schizosaccharomyces pombe 972h- 19S proteasome regulatory subunit Rpn10 NP_594628.1 4557721 R 284812 CDS SPAC637.11 19115541 2543678 4559293..4561236 1 NC_003424.3 RNA processosome mitochondrial, name derivation; mitochondrial ATP-dependent RNA helicase Rpm2 4561236 rpm2 2543678 rpm2 Schizosaccharomyces pombe 972h- mitochondrial ATP-dependent RNA helicase Rpm2 NP_594629.1 4559293 D 284812 CDS SPAC637.12c 19115542 2543506 complement(4561384..4562775) 1 NC_003424.3 KAT5 family histone acetyltransferase Mst1 4562775 mst1 2543506 mst1 Schizosaccharomyces pombe 972h- KAT5 family histone acetyltransferase Mst1 NP_594630.1 4561384 R 284812 CDS SPAC637.13c 19115543 2543674 complement(4563894..4565390) 1 NC_003424.3 cytoskeletal signaling protein 4565390 2543674 SPAC637.13c Schizosaccharomyces pombe 972h- cytoskeletal signaling protein NP_594631.1 4563894 R 284812 CDS SPAC31F12.01 19115544 2543190 4567307..4570123 1 NC_003424.3 zds family protein phosphatase type A regulator Zds1 (predicted) 4570123 zds1 2543190 zds1 Schizosaccharomyces pombe 972h- zds family protein phosphatase type A regulator Zds1 (predicted) NP_594632.1 4567307 D 284812 CDS SPAC12B10.01c 63054640 2541575 complement(4570498..4575441) 1 NC_003424.3 ubiquitin-protein ligase E3 (predicted) 4575441 2541575 SPAC12B10.01c Schizosaccharomyces pombe 972h- ubiquitin-protein ligase E3 (predicted) NP_594633.2 4570498 R 284812 CDS SPAC12B10.02c 19115546 2543004 complement(4576228..4576935) 1 NC_003424.3 endoplasmic reticulum resident protein required for packaging into COPII vesicles 4576935 2543004 SPAC12B10.02c Schizosaccharomyces pombe 972h- endoplasmic reticulum resident protein required for packaging into COPII vesicles NP_594634.1 4576228 R 284812 CDS SPAC12B10.03 19115547 2542950 4578627..4580258 1 NC_003424.3 WD repeat protein, human WDR20 family 4580258 2542950 SPAC12B10.03 Schizosaccharomyces pombe 972h- WD repeat protein, human WDR20 family NP_594635.1 4578627 D 284812 CDS SPAC12B10.04 19115548 2542924 join(4580824..4581783,4581836..4581919,4581978..4582145) 1 NC_003424.3 tubulin-tyrosine ligase (predicted) 4582145 2542924 SPAC12B10.04 Schizosaccharomyces pombe 972h- tubulin-tyrosine ligase (predicted) NP_594636.1 4580824 D 284812 CDS SPAC12B10.05 19115549 2542952 join(4582378..4582549,4582595..4582697,4582747..4582767,4582807..4582833,4582869..4582882,4582931..4582963,4583007..4583134,4583174..4583557,4583619..4583696,4583740..4583961,4584011..4584118,4584163..4584333) 1 NC_003424.3 mitochondrial metallopeptidase 4584333 2542952 SPAC12B10.05 Schizosaccharomyces pombe 972h- mitochondrial metallopeptidase NP_594637.1 4582378 D 284812 CDS SPAC12B10.06c 19115550 2542705 complement(join(4584550..4584676,4584733..4585025)) 1 NC_003424.3 DUF339 family protein 4585025 2542705 SPAC12B10.06c Schizosaccharomyces pombe 972h- DUF339 family protein NP_594638.1 4584550 R 284812 CDS SPAC12B10.07 19115551 2542679 join(4585255..4585324,4585371..4585564,4585629..4586135) 1 NC_003424.3 F-actin capping protein alpha subunit 4586135 acp1 2542679 acp1 Schizosaccharomyces pombe 972h- F-actin capping protein alpha subunit NP_594639.1 4585255 D 284812 CDS SPAC12B10.08c 19115552 2543003 complement(join(4586584..4587390,4587450..4587937,4587983..4588058)) 1 NC_003424.3 mitochondrial tRNA(Ile)-lysidine synthetase family (predicted) 4588058 2543003 SPAC12B10.08c Schizosaccharomyces pombe 972h- mitochondrial tRNA(Ile)-lysidine synthetase family (predicted) NP_594640.1 4586584 R 284812 CDS SPAC12B10.09 19115553 2542695 join(4588250..4588510,4588567..4588723,4588869..4589323,4589410..4589574) 1 NC_003424.3 S-adenosylmethionine transporter (predicted) 4589574 2542695 SPAC12B10.09 Schizosaccharomyces pombe 972h- S-adenosylmethionine transporter (predicted) NP_594641.1 4588250 D 284812 CDS SPAC12B10.10 19115554 2543030 4590265..4591524 1 NC_003424.3 sequence orphan 4591524 2543030 SPAC12B10.10 Schizosaccharomyces pombe 972h- sequence orphan NP_594642.1 4590265 D 284812 CDS SPAC12B10.11 19115555 2542987 4591855..4593567 1 NC_003424.3 glucan 1,3-beta-glucosidase Exg2 4593567 exg2 2542987 exg2 Schizosaccharomyces pombe 972h- glucan 1,3-beta-glucosidase Exg2 NP_594643.1 4591855 D 284812 CDS SPAC12B10.12c 19115556 2542967 complement(4593873..4595789) 1 NC_003424.3 DNA repair protein Rhp41 4595789 rhp41 2542967 rhp41 Schizosaccharomyces pombe 972h- DNA repair protein Rhp41 NP_594644.1 4593873 R 284812 CDS SPAC12B10.13 19115557 2543008 join(4596439..4596539,4596604..4596799,4596844..4597269) 1 NC_003424.3 CTLH domain 4597269 2543008 SPAC12B10.13 Schizosaccharomyces pombe 972h- CTLH domain NP_594645.1 4596439 D 284812 CDS SPAC12B10.14c 19115558 2543100 complement(join(4597567..4597621,4597680..4599622)) 1 NC_003424.3 serine/threonine protein kinase Ppk2 (predicted) 4599622 ppk2 2543100 ppk2 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Ppk2 (predicted) NP_594646.1 4597567 R 284812 CDS SPAC12B10.15c 19115559 2543211 complement(4600263..4600706) 1 NC_003424.3 S. cerevisiae orthology prediction pers. comm Charly Chahwan; ribonuclease H2 complex subunit 4600706 2543211 SPAC12B10.15c Schizosaccharomyces pombe 972h- ribonuclease H2 complex subunit NP_594647.1 4600263 R 284812 CDS SPAC12B10.16c 19115560 2543213 complement(join(4601527..4602981,4603147..4603221)) 1 NC_003424.3 conserved protein (fungal and bacterial) 4603221 mug157 2543213 mug157 Schizosaccharomyces pombe 972h- conserved protein (fungal and bacterial) NP_594648.1 4601527 R 284812 CDS SPAC1093.01 63054641 2542921 4607632..4611417 1 NC_003424.3 PPR repeat protein 4611417 2542921 SPAC1093.01 Schizosaccharomyces pombe 972h- PPR repeat protein NP_594649.2 4607632 D 284812 CDS SPAC1093.02 19115562 2542998 4612131..4612826 1 NC_003424.3 pyridoxamine 5'-phosphate oxidase (predicted) 4612826 2542998 SPAC1093.02 Schizosaccharomyces pombe 972h- pyridoxamine 5'-phosphate oxidase (predicted) NP_594650.1 4612131 D 284812 CDS SPAC1093.03 295443064 3361401 join(4613627..4613686,4613723..4614081,4614164..4614378,4614438..4614954,4614996..4616331) 1 NC_003424.3 GAG acceptor; inositol polyphosphate phosphatase (predicted) 4616331 3361401 SPAC1093.03 Schizosaccharomyces pombe 972h- inositol polyphosphate phosphatase (predicted) NP_001018284.2 4613627 D 284812 CDS SPAC1093.04c 162312548 2542977 complement(join(4616462..4616623,4616668..4617281,4617353..4617935,4617997..4618140)) 1 NC_003424.3 tRNA nucleotidyltransferase (predicted) 4618140 2542977 SPAC1093.04c Schizosaccharomyces pombe 972h- tRNA nucleotidyltransferase (predicted) NP_594651.2 4616462 R 284812 CDS SPAC1093.05 19115564 2541630 4619693..4621900 1 NC_003424.3 ATP-dependent RNA helicase Hca4 (predicted) 4621900 2541630 SPAC1093.05 Schizosaccharomyces pombe 972h- ATP-dependent RNA helicase Hca4 (predicted) NP_594652.1 4619693 D 284812 CDS SPAC1093.06c 162312550 3361400 complement(4622166..4634756) 1 NC_003424.3 dynein heavy chain Dhc1 4634756 dhc1 3361400 dhc1 Schizosaccharomyces pombe 972h- dynein heavy chain Dhc1 XP_001713108.1 4622166 R 284812 CDS SPAC30C2.02 19115566 2541465 4635747..4636703 1 NC_003424.3 deoxyhypusine hydroxylase (predicted) 4636703 mmd1 2541465 mmd1 Schizosaccharomyces pombe 972h- deoxyhypusine hydroxylase (predicted) NP_594654.1 4635747 D 284812 CDS SPAC30C2.03 19115567 2541703 4637270..4637902 1 NC_003424.3 sequence orphan 4637902 2541703 SPAC30C2.03 Schizosaccharomyces pombe 972h- sequence orphan NP_594655.1 4637270 D 284812 CDS SPAC30C2.04 19115568 2543087 4638117..4639469 1 NC_003424.3 cofactor for methionyl-and glutamyl-tRNA synthetases (predicted) 4639469 2543087 SPAC30C2.04 Schizosaccharomyces pombe 972h- cofactor for methionyl-and glutamyl-tRNA synthetases (predicted) NP_594656.1 4638117 D 284812 CDS SPAC30C2.05 295443066 2543081 join(4639884..4639924,4639969..4640020,4640076..4640365,4640447..4640477) 1 NC_003424.3 cornichon family protein Erv14 4640477 erv14 2543081 erv14 Schizosaccharomyces pombe 972h- cornichon family protein Erv14 NP_594657.2 4639884 D 284812 CDS SPAC30C2.06c 19115570 2542590 complement(4640742..4642139) 1 NC_003424.3 ISS to human from PMID:17349998; mitochondrial inheritance GTPase (predicted) 4642139 dml1 2542590 dml1 Schizosaccharomyces pombe 972h- mitochondrial inheritance GTPase (predicted) NP_594658.1 4640742 R 284812 CDS SPAC30C2.07 19115571 2543076 4642495..4645023 1 NC_003424.3 sequence orphan 4645023 2543076 SPAC30C2.07 Schizosaccharomyces pombe 972h- sequence orphan NP_594659.1 4642495 D 284812 CDS SPAC30C2.08 19115572 2543060 join(4645560..4645722,4645854..4646589,4646646..4646742,4646794..4647171) 1 NC_003424.3 conserved fungal protein 4647171 2543060 SPAC30C2.08 Schizosaccharomyces pombe 972h- conserved fungal protein NP_594660.1 4645560 D 284812 CDS SPAC1635.01 19115573 2542750 4649258..4650106 1 NC_003424.3 mitochondrial outer membrane voltage-dependent anion-selective channel 4650106 2542750 SPAC1635.01 Schizosaccharomyces pombe 972h- mitochondrial outer membrane voltage-dependent anion-selective channel NP_594661.1 4649258 D 284812 CDS SPAC144.01 19115574 2542865 complement(join(4650666..4650764,4650823..4651062)) 1 NC_003424.3 confirmed intron; sequence orphan 4651062 2542865 SPAC144.01 Schizosaccharomyces pombe 972h- sequence orphan NP_594662.1 4650666 R 284812 CDS SPAC144.02 19115575 2542854 4653093..4653842 1 NC_003424.3 Ino80 complex subunit Iec1 4653842 iec1 2542854 iec1 Schizosaccharomyces pombe 972h- Ino80 complex subunit Iec1 NP_594663.1 4653093 D 284812 CDS SPAC144.03 19115576 2542823 join(4654684..4654727,4654767..4654863,4655247..4656410) 1 NC_003424.3 adenylosuccinate synthetase Ade2 4656410 ade2 2542823 ade2 Schizosaccharomyces pombe 972h- adenylosuccinate synthetase Ade2 NP_594664.1 4654684 D 284812 CDS SPAC144.04c 19115577 2542855 complement(4656720..4658018) 1 NC_003424.3 ornithine decarboxylase Spe1 4658018 spe1 2542855 spe1 Schizosaccharomyces pombe 972h- ornithine decarboxylase Spe1 NP_594665.1 4656720 R 284812 CDS SPAC144.05 19115578 2542902 join(4659256..4662577,4662618..4662883,4662922..4663121,4663164..4663204,4663245..4663543) 1 NC_003424.3 ATP-dependent DNA helicase (predicted) 4663543 2542902 SPAC144.05 Schizosaccharomyces pombe 972h- ATP-dependent DNA helicase (predicted) NP_594666.1 4659256 D 284812 CDS SPAC144.06 19115579 2542857 join(4664387..4664545,4664586..4664747,4664799..4666982) 1 NC_003424.3 AP-3 adaptor complex subunit Apl5 (predicted) 4666982 apl5 2542857 apl5 Schizosaccharomyces pombe 972h- AP-3 adaptor complex subunit Apl5 (predicted) NP_594667.1 4664387 D 284812 CDS SPAC144.07c 19115580 2542899 complement(4667394..4668341) 1 NC_003424.3 conserved ATP binding protein 4668341 2542899 SPAC144.07c Schizosaccharomyces pombe 972h- conserved ATP binding protein NP_594668.1 4667394 R 284812 CDS SPAC144.08 19115581 2542900 4668874..4669551 1 NC_003424.3 DNAJ domain protein Jac1 (predicted) 4669551 2542900 SPAC144.08 Schizosaccharomyces pombe 972h- DNAJ domain protein Jac1 (predicted) NP_594669.1 4668874 D 284812 CDS SPAC144.09c 19115582 2542887 complement(join(4669888..4670862,4670906..4671055)) 1 NC_003424.3 RNA polymerase III transcription factor TFIIIA 4671055 sfc2 2542887 sfc2 Schizosaccharomyces pombe 972h- RNA polymerase III transcription factor TFIIIA NP_594670.1 4669888 R 284812 CDS SPAC144.10c 19115583 2542825 complement(4671564..4672943) 1 NC_003424.3 pig-W 4672943 gwt1 2542825 gwt1 Schizosaccharomyces pombe 972h- pig-W NP_594671.1 4671564 R 284812 CDS SPAC144.11 19115584 2542904 4674612..4675070 1 NC_003424.3 40S ribosomal protein S11 4675070 rps1102 2542904 rps1102 Schizosaccharomyces pombe 972h- 40S ribosomal protein S11 NP_594672.1 4674612 D 284812 CDS SPAC144.12 19115585 2542821 4676624..4677448 1 NC_003424.3 Pentose phosphate shunt enzymes are cytoplasmic (Bohringer Biochemical Pathways); ribose 5-phosphate isomerase (predicted) 4677448 2542821 SPAC144.12 Schizosaccharomyces pombe 972h- ribose 5-phosphate isomerase (predicted) NP_594673.1 4676624 D 284812 CDS SPAC144.13c 19115586 2542824 complement(4678386..4680056) 1 NC_003424.3 CDK inhibitor Srw1 4680056 srw1 2542824 srw1 Schizosaccharomyces pombe 972h- CDK inhibitor Srw1 NP_594674.1 4678386 R 284812 CDS SPAC144.14 19115587 2542849 join(4681626..4682276,4682329..4683213) 1 NC_003424.3 kinesin-like protein Klp8 4683213 klp8 2542849 klp8 Schizosaccharomyces pombe 972h- kinesin-like protein Klp8 NP_594675.1 4681626 D 284812 CDS SPAC144.15c 19115588 2542853 complement(4683276..4685381) 1 NC_003424.3 Golgi transport complex subunit Cog1 (predicted) 4685381 cog1 2542853 cog1 Schizosaccharomyces pombe 972h- Golgi transport complex subunit Cog1 (predicted) NP_594676.1 4683276 R 284812 CDS SPAC144.16 19115589 2542897 4686562..4687101 1 NC_003424.3 DUF59 family protein 4687101 2542897 SPAC144.16 Schizosaccharomyces pombe 972h- DUF59 family protein NP_594677.1 4686562 D 284812 CDS SPAC144.17c 295443068 2542894 complement(join(4687388..4687477,4687522..4688462,4688513..4688831)) 1 NC_003424.3 phosphoglycerate mutase family is below threshold; 6-phosphofructo-2-kinase (predicted) 4688831 2542894 SPAC144.17c Schizosaccharomyces pombe 972h- 6-phosphofructo-2-kinase (predicted) NP_594678.2 4687388 R 284812 CDS SPAC144.18 19115591 2542850 4690170..4691207 1 NC_003424.3 nucleotide sugar transporter (predicted) 4691207 2542850 SPAC144.18 Schizosaccharomyces pombe 972h- nucleotide sugar transporter (predicted) NP_594679.1 4690170 D 284812 CDS SPAC1834.01 19115592 2542148 4691927..4693228 1 NC_003424.3 translation release factor eRF1 4693228 sup45 2542148 sup45 Schizosaccharomyces pombe 972h- translation release factor eRF1 NP_594680.1 4691927 D 284812 CDS SPAC1834.02 19115593 2542115 4693771..4698492 1 NC_003424.3 pentafunctional aromatic polypeptide Aro1 (predicted) 4698492 aro1 2542115 aro1 Schizosaccharomyces pombe 972h- pentafunctional aromatic polypeptide Aro1 (predicted) NP_594681.1 4693771 D 284812 CDS SPAC1834.03c 19115594 2542463 complement(4699085..4699396) 1 NC_003424.3 histone H4 h4.1 4699396 hhf1 2542463 hhf1 Schizosaccharomyces pombe 972h- histone H4 h4.1 NP_594682.1 4699085 R 284812 CDS SPAC1834.04 19115595 2542467 4699829..4700239 1 NC_003424.3 histone H3 h3.1 4700239 hht1 2542467 hht1 Schizosaccharomyces pombe 972h- histone H3 h3.1 NP_594683.1 4699829 D 284812 CDS SPAC1834.05 19115596 2542331 4702588..4704321 1 NC_003424.3 mannosyltransferase complex subunit Alg9 (predicted) 4704321 alg9 2542331 alg9 Schizosaccharomyces pombe 972h- mannosyltransferase complex subunit Alg9 (predicted) NP_594684.1 4702588 D 284812 CDS SPAC1834.06c 19115597 2542388 complement(join(4704790..4705224,4705310..4705762,4705818..4705919)) 1 NC_003424.3 mo25 family protein Pmo25 4705919 pmo25 2542388 pmo25 Schizosaccharomyces pombe 972h- mo25 family protein Pmo25 NP_594685.1 4704790 R 284812 CDS SPAC1834.07 19115598 2542195 join(4706915..4707025,4707079..4707178,4707387..4707460,4707506..4707659,4707733..4708958) 1 NC_003424.3 overexpression inhibits mitotic growth (PMID 12132578); kinesin-like protein Klp3 4708958 klp3 2542195 klp3 Schizosaccharomyces pombe 972h- kinesin-like protein Klp3 NP_594686.1 4706915 D 284812 CDS SPAC1834.08 19115599 2542119 join(4709970..4710038,4710139..4714989) 1 NC_003424.3 histidine kinase Mak1 4714989 mak1 2542119 mak1 Schizosaccharomyces pombe 972h- histidine kinase Mak1 NP_594687.1 4709970 D 284812 CDS SPAC1834.09 19115600 2542159 4716570..4717490 1 NC_003424.3 conserved fungal protein 4717490 mug51 2542159 mug51 Schizosaccharomyces pombe 972h- conserved fungal protein NP_594688.1 4716570 D 284812 CDS SPAC1834.10c 19115601 2542624 complement(join(4717714..4718027,4718089..4718311)) 1 NC_003424.3 sequence orphan 4718311 2542624 SPAC1834.10c Schizosaccharomyces pombe 972h- sequence orphan NP_594689.1 4717714 R 284812 CDS SPAC1834.11c 19115602 2542410 complement(4718738..4721116) 1 NC_003424.3 secretory pathway protein Sec18 (predicted) 4721116 sec18 2542410 sec18 Schizosaccharomyces pombe 972h- secretory pathway protein Sec18 (predicted) NP_594690.1 4718738 R 284812 CDS SPAC17D4.01 162312552 5802962 join(4723018..4723048,4723376..4723508,4723638..4724400) 1 NC_003424.3 peroxin-7 (predicted) 4724400 pex7 5802962 pex7 Schizosaccharomyces pombe 972h- peroxin-7 (predicted) XP_001713109.1 4723018 D 284812 CDS SPAC17D4.02 19115605 2542266 join(4724803..4726422,4726464..4726760) 1 NC_003424.3 DNA replication pre-initiation complex subunit Cdc45 4726760 cdc45 2542266 cdc45 Schizosaccharomyces pombe 972h- DNA replication pre-initiation complex subunit Cdc45 NP_594693.1 4724803 D 284812 CDS SPAC17D4.03c 19115606 2542250 complement(4726860..4729058) 1 NC_003424.3 cation diffusion family zinc membrane transporter Cis4 4729058 cis4 2542250 cis4 Schizosaccharomyces pombe 972h- cation diffusion family zinc membrane transporter Cis4 NP_594694.1 4726860 R 284812 CDS SPAC17D4.04 63054645 2542264 join(4729888..4730042,4730088..4731897) 1 NC_003424.3 tRNA (cytosine-5-)-methyltransferase (predicted) 4731897 2542264 SPAC17D4.04 Schizosaccharomyces pombe 972h- tRNA (cytosine-5-)-methyltransferase (predicted) NP_594695.2 4729888 D 284812 CDS SPAC458.02c 19115608 2543631 complement(join(4732192..4733328,4733426..4733599,4733720..4733815)) 1 NC_003424.3 mRNP complex (predicted) 4733815 2543631 SPAC458.02c Schizosaccharomyces pombe 972h- mRNP complex (predicted) NP_594696.1 4732192 R 284812 CDS SPAC458.03 19115609 2543639 4734862..4737468 1 NC_003424.3 Tel2/Rad-5/Clk-2 family protein Tel2 4737468 tel2 2543639 tel2 Schizosaccharomyces pombe 972h- Tel2/Rad-5/Clk-2 family protein Tel2 NP_594697.1 4734862 D 284812 CDS SPAC458.04c 19115610 2543586 complement(join(4737605..4738147,4738189..4738283,4738330..4738714)) 1 NC_003424.3 sequence orphan 4738714 2543586 SPAC458.04c Schizosaccharomyces pombe 972h- sequence orphan NP_594698.1 4737605 R 284812 CDS SPAC458.05 19115611 2543444 4740237..4742642 1 NC_003424.3 phosphatidylinositol 3-kinase Pik3 4742642 pik3 2543444 pik3 Schizosaccharomyces pombe 972h- phosphatidylinositol 3-kinase Pik3 NP_594699.1 4740237 D 284812 CDS SPAC458.06 19115612 2543338 join(4742869..4742983,4743035..4743135,4743184..4743272,4743329..4743420,4743470..4744167) 1 NC_003424.3 phosphoinositide binding protein 4744167 2543338 SPAC458.06 Schizosaccharomyces pombe 972h- phosphoinositide binding protein NP_594700.1 4742869 D 284812 CDS SPAC458.07 63054646 2543627 join(4744584..4744828,4744870..4745011,4745140..4746099) 1 NC_003424.3 transcription factor TFIIE alpha subunit Tfa1 4746099 tfa1 2543627 tfa1 Schizosaccharomyces pombe 972h- transcription factor TFIIE alpha subunit Tfa1 NP_594701.2 4744584 D 284812 CDS SPAPYUG7.02c 19115615 2542972 complement(join(4746193..4746283,4746323..4748206,4748266..4748288)) 1 NC_003424.3 stress activated MAP kinase interacting protein Sin1 4748288 sin1 2542972 sin1 Schizosaccharomyces pombe 972h- stress activated MAP kinase interacting protein Sin1 NP_594703.1 4746193 R 284812 CDS SPAPYUG7.03c 19115616 2542683 complement(4749139..4751253) 1 NC_003424.3 anillin homologue Mid2 4751253 mid2 2542683 mid2 Schizosaccharomyces pombe 972h- anillin homologue Mid2 NP_594704.1 4749139 R 284812 CDS SPAPYUG7.04c 19115617 2541470 complement(join(4751684..4751734,4751810..4751942,4751985..4752034,4752158..4752224,4752292..4752332)) 1 NC_003424.3 DNA-directed RNA polymerase II complex subunit Rpb9 4752332 rpb9 2541470 rpb9 Schizosaccharomyces pombe 972h- DNA-directed RNA polymerase II complex subunit Rpb9 NP_594705.1 4751684 R 284812 CDS SPAPYUG7.05 19115618 2543212 4752794..4753642 1 NC_003424.3 delta-1-pyrroline-5-carboxylate reductase (predicted) 4753642 2543212 SPAPYUG7.05 Schizosaccharomyces pombe 972h- delta-1-pyrroline-5-carboxylate reductase (predicted) NP_594706.1 4752794 D 284812 CDS SPAPYUG7.06 63054647 2542933 4754183..4754788 1 NC_003424.3 PPPDE peptidase family (predicted) 4754788 mug67 2542933 mug67 Schizosaccharomyces pombe 972h- PPPDE peptidase family (predicted) NP_594707.2 4754183 D 284812 CDS SPAC1782.01 162312554 3361455 4755007..4760046 1 NC_003424.3 proteasome component 4760046 3361455 SPAC1782.01 Schizosaccharomyces pombe 972h- proteasome component XP_001713110.1 4755007 D 284812 CDS SPAC1782.02c 19115621 2542352 complement(join(4760301..4760651,4760752..4760886)) 1 NC_003424.3 conserved fungal protein 4760886 2542352 SPAC1782.02c Schizosaccharomyces pombe 972h- conserved fungal protein NP_594709.1 4760301 R 284812 CDS SPAC1782.03 19115622 2542348 4761807..4762874 1 NC_003424.3 microfibrillar-associated protein family protein 4762874 2542348 SPAC1782.03 Schizosaccharomyces pombe 972h- microfibrillar-associated protein family protein NP_594710.1 4761807 D 284812 CDS SPAC1782.04 19115623 2542350 join(4763079..4763235,4763278..4763648) 1 NC_003424.3 ISS not annotated at SGD from PMID:16339141; mitochondrial mRNA processing protein Cox24 (predicted) 4763648 cox24 2542350 cox24 Schizosaccharomyces pombe 972h- mitochondrial mRNA processing protein Cox24 (predicted) NP_594711.1 4763079 D 284812 CDS SPAC1782.05 19115624 2542349 4764449..4765507 1 NC_003424.3 phosphotyrosyl phosphatase activator homolog 4765507 2542349 SPAC1782.05 Schizosaccharomyces pombe 972h- phosphotyrosyl phosphatase activator homolog NP_594712.1 4764449 D 284812 CDS SPAC1782.06c 19115625 2542354 complement(4765966..4766814) 1 NC_003424.3 prohibitin Phb1 4766814 2542354 SPAC1782.06c Schizosaccharomyces pombe 972h- prohibitin Phb1 NP_594713.1 4765966 R 284812 CDS SPAC1782.07 19115626 2542357 join(4767110..4767141,4767331..4767348,4767394..4767607,4767711..4767725) 1 NC_003424.3 ubiquinol-cytochrome-c reductase complex subunit 7 4767725 qcr8 2542357 qcr8 Schizosaccharomyces pombe 972h- ubiquinol-cytochrome-c reductase complex subunit 7 NP_594714.1 4767110 D 284812 CDS SPAC1782.08c 19115627 2542165 complement(4767907..4769529) 1 NC_003424.3 exonuclease Rex3 (predicted) 4769529 rex3 2542165 rex3 Schizosaccharomyces pombe 972h- exonuclease Rex3 (predicted) NP_594715.1 4767907 R 284812 CDS SPAC1782.09c 19115628 2542358 complement(join(4769991..4771555,4771611..4771659)) 1 NC_003424.3 Cdc14-related protein phosphatase Clp1/Flp1 4771659 clp1 2542358 clp1 Schizosaccharomyces pombe 972h- Cdc14-related protein phosphatase Clp1/Flp1 NP_594716.1 4769991 R 284812 CDS SPAC1782.10c 19115629 2542369 complement(4772682..4773146) 1 NC_003424.3 RNA-binding protein Nhp2 (predicted) 4773146 nhp2 2542369 nhp2 Schizosaccharomyces pombe 972h- RNA-binding protein Nhp2 (predicted) NP_594717.1 4772682 R 284812 CDS SPAC1782.11 19115630 2542359 join(4773792..4774260,4774367..4774506) 1 NC_003424.3 adenylyl-sulfate kinase (predicted) 4774506 met14 2542359 met14 Schizosaccharomyces pombe 972h- adenylyl-sulfate kinase (predicted) NP_594718.1 4773792 D 284812 CDS SPAC1782.12c 19115631 2542361 complement(join(4774686..4774934,4774991..4775067,4775164..4775194)) 1 NC_003424.3 DUF423 protein 4775194 2542361 SPAC1782.12c Schizosaccharomyces pombe 972h- DUF423 protein NP_594719.1 4774686 R 284812 CDS SPAC11H11.01 68004450 3361461 join(4775838..4775894,4775934..4777340) 1 NC_003424.3 ESCRT I complex subunit Vps23 4777340 sst6 3361461 sst6 Schizosaccharomyces pombe 972h- ESCRT I complex subunit Vps23 NP_001018287.1 4775838 D 284812 CDS SPAC11H11.02c 19115632 2543014 complement(join(4777439..4777498,4777537..4777956,4778009..4778147,4778254..4778429)) 1 NC_003424.3 sequence orphan 4778429 mug162 2543014 mug162 Schizosaccharomyces pombe 972h- sequence orphan NP_594720.1 4777439 R 284812 CDS SPAC11H11.03c 19115633 2541436 complement(join(4779181..4779484,4779523..4779667,4780023..4780185,4780241..4780249)) 1 NC_003424.3 SMR and DUF1771 domain protein 4780249 2541436 SPAC11H11.03c Schizosaccharomyces pombe 972h- SMR and DUF1771 domain protein NP_594721.1 4779181 R 284812 CDS SPAC11H11.04 19115634 2541606 4780688..4781734 1 NC_003424.3 pheromone p-factor receptor 4781734 mam2 2541606 mam2 Schizosaccharomyces pombe 972h- pheromone p-factor receptor NP_594722.1 4780688 D 284812 CDS SPAC11H11.05c 19115635 2542646 complement(join(4782047..4782195,4782243..4782273)) 1 NC_003424.3 Sim4 and Mal2 associated (4 and 2 associated) protein 6 4782273 fta6 2542646 fta6 Schizosaccharomyces pombe 972h- Sim4 and Mal2 associated (4 and 2 associated) protein 6 NP_594723.1 4782047 R 284812 CDS SPAC11H11.06 162312556 5802965 join(4783055..4783102,4783153..4784277) 1 NC_003424.3 ARP2/3 actin-organizing complex subunit Arp2 4784277 arp2 5802965 arp2 Schizosaccharomyces pombe 972h- ARP2/3 actin-organizing complex subunit Arp2 XP_001713111.1 4783055 D 284812 CDS SPAC22F8.02c 19115637 2541716 complement(4785162..4786280) 1 NC_003424.3 PvGal biosynthesis protein Pvg5 4786280 pvg5 2541716 pvg5 Schizosaccharomyces pombe 972h- PvGal biosynthesis protein Pvg5 NP_594725.1 4785162 R 284812 CDS SPAC22F8.03c 19115638 2541904 complement(4788494..4788895) 1 NC_003424.3 previously annotated as dubious, may not be protein coding; sequence orphan 4788895 2541904 SPAC22F8.03c Schizosaccharomyces pombe 972h- sequence orphan NP_594726.1 4788494 R 284812 CDS SPAC22F8.04 19115639 2541895 4789789..4790940 1 NC_003424.3 triose phosphate transporter (predicted) 4790940 2541895 SPAC22F8.04 Schizosaccharomyces pombe 972h- triose phosphate transporter (predicted) NP_594727.1 4789789 D 284812 CDS SPAC22F8.05 19115640 2541903 4792308..4794983 1 NC_003424.3 alpha,alpha-trehalose-phosphate synthase (predicted) 4794983 2541903 SPAC22F8.05 Schizosaccharomyces pombe 972h- alpha,alpha-trehalose-phosphate synthase (predicted) NP_594728.1 4792308 D 284812 CDS SPAC22F8.06 19115641 2542062 4795479..4796156 1 NC_003424.3 20S proteasome component beta 6 4796156 pam1 2542062 pam1 Schizosaccharomyces pombe 972h- 20S proteasome component beta 6 NP_594729.1 4795479 D 284812 CDS SPAC22F8.07c 295443070 2541545 complement(join(4797267..4797376,4797424..4797575,4797621..4797953,4797992..4798103,4798143..4798230,4798276..4798442,4798490..4798928)) 1 NC_003424.3 gene structure updated 28-08-07 based on AJ627891; replication termination factor Rtf1 4798928 rtf1 2541545 rtf1 Schizosaccharomyces pombe 972h- replication termination factor Rtf1 NP_594730.2 4797267 R 284812 CDS SPAC22F8.08 19115643 2541601 4799755..4802535 1 NC_003424.3 COPII vesicle coat protein (predicted) 4802535 2541601 SPAC22F8.08 Schizosaccharomyces pombe 972h- COPII vesicle coat protein (predicted) NP_594731.1 4799755 D 284812 CDS SPAC22F8.09 19115644 2541680 join(4803179..4803315,4803371..4804493) 1 NC_003424.3 rRNA processing protein Rrp16 (predicted) 4804493 rrp16 2541680 rrp16 Schizosaccharomyces pombe 972h- rRNA processing protein Rrp16 (predicted) NP_594732.1 4803179 D 284812 CDS SPAC22F8.10c 19115645 2541609 complement(4804630..4806435) 1 NC_003424.3 U2 snRNP-associated protein Sap145 (predicted) 4806435 sap145 2541609 sap145 Schizosaccharomyces pombe 972h- U2 snRNP-associated protein Sap145 (predicted) NP_594733.1 4804630 R 284812 CDS SPAC22F8.11 19115646 2541439 4807786..4810485 1 NC_003424.3 phosphoinositide phospholipase C Plc1 4810485 plc1 2541439 plc1 Schizosaccharomyces pombe 972h- phosphoinositide phospholipase C Plc1 NP_594734.1 4807786 D 284812 CDS SPAC22F8.12c 19115647 2541675 complement(4810770..4811267) 1 NC_003424.3 orthology prediction Pers. comm. Charly Chahwan, both entries are notw in Pfam PF11488; small histone ubiquitination factor Shf1 4811267 shf1 2541675 shf1 Schizosaccharomyces pombe 972h- small histone ubiquitination factor Shf1 NP_594735.1 4810770 R 284812 CDS SPAC20G4.01 162312558 2541846 join(4812099..4812222,4812302..4812421,4812467..4813065) 1 NC_003424.3 CCR4-Not complex subunit Caf16 4813065 caf16 2541846 caf16 Schizosaccharomyces pombe 972h- CCR4-Not complex subunit Caf16 XP_001713112.1 4812099 D 284812 CDS SPAC20G4.02c 19115649 2541741 complement(4813225..4817343) 1 NC_003424.3 formin Fus1 4817343 fus1 2541741 fus1 Schizosaccharomyces pombe 972h- formin Fus1 NP_594737.1 4813225 R 284812 CDS SPAC20G4.03c 19115650 2541728 complement(4818259..4820373) 1 NC_003424.3 eIF2 alpha kinase Hri1 4820373 hri1 2541728 hri1 Schizosaccharomyces pombe 972h- eIF2 alpha kinase Hri1 NP_594738.1 4818259 R 284812 CDS SPAC20G4.04c 19115651 2541746 complement(join(4821491..4821594,4821652..4822246,4822301..4822313,4822379..4822487,4822536..4822578)) 1 NC_003424.3 HydroxyUrea sensitive 1; checkpoint clamp complex protein Hus1 4822578 hus1 2541746 hus1 Schizosaccharomyces pombe 972h- checkpoint clamp complex protein Hus1 NP_594739.1 4821491 R 284812 CDS SPAC20G4.05c 19115652 2541666 complement(4822943..4824649) 1 NC_003424.3 UPF0061 family protein 4824649 2541666 SPAC20G4.05c Schizosaccharomyces pombe 972h- UPF0061 family protein NP_594740.1 4822943 R 284812 CDS SPAC20G4.06c 19115653 2541738 complement(join(4825450..4825754,4825918..4826023,4826075..4826077)) 1 NC_003424.3 cofilin 4826077 adf1 2541738 adf1 Schizosaccharomyces pombe 972h- cofilin NP_594741.1 4825450 R 284812 CDS SPAC20G4.09 295443072 9406905 join(4826230..4826297,4826343..4826349) 1 NC_003424.3 intron from Solexa transread data; sequence orphan 4826349 9406905 SPAC20G4.09 Schizosaccharomyces pombe 972h- sequence orphan XP_002742516.1 4826230 D 284812 CDS SPAC20G4.07c 19115654 2541740 complement(4826683..4828044) 1 NC_003424.3 C-24(28) sterol reductase Sts1 4828044 sts1 2541740 sts1 Schizosaccharomyces pombe 972h- C-24(28) sterol reductase Sts1 NP_594742.1 4826683 R 284812 CDS SPAC20G4.08 162312560 5802967 join(4829057..4831286,4831328..4831968,4832011..4832370) 1 NC_003424.3 sequence orphan 4832370 5802967 SPAC20G4.08 Schizosaccharomyces pombe 972h- sequence orphan XP_001713113.1 4829057 D 284812 CDS SPAC4F10.02 19115657 2543605 join(4832929..4833160,4833257..4834428) 1 NC_003424.3 aminopeptidase (predicted) 4834428 2543605 SPAC4F10.02 Schizosaccharomyces pombe 972h- aminopeptidase (predicted) NP_594745.1 4832929 D 284812 CDS SPAC4F10.03c 19115658 2543625 complement(join(4834870..4835703,4835922..4835945)) 1 NC_003424.3 tRNA 2'-O-ribose methyltransferase (predicted) 4835945 2543625 SPAC4F10.03c Schizosaccharomyces pombe 972h- tRNA 2'-O-ribose methyltransferase (predicted) NP_594746.1 4834870 R 284812 CDS SPAC4F10.04 19115659 2543619 join(4836395..4837267,4837311..4837415) 1 NC_003424.3 protein phosphatase type 2A, intrinsic regulator (predicted) 4837415 2543619 SPAC4F10.04 Schizosaccharomyces pombe 972h- protein phosphatase type 2A, intrinsic regulator (predicted) NP_594747.1 4836395 D 284812 CDS SPAC4F10.05c 19115660 2543640 complement(4837650..4838309) 1 NC_003424.3 mitochondrial lipoate-protein ligase (predicted) 4838309 2543640 SPAC4F10.05c Schizosaccharomyces pombe 972h- mitochondrial lipoate-protein ligase (predicted) NP_594748.1 4837650 R 284812 CDS SPAC4F10.06 19115661 2543574 4839114..4840280 1 NC_003424.3 NOTE: the ribosome biogeneis assignment is based on a computational prediction made from cerevisiae physical interactions, but looks likely based on species distribution/copy number/localization; BUD22 family protein 4840280 2543574 SPAC4F10.06 Schizosaccharomyces pombe 972h- BUD22 family protein NP_594749.1 4839114 D 284812 CDS SPAC4F10.07c 19115662 2543425 complement(join(4840846..4842891,4843136..4843231,4843310..4843444)) 1 NC_003424.3 autophagy associated protein Atg13 (predicted) 4843444 atg13 2543425 atg13 Schizosaccharomyces pombe 972h- autophagy associated protein Atg13 (predicted) NP_594750.1 4840846 R 284812 CDS SPAC4F10.08 295443074 2543519 join(4844855..4845824,4845863..4846063,4846104..4846129) 1 NC_003424.3 sequence orphan 4846129 mug126 2543519 mug126 Schizosaccharomyces pombe 972h- sequence orphan NP_594751.2 4844855 D 284812 CDS SPAC4F10.09c 19115664 2543648 complement(4846797..4849379) 1 NC_003424.3 ribosome biogenesis protein Noc1 (predicted) 4849379 2543648 SPAC4F10.09c Schizosaccharomyces pombe 972h- ribosome biogenesis protein Noc1 (predicted) NP_594752.1 4846797 R 284812 CDS SPAC4F10.10c 19115665 2543252 complement(4850308..4851321) 1 NC_003424.3 mannosyltransferase complex subunit, Anp family Mnn9 (predicted) 4851321 mnn9 2543252 mnn9 Schizosaccharomyces pombe 972h- mannosyltransferase complex subunit, Anp family Mnn9 (predicted) NP_594753.1 4850308 R 284812 CDS SPAC4F10.11 19115666 2543516 join(4853086..4853265,4853303..4853899,4853945..4854577) 1 NC_003424.3 septin Spn1 4854577 spn1 2543516 spn1 Schizosaccharomyces pombe 972h- septin Spn1 NP_594754.1 4853086 D 284812 CDS SPAC4F10.12 19115667 2543650 4855543..4856385 1 NC_003424.3 Sim4 and Mal2 associated (4 and 2 associated) protein 1 4856385 fta1 2543650 fta1 Schizosaccharomyces pombe 972h- Sim4 and Mal2 associated (4 and 2 associated) protein 1 NP_594755.1 4855543 D 284812 CDS SPAC4F10.13c 19115668 2543445 complement(join(4856873..4859813,4859931..4859968)) 1 NC_003424.3 GYF domain protein 4859968 mpd2 2543445 mpd2 Schizosaccharomyces pombe 972h- GYF domain protein NP_594756.1 4856873 R 284812 CDS SPAC4F10.14c 19115669 2543515 complement(join(4860619..4861028,4861187..4861232)) 1 NC_003424.3 nascent polypeptide-associated complex beta subunit 4861232 btf3 2543515 btf3 Schizosaccharomyces pombe 972h- nascent polypeptide-associated complex beta subunit NP_594757.1 4860619 R 284812 CDS SPAC4F10.15c 19115670 2543589 complement(join(4861530..4861564,4861624..4861756,4861807..4863147,4863233..4863448)) 1 NC_003424.3 WASp homolog 4863448 wsp1 2543589 wsp1 Schizosaccharomyces pombe 972h- WASp homolog NP_594758.1 4861530 R 284812 CDS SPAC4F10.16c 19115671 2543523 complement(join(4863961..4864537,4864584..4868110)) 1 NC_003424.3 P-type ATPase (predicted) 4868110 2543523 SPAC4F10.16c Schizosaccharomyces pombe 972h- P-type ATPase (predicted) NP_594759.1 4863961 R 284812 CDS SPAC4F10.17 19115672 2543528 4868588..4868959 1 NC_003424.3 YOL109W tentative , reciprocal blast best hit, size and compositon agree; conserved fungal protein 4868959 2543528 SPAC4F10.17 Schizosaccharomyces pombe 972h- conserved fungal protein NP_594760.1 4868588 D 284812 CDS SPAC4F10.18 19115673 2543592 join(4870500..4870525,4870577..4870653,4870823..4871895) 1 NC_003424.3 WD repeat protein, human NUP37 family 4871895 2543592 SPAC4F10.18 Schizosaccharomyces pombe 972h- WD repeat protein, human NUP37 family NP_594761.1 4870500 D 284812 CDS SPAC4F10.19c 19115674 2543613 complement(join(4872176..4872572,4872686..4872753)) 1 NC_003424.3 zf-HIT protein Hit1 (predicted) 4872753 2543613 SPAC4F10.19c Schizosaccharomyces pombe 972h- zf-HIT protein Hit1 (predicted) NP_594762.1 4872176 R 284812 CDS SPAC4F10.20 19115675 2543556 join(4874269..4874289,4874384..4874436,4874605..4874702,4874826..4874959) 1 NC_003424.3 glutaredoxin Grx1 4874959 grx1 2543556 grx1 Schizosaccharomyces pombe 972h- glutaredoxin Grx1 NP_594763.1 4874269 D 284812 CDS SPAC19B12.01 63054653 2543591 4875575..4878028 1 NC_003424.3 TPR repeat protein, TTC27 family 4878028 2543591 SPAC19B12.01 Schizosaccharomyces pombe 972h- TPR repeat protein, TTC27 family NP_594764.2 4875575 D 284812 CDS SPAC19B12.02c 19115677 2542584 complement(4878825..4880453) 1 NC_003424.3 cell wall protein Gas1, 1,3-beta-glucanosyltransferase (predicted) 4880453 gas1 2542584 gas1 Schizosaccharomyces pombe 972h- cell wall protein Gas1, 1,3-beta-glucanosyltransferase (predicted) NP_594765.1 4878825 R 284812 CDS SPAC19B12.03 19115678 2542591 4883998..4889478 1 NC_003424.3 1,3-beta-glucan synthase subunit Bgs3 4889478 bgs3 2542591 bgs3 Schizosaccharomyces pombe 972h- 1,3-beta-glucan synthase subunit Bgs3 NP_594766.1 4883998 D 284812 CDS SPAC19B12.04 19115679 2542603 join(4890335..4890373,4890426..4890572) 1 NC_003424.3 40S ribosomal protein S30 4890572 rps3001 2542603 rps3001 Schizosaccharomyces pombe 972h- 40S ribosomal protein S30 NP_594767.1 4890335 D 284812 CDS SPAC19B12.05c 19115680 2542225 complement(join(4891043..4891292,4891365..4891669,4891714..4892892,4892966..4893050,4893098..4893184,4893240..4893505)) 1 NC_003424.3 CTD phosphatase Fcp1 4893505 fcp1 2542225 fcp1 Schizosaccharomyces pombe 972h- CTD phosphatase Fcp1 NP_594768.1 4891043 R 284812 CDS SPAC19B12.06c 63054654 2542407 complement(join(4894099..4894405,4894449..4894514,4894620..4894836,4894887..4895073)) 1 NC_003424.3 22.04.2003 added exon 18153..18218; rhomboid family protease 4895073 2542407 SPAC19B12.06c Schizosaccharomyces pombe 972h- rhomboid family protease NP_594769.2 4894099 R 284812 CDS SPAC19B12.07c 19115682 2542411 complement(join(4895775..4896084,4896125..4896340,4896410..4896843)) 1 NC_003424.3 human ZNF277P homolog 4896843 2542411 SPAC19B12.07c Schizosaccharomyces pombe 972h- human ZNF277P homolog NP_594770.1 4895775 R 284812 CDS SPAC19B12.08 19115683 2542182 join(4898141..4898565,4898749..4899286) 1 NC_003424.3 peptidase family C54, required for autophagy Atg4 (predicted) 4899286 atg4 2542182 atg4 Schizosaccharomyces pombe 972h- peptidase family C54, required for autophagy Atg4 (predicted) NP_594771.1 4898141 D 284812 CDS SPAC19B12.09 19115684 2542565 join(4900565..4900585,4900634..4900712,4900757..4900977) 1 NC_003424.3 signal recognition particle subunit Srp14 4900977 srp14 2542565 srp14 Schizosaccharomyces pombe 972h- signal recognition particle subunit Srp14 NP_594772.1 4900565 D 284812 CDS SPAC19B12.10 19115685 2542606 join(4901671..4901802,4901867..4902001,4902133..4903001,4903046..4903217) 1 NC_003424.3 human AMSH protein homolog 4903217 sst2 2542606 sst2 Schizosaccharomyces pombe 972h- human AMSH protein homolog NP_594773.1 4901671 D 284812 CDS SPAC19B12.11c 19115686 2542462 complement(join(4903743..4904040,4904100..4904176)) 1 NC_003424.3 zinc finger protein, human ZNF593 ortholog 4904176 2542462 SPAC19B12.11c Schizosaccharomyces pombe 972h- zinc finger protein, human ZNF593 ortholog NP_594774.1 4903743 R 284812 CDS SPAC19B12.12c 19115687 2542486 complement(join(4905508..4905699,4905774..4906122,4906228..4906394)) 1 NC_003424.3 SMN family protein Yip11 4906394 yip11 2542486 yip11 Schizosaccharomyces pombe 972h- SMN family protein Yip11 NP_594775.1 4905508 R 284812 CDS SPAC19B12.13 162312562 5802969 4906978..4909239 1 NC_003424.3 fusion cytochrome c oxidase assembly protein Cox1102, mitochondrial ribosomal protein Rsm2202 4909239 cox1102 5802969 cox1102 Schizosaccharomyces pombe 972h- fusion cytochrome c oxidase assembly protein Cox1102, mitochondrial ribosomal protein Rsm2202 XP_001713114.1 4906978 D 284812 CDS SPAPB8E5.02c 19115688 2543347 complement(join(4909497..4910744,4910792..4910875)) 1 NC_003424.3 expression level is tightly controlled so that deletion of either copy is compensated (PMID 12783882); 19S proteasome regulatory subunit Rpn502 4910875 rpn502 2543347 rpn502 Schizosaccharomyces pombe 972h- 19S proteasome regulatory subunit Rpn502 NP_594776.1 4909497 R 284812 CDS SPAPB8E5.03 19115689 2543334 4912297..4913613 1 NC_003424.3 malic acid transport protein Mae1 4913613 mae1 2543334 mae1 Schizosaccharomyces pombe 972h- malic acid transport protein Mae1 NP_594777.1 4912297 D 284812 CDS SPAPB8E5.04c 19115690 2543332 complement(4914464..4915030) 1 NC_003424.3 Niemann-Pick disease type C2 protein hE1 homolog 4915030 2543332 SPAPB8E5.04c Schizosaccharomyces pombe 972h- Niemann-Pick disease type C2 protein hE1 homolog NP_594778.1 4914464 R 284812 CDS SPAPB8E5.05 19115691 2543246 join(4917099..4917214,4917286..4917298) 1 NC_003424.3 M-factor precursor Mfm1 4917298 mfm1 2543246 mfm1 Schizosaccharomyces pombe 972h- M-factor precursor Mfm1 NP_594779.1 4917099 D 284812 CDS SPAPB8E5.06c 19115692 2543309 complement(4917825..4918991) 1 NC_003424.3 60S ribosomal protein L3 4918991 rpl302 2543309 rpl302 Schizosaccharomyces pombe 972h- 60S ribosomal protein L3 NP_594780.1 4917825 R 284812 CDS SPAPB8E5.07c 19115693 2543238 complement(4919839..4923330) 1 NC_003424.3 ribosome biogenesis protein Rrp12 4923330 2543238 SPAPB8E5.07c Schizosaccharomyces pombe 972h- ribosome biogenesis protein Rrp12 NP_594781.1 4919839 R 284812 CDS SPAPB8E5.08 19115694 2543231 4923580..4923891 1 NC_003424.3 unusual nucleotide composition; previously annotated as dubious, but has localization signal; sequence orphan 4923891 2543231 SPAPB8E5.08 Schizosaccharomyces pombe 972h- sequence orphan NP_594782.1 4923580 D 284812 CDS SPAPB8E5.09 19115695 2543227 join(4924264..4924407,4924461..4925687) 1 NC_003424.3 AAA family ATPase Rvb1 4925687 rvb1 2543227 rvb1 Schizosaccharomyces pombe 972h- AAA family ATPase Rvb1 NP_594783.1 4924264 D 284812 CDS SPAPB8E5.10 63054656 2543224 join(4926538..4926610,4926659..4926729,4926795..4926872) 1 NC_003424.3 candidate ortholog S. cerevisiae YJL062W-A; conserved fungal protein, with meiosis specific splicing 4926872 2543224 SPAPB8E5.10 Schizosaccharomyces pombe 972h- conserved fungal protein, with meiosis specific splicing NP_594784.2 4926538 D 284812 CDS SPAC1B3.01c 19115697 2542512 complement(join(4926946..4927003,4927096..4927598,4927820..4927918)) 1 NC_003424.3 uracil phosphoribosyltransferase (predicted) 4927918 2542512 SPAC1B3.01c Schizosaccharomyces pombe 972h- uracil phosphoribosyltransferase (predicted) NP_594785.1 4926946 R 284812 CDS SPAC1B3.02c 19115698 2542550 complement(join(4928961..4929100,4929249..4929319,4929363..4929409,4929451..4929516)) 1 NC_003424.3 transcription elongation factor, Elf1 family 4929516 2542550 SPAC1B3.02c Schizosaccharomyces pombe 972h- transcription elongation factor, Elf1 family NP_594786.1 4928961 R 284812 CDS SPAC1B3.03c 19115699 2542541 complement(4929945..4931015) 1 NC_003424.3 cyclophilin family peptidyl-prolyl cis-trans isomerase Wis2 4931015 wis2 2542541 wis2 Schizosaccharomyces pombe 972h- cyclophilin family peptidyl-prolyl cis-trans isomerase Wis2 NP_594787.1 4929945 R 284812 CDS SPAC1B3.04c 19115700 2542529 complement(join(4931482..4932927,4933016..4933510)) 1 NC_003424.3 mitochondrial GTPase Guf1 (predicted) 4933510 2542529 SPAC1B3.04c Schizosaccharomyces pombe 972h- mitochondrial GTPase Guf1 (predicted) NP_594788.1 4931482 R 284812 CDS SPAC1B3.05 19115701 2542126 join(4934801..4935025,4935082..4936749) 1 NC_003424.3 CCR4-Not complex subunit Not3/5 (predicted) 4936749 not3 2542126 not3 Schizosaccharomyces pombe 972h- CCR4-Not complex subunit Not3/5 (predicted) NP_594789.1 4934801 D 284812 CDS SPAC1B3.06c 19115702 2542230 complement(4937997..4938833) 1 NC_003424.3 possibly vitamin, cofactor or ergosterol metabolism; UbiE family methyltransferase (predicted) 4938833 2542230 SPAC1B3.06c Schizosaccharomyces pombe 972h- UbiE family methyltransferase (predicted) NP_594790.1 4937997 R 284812 CDS SPAC1B3.07c 19115703 2542429 complement(4940690..4941436) 1 NC_003424.3 ESCRT I complex subunit Vps28 4941436 vps28 2542429 vps28 Schizosaccharomyces pombe 972h- ESCRT I complex subunit Vps28 NP_594791.1 4940690 R 284812 CDS SPAC1B3.08 19115704 2542528 4942676..4943947 1 NC_003424.3 COP9 signalosome complex subunit 12 (predicted) 4943947 2542528 SPAC1B3.08 Schizosaccharomyces pombe 972h- COP9 signalosome complex subunit 12 (predicted) NP_594792.1 4942676 D 284812 CDS SPAC1B3.09c 19115705 2542229 complement(4944228..4945814) 1 NC_003424.3 Noc2p-Noc3p complex subunit Noc2 family (predicted) 4945814 2542229 SPAC1B3.09c Schizosaccharomyces pombe 972h- Noc2p-Noc3p complex subunit Noc2 family (predicted) NP_594793.1 4944228 R 284812 CDS SPAC1B3.10c 295443076 2542146 complement(4946090..4948084) 1 NC_003424.3 SEL1 repeat protein, unknown biological role 4948084 2542146 SPAC1B3.10c Schizosaccharomyces pombe 972h- SEL1 repeat protein, unknown biological role NP_594794.2 4946090 R 284812 CDS SPAC1B3.20 19115707 2542570 join(4948616..4948758,4948803..4948896) 1 NC_003424.3 confirmed intron; sequence orphan 4948896 2542570 SPAC1B3.20 Schizosaccharomyces pombe 972h- sequence orphan NP_594795.1 4948616 D 284812 CDS SPAC1B3.11c 19115708 2542113 complement(join(4949270..4949874,4949923..4950022)) 1 NC_003424.3 GTPase Ypt4 4950022 ypt4 2542113 ypt4 Schizosaccharomyces pombe 972h- GTPase Ypt4 NP_594796.1 4949270 R 284812 CDS SPAC1B3.12c 19115709 2542233 complement(join(4950640..4950665,4950729..4950882,4951199..4951234)) 1 NC_003424.3 DNA-directed RNA polymerase I, II, and III subunit Rpb10 4951234 rpb10 2542233 rpb10 Schizosaccharomyces pombe 972h- DNA-directed RNA polymerase I, II, and III subunit Rpb10 NP_594797.1 4950640 R 284812 CDS SPAC1B3.13 19115710 2542217 join(4951450..4951565,4951737..4954023) 1 NC_003424.3 U3 snoRNP-associated protein Nan1 4954023 2542217 SPAC1B3.13 Schizosaccharomyces pombe 972h- U3 snoRNP-associated protein Nan1 NP_594798.1 4951450 D 284812 CDS SPAC1B3.14 19115711 2542471 join(4954634..4954650,4954696..4954701,4954748..4954879,4955068..4955392,4955438..4955443) 1 NC_003424.3 V-type ATPase subunit c 4955443 vma3 2542471 vma3 Schizosaccharomyces pombe 972h- V-type ATPase subunit c NP_594799.1 4954634 D 284812 CDS SPAC1B3.15c 19115712 2542116 complement(4955830..4957716) 1 NC_003424.3 membrane transporter 4957716 2542116 SPAC1B3.15c Schizosaccharomyces pombe 972h- membrane transporter NP_594800.1 4955830 R 284812 CDS SPAC1B3.16c 19115713 2542518 complement(4959094..4960800) 1 NC_003424.3 vitamin H transporter Vth1 4960800 vht1 2542518 vht1 Schizosaccharomyces pombe 972h- vitamin H transporter Vth1 NP_594801.1 4959094 R 284812 CDS SPAC1B3.17 19115714 2542596 4965276..4966889 1 NC_003424.3 chromatin silencing protein Clr2 4966889 clr2 2542596 clr2 Schizosaccharomyces pombe 972h- chromatin silencing protein Clr2 NP_594802.1 4965276 D 284812 CDS SPAC1B3.18c 19115715 2542616 complement(4967223..4967894) 1 NC_003424.3 mitochondrial ribosomal protein subunit S18 4967894 mrps18 2542616 mrps18 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit S18 NP_594803.1 4967223 R 284812 CDS SPAC1952.01 162312564 3361539 join(4968146..4968537,4968765..4969599) 1 NC_003424.3 Pig-U 4969599 3361539 SPAC1952.01 Schizosaccharomyces pombe 972h- Pig-U XP_001713115.1 4968146 D 284812 CDS SPAC1952.02 63054658 2542568 join(4969892..4970005,4970087..4970179,4970244..4970645) 1 NC_003424.3 highly charged C-term; ribosome biogenesis protein (predicted) 4970645 2542568 SPAC1952.02 Schizosaccharomyces pombe 972h- ribosome biogenesis protein (predicted) NP_594805.2 4969892 D 284812 CDS SPAC1952.03 19115718 2542554 join(4971117..4971548,4971595..4972137) 1 NC_003424.3 cysteine protease, OTU family 4972137 2542554 SPAC1952.03 Schizosaccharomyces pombe 972h- cysteine protease, OTU family NP_594806.1 4971117 D 284812 CDS SPAC1952.04c 68005587 3361392 complement(join(4972134..4972225,4972353..4972369,4972430..4972662,4972852..4972986)) 1 NC_003424.3 sequence orphan 4972986 3361392 SPAC1952.04c Schizosaccharomyces pombe 972h- sequence orphan NP_001018291.1 4972134 R 284812 CDS SPAC1952.05 19115719 2542513 4974116..4975480 1 NC_003424.3 SAGA complex histone acetyltransferase subunit Gcn5 4975480 gcn5 2542513 gcn5 Schizosaccharomyces pombe 972h- SAGA complex histone acetyltransferase subunit Gcn5 NP_594807.1 4974116 D 284812 CDS SPAC1952.06c 19115720 2542555 complement(4975746..4977440) 1 NC_003424.3 DUF1716 family protein 4977440 2542555 SPAC1952.06c Schizosaccharomyces pombe 972h- DUF1716 family protein NP_594808.1 4975746 R 284812 CDS SPAC1952.07 19115721 2542558 join(4978619..4978754,4978881..4979121,4979165..4979759) 1 NC_003424.3 checkpoint clamp complex protein Rad1 4979759 rad1 2542558 rad1 Schizosaccharomyces pombe 972h- checkpoint clamp complex protein Rad1 NP_594809.1 4978619 D 284812 CDS SPAC1952.08c 19115722 2542572 complement(join(4980139..4980486,4980562..4980786)) 1 NC_003424.3 pyridoxamine 5'-phosphate oxidase (predicted) 4980786 2542572 SPAC1952.08c Schizosaccharomyces pombe 972h- pyridoxamine 5'-phosphate oxidase (predicted) NP_594810.1 4980139 R 284812 CDS SPAC1952.09c 19115723 2542515 complement(4981334..4982899) 1 NC_003424.3 acetyl-CoA hydrolase 4982899 2542515 SPAC1952.09c Schizosaccharomyces pombe 972h- acetyl-CoA hydrolase NP_594811.1 4981334 R 284812 CDS SPAC1952.10c 19115724 2542153 complement(join(4985094..4985906,4986022..4986294)) 1 NC_003424.3 conserved fungal protein 4986294 2542153 SPAC1952.10c Schizosaccharomyces pombe 972h- conserved fungal protein NP_594812.1 4985094 R 284812 CDS SPAC1952.11c 19115725 2542563 complement(4986738..4989245) 1 NC_003424.3 urease Ure2 4989245 ure2 2542563 ure2 Schizosaccharomyces pombe 972h- urease Ure2 NP_594813.1 4986738 R 284812 CDS SPAC1952.12c 19115726 2542127 complement(4990047..4990664) 1 NC_003424.3 COP9/signalosome complex subunit 7a 4990664 csn71 2542127 csn71 Schizosaccharomyces pombe 972h- COP9/signalosome complex subunit 7a NP_594814.1 4990047 R 284812 CDS SPAC1952.13 19115727 2542274 join(4991146..4991205,4991276..4991557,4991706..4993334) 1 NC_003424.3 lipin Ned1 4993334 ned1 2542274 ned1 Schizosaccharomyces pombe 972h- lipin Ned1 NP_594815.1 4991146 D 284812 CDS SPAC1952.14c 19115728 2542604 complement(4993998..4994444) 1 NC_003424.3 mitochondrial ribosomal protein subunit L25 4994444 mrpl25 2542604 mrpl25 Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit L25 NP_594816.1 4993998 R 284812 CDS SPAC1952.15c 19115729 2542618 complement(join(4996030..4996763,4996904..4997222)) 1 NC_003424.3 meiotic recombination protein Rec24 4997222 rec24 2542618 rec24 Schizosaccharomyces pombe 972h- meiotic recombination protein Rec24 NP_594817.1 4996030 R 284812 CDS SPAC1952.16 19115730 2542132 join(4997617..4997719,4997775..4997935,4997988..4999017,4999068..4999154,4999207..4999233,4999274..4999672,4999708..4999955) 1 NC_003424.3 rga9 proposed PMID: 14506270; RhoGAp, GTPase activator towards Rho/Rac/Cdc42-like small GTPases 4999955 rga9 2542132 rga9 Schizosaccharomyces pombe 972h- RhoGAp, GTPase activator towards Rho/Rac/Cdc42-like small GTPases NP_594818.1 4997617 D 284812 CDS SPAC1952.17c 63054660 2542551 complement(join(5000024..5000272,5000325..5000891,5000933..5001976)) 1 NC_003424.3 GTPase activating protein (predicted) 5001976 2542551 SPAC1952.17c Schizosaccharomyces pombe 972h- GTPase activating protein (predicted) NP_594819.2 5000024 R 284812 CDS SPAC890.02c 19115732 2543382 complement(5002771..5004195) 1 NC_003424.3 TACC homolog (predicted) 5004195 alp7 2543382 alp7 Schizosaccharomyces pombe 972h- TACC homolog (predicted) NP_594820.1 5002771 R 284812 CDS SPAC890.03 19115733 2543567 join(5004671..5004694,5004742..5004835,5004903..5004952,5005121..5006971) 1 NC_003424.3 serine/threonine protein kinase Ppk16 (predicted) 5006971 ppk16 2543567 ppk16 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Ppk16 (predicted) NP_594821.1 5004671 D 284812 CDS SPAC890.04c 19115734 2543549 complement(join(5007173..5008344,5008707..5008857)) 1 NC_003424.3 ribosome biogenesis protein Ytm1 (predicted) 5008857 2543549 SPAC890.04c Schizosaccharomyces pombe 972h- ribosome biogenesis protein Ytm1 (predicted) NP_594822.1 5007173 R 284812 CDS SPAC890.05 19115735 2543532 5009807..5010661 1 NC_003424.3 ribosome biogenesis protein (predicted) 5010661 2543532 SPAC890.05 Schizosaccharomyces pombe 972h- ribosome biogenesis protein (predicted) NP_594823.1 5009807 D 284812 CDS SPAC890.06 19115736 2543502 join(5011732..5011864,5011916..5012020,5012077..5015786) 1 NC_003424.3 possible alternative donor for 1st intron at position 10149-10154; nucleoporin Nup157/170 5015786 2543502 SPAC890.06 Schizosaccharomyces pombe 972h- nucleoporin Nup157/170 NP_594824.1 5011732 D 284812 CDS SPAC890.07c 295443078 2543492 complement(join(5016020..5016026,5016076..5016215,5016262..5016596,5016649..5016943,5016994..5017059,5017138..5017252,5017421..5017433,5017700..5017703,5017782..5017829)) 1 NC_003424.3 type I protein arginine N-methyltransferase Rmt1 5017829 rmt1 2543492 rmt1 Schizosaccharomyces pombe 972h- type I protein arginine N-methyltransferase Rmt1 NP_594825.2 5016020 R 284812 CDS SPAC890.08 19115738 2543475 join(5018126..5018272,5018393..5018587) 1 NC_003424.3 60S ribosomal protein L31 5018587 rpl31 2543475 rpl31 Schizosaccharomyces pombe 972h- 60S ribosomal protein L31 NP_594826.1 5018126 D 284812 CDS SPAC22E12.01 63054661 2541816 join(5019492..5019670,5019722..5020667) 1 NC_003424.3 similar to nucleotide-sugar transporters; membrane transporter (predicted) 5020667 2541816 SPAC22E12.01 Schizosaccharomyces pombe 972h- membrane transporter (predicted) NP_594827.2 5019492 D 284812 CDS SPAC22E12.02 19115740 2541753 join(5022184..5022491,5022726..5023077) 1 NC_003424.3 RNA-binding protein 5023077 2541753 SPAC22E12.02 Schizosaccharomyces pombe 972h- RNA-binding protein NP_594828.1 5022184 D 284812 CDS SPAC22E12.03c 19115741 2541772 complement(join(5023079..5023175,5023274..5023752)) 1 NC_003424.3 THIJ/PFPI family peptidase (predicted) 5023752 2541772 SPAC22E12.03c Schizosaccharomyces pombe 972h- THIJ/PFPI family peptidase (predicted) NP_594829.1 5023079 R 284812 CDS SPAC22E12.04 19115742 2541803 join(5024936..5024944,5024997..5025123,5025279..5026036) 1 NC_003424.3 metallochaperone Ccs1 5026036 ccs1 2541803 ccs1 Schizosaccharomyces pombe 972h- metallochaperone Ccs1 NP_594830.1 5024936 D 284812 CDS SPAC22E12.05c 19115743 2541774 complement(join(5026800..5027294,5027348..5027407)) 1 NC_003424.3 Rer1 family protein 5027407 rer1 2541774 rer1 Schizosaccharomyces pombe 972h- Rer1 family protein NP_594831.1 5026800 R 284812 CDS SPAC22E12.06c 19115744 2541748 complement(5029000..5029998) 1 NC_003424.3 alpha-1,2-galactosyltransferase Gmh3 5029998 gmh3 2541748 gmh3 Schizosaccharomyces pombe 972h- alpha-1,2-galactosyltransferase Gmh3 NP_594832.1 5029000 R 284812 CDS SPAC22E12.07 19115745 2541863 5031784..5032944 1 NC_003424.3 Ran GAP Rna1 5032944 rna1 2541863 rna1 Schizosaccharomyces pombe 972h- Ran GAP Rna1 NP_594833.1 5031784 D 284812 CDS SPAC22E12.08 19115746 2541835 join(5033478..5033603,5033656..5033823) 1 NC_003424.3 was originally annotated as dubious due to small size, no homology, only identified by splice site; RNA polymerase I upstream activation factor complex subunit Rrn10 5033823 rrn10 2541835 rrn10 Schizosaccharomyces pombe 972h- RNA polymerase I upstream activation factor complex subunit Rrn10 NP_594834.1 5033478 D 284812 CDS SPAC22E12.09c 19115747 2542576 complement(5034440..5036569) 1 NC_003424.3 kexin 5036569 krp1 2542576 krp1 Schizosaccharomyces pombe 972h- kexin NP_594835.1 5034440 R 284812 CDS SPAC22E12.10c 295443080 2541839 complement(join(5037208..5037446,5037492..5039103)) 1 NC_003424.3 mitochondrial type I [2Fe-2S] ferredoxin Etp1/ cytochrome oxidase cofactor Cox15, fusion 5039103 etp1 2541839 etp1 Schizosaccharomyces pombe 972h- mitochondrial type I [2Fe-2S] ferredoxin Etp1/ cytochrome oxidase cofactor Cox15, fusion NP_594836.2 5037208 R 284812 CDS SPAC22E12.11c 19115749 2541899 complement(5039902..5042481) 1 NC_003424.3 histone lysine methyltransferase Set3 5042481 set3 2541899 set3 Schizosaccharomyces pombe 972h- histone lysine methyltransferase Set3 NP_594837.1 5039902 R 284812 CDS SPAC22E12.13c 19115751 2541855 complement(join(5043797..5044231,5044479..5044617,5044668..5044672)) 1 NC_003424.3 60S ribosomal protein L24-3 (L30) 5044672 rpl2403 2541855 rpl2403 Schizosaccharomyces pombe 972h- 60S ribosomal protein L24-3 (L30) NP_594839.1 5043797 R 284812 CDS SPAC22E12.14c 19115752 2541867 complement(5046577..5048517) 1 NC_003424.3 serine/threonine protein kinase Sck2 5048517 sck2 2541867 sck2 Schizosaccharomyces pombe 972h- serine/threonine protein kinase Sck2 NP_594840.1 5046577 R 284812 CDS SPAC22E12.16c 19115754 2541887 complement(join(5049409..5051779,5051977..5052018,5052068..5052186,5052236..5052259)) 1 NC_003424.3 phosphatidylinositol kinase Pik1 5052259 pik1 2541887 pik1 Schizosaccharomyces pombe 972h- phosphatidylinositol kinase Pik1 NP_594842.1 5049409 R 284812 CDS SPAC22E12.17c 19115755 2541825 complement(join(5053107..5054382,5054436..5054554,5054608..5054673)) 1 NC_003424.3 ARF GTPase activating protein 5054673 glo3 2541825 glo3 Schizosaccharomyces pombe 972h- ARF GTPase activating protein NP_594843.1 5053107 R 284812 CDS SPAC22E12.18 19115756 2541850 join(5055181..5055217,5055257..5056230) 1 NC_003424.3 conserved fungal protein 5056230 2541850 SPAC22E12.18 Schizosaccharomyces pombe 972h- conserved fungal protein NP_594844.1 5055181 D 284812 CDS SPAC22E12.19 63054662 2541792 5056708..5058693 1 NC_003424.3 Set3 complex subunit Snt1 5058693 snt1 2541792 snt1 Schizosaccharomyces pombe 972h- Set3 complex subunit Snt1 NP_594845.2 5056708 D 284812 CDS SPAC2E12.02 19115758 2541888 join(5059475..5059802,5060145..5061646) 1 NC_003424.3 transcription factor Hsf1 5061646 hsf1 2541888 hsf1 Schizosaccharomyces pombe 972h- transcription factor Hsf1 NP_594846.1 5059475 D 284812 CDS SPAC2E12.03c 19115759 2541787 complement(5062198..5063049) 1 NC_003424.3 PQ loop protein 5063049 2541787 SPAC2E12.03c Schizosaccharomyces pombe 972h- PQ loop protein NP_594847.1 5062198 R 284812 CDS SPAC1006.01 19115760 2543256 5067840..5069195 1 NC_003424.3 the third S. pombe serine protease (PMID 11115118); serine protease Psp3 (predicted) 5069195 psp3 2543256 psp3 Schizosaccharomyces pombe 972h- serine protease Psp3 (predicted) NP_594848.1 5067840 D 284812 CDS SPAC1006.02 19115761 2543255 5069696..5070802 1 NC_003424.3 Astra associated protein 1 Asa1 5070802 asa1 2543255 asa1 Schizosaccharomyces pombe 972h- Astra associated protein 1 Asa1 NP_594849.1 5069696 D 284812 CDS SPAC1006.03c 19115762 2543254 complement(join(5071212..5071417,5071456..5073188,5073389..5073449,5073728..5073872)) 1 NC_003424.3 human CCDC131 homolog 5073872 2543254 SPAC1006.03c Schizosaccharomyces pombe 972h- human CCDC131 homolog NP_594850.1 5071212 R 284812 CDS SPAC1006.04c 19115763 2543146 complement(5075136..5077994) 1 NC_003424.3 sequence orphan 5077994 mcp3 2543146 mcp3 Schizosaccharomyces pombe 972h- sequence orphan NP_594851.1 5075136 R 284812 CDS SPAC1006.05c 19115764 2543147 complement(5079186..5080376) 1 NC_003424.3 C12N15/09,C07K14/00,C07K14/39,C12N1/00,C12N1/15, C12N 1/19,C12N1/21,C12N5/10,C12N9/10,C12P21/02//(C12N15/09, C12R1 :645),(C12N1/00,C12R1:645),(C12N9/10,C12R1:645), (C12P21/02, C12R1:645),C12N15/00,C12N5/00, (C12N15/00, C12R1:645); alpha-1,6-mannosyltransferase Och1 5080376 och1 2543147 och1 Schizosaccharomyces pombe 972h- alpha-1,6-mannosyltransferase Och1 NP_594852.1 5079186 R 284812 CDS SPAC1006.06 19115765 2542953 join(5081105..5083607,5083663..5084084,5084129..5084680) 1 NC_003424.3 RhoGEF Rgf2 5084680 rgf2 2542953 rgf2 Schizosaccharomyces pombe 972h- RhoGEF Rgf2 NP_594853.1 5081105 D 284812 CDS SPAC1006.07 19115766 2542948 5085563..5086741 1 NC_003424.3 translation initiation factor eIF4A 5086741 2542948 SPAC1006.07 Schizosaccharomyces pombe 972h- translation initiation factor eIF4A NP_594854.1 5085563 D 284812 CDS SPAC1006.08 19115767 2543001 join(5088089..5088998,5089061..5089326) 1 NC_003424.3 ethanol-hypersensitive mutant protein 5089326 etd1 2543001 etd1 Schizosaccharomyces pombe 972h- ethanol-hypersensitive mutant protein NP_594855.1 5088089 D 284812 CDS SPAC1006.09 63054663 2542988 5090441..5094751 1 NC_003424.3 MAP kinase kinase kinase Win1 5094751 win1 2542988 win1 Schizosaccharomyces pombe 972h- MAP kinase kinase kinase Win1 NP_594856.2 5090441 D 284812 CDS SPAC1250.05 19115769 2542661 complement(join(5095211..5095301,5095548..5095810)) 1 NC_003424.3 60S ribosomal protein L30 5095810 rpl3002 2542661 rpl3002 Schizosaccharomyces pombe 972h- 60S ribosomal protein L30 NP_594857.1 5095211 R 284812 CDS SPAC1250.04c 19115770 2541704 5097113..5097439 1 NC_003424.3 ribonuclease domain present in other eukaryotic homologs is missing; alkyltransferase-like protein Atl1 5097439 atl1 2541704 atl1 Schizosaccharomyces pombe 972h- alkyltransferase-like protein Atl1 NP_594858.1 5097113 D 284812 CDS SPAC1250.07 162312566 5802974 complement(5097850..5098212) 1 NC_003424.3 gene added 20070412 from PMID:17409385; TFIIIC subunit Sfc7 5098212 sfc7 5802974 sfc7 Schizosaccharomyces pombe 972h- TFIIIC subunit Sfc7 XP_001713116.1 5097850 R 284812 CDS SPAC1250.03 19115771 2541565 complement(join(5098187..5098405,5098507..5098713,5098775..5098816)) 1 NC_003424.3 ubiquitin conjugating enzyme Ubc14 5098816 ubc14 2541565 ubc14 Schizosaccharomyces pombe 972h- ubiquitin conjugating enzyme Ubc14 NP_594859.1 5098187 R 284812 CDS SPAC1250.02 19115772 2543012 complement(join(5099365..5099512,5099598..5099986)) 1 NC_003424.3 sequence orphan 5099986 mug95 2543012 mug95 Schizosaccharomyces pombe 972h- sequence orphan NP_594860.1 5099365 R 284812 CDS SPAC1250.01 19115773 2542638 complement(join(5100376..5103924,5103966..5104016)) 1 NC_003424.3 ATP-dependent DNA helicase Snf21 5104016 snf21 2542638 snf21 Schizosaccharomyces pombe 972h- ATP-dependent DNA helicase Snf21 NP_594861.1 5100376 R 284812 CDS SPAC29A4.20 19115774 2541614 complement(join(5104524..5104605,5104701..5106253)) 1 NC_003424.3 elongator complex, histone acetyltransferase subunit Elp3 (predicted) 5106253 elp3 2541614 elp3 Schizosaccharomyces pombe 972h- elongator complex, histone acetyltransferase subunit Elp3 (predicted) NP_594862.1 5104524 R 284812 CDS SPAC29A4.19c 19115775 2542076 join(5106861..5107454,5107504..5108309,5108357..5110068,5110115..5110293) 1 NC_003424.3 Ca2+/Mn2+ transporting P-type ATPase Cta5 5110293 cta5 2542076 cta5 Schizosaccharomyces pombe 972h- Ca2+/Mn2+ transporting P-type ATPase Cta5 NP_594863.1 5106861 D 284812 CDS SPAC29A4.18 19115776 2541804 complement(join(5110432..5111536,5111614..5111719,5111790..5111874)) 1 NC_003424.3 Clr6 histone deacetylase complex subunit Prw1 5111874 prw1 2541804 prw1 Schizosaccharomyces pombe 972h- Clr6 histone deacetylase complex subunit Prw1 NP_594864.1 5110432 R 284812 CDS SPAC29A4.17c 19115777 2541621 join(5113142..5113369,5113481..5113696) 1 NC_003424.3 mitocondrial FUN14 family protein 5113696 2541621 SPAC29A4.17c Schizosaccharomyces pombe 972h- mitocondrial FUN14 family protein NP_594865.1 5113142 D 284812 CDS SPAC29A4.16 19115778 2542804 complement(5114504..5116414) 1 NC_003424.3 halotolerence protein 4 5116414 hal4 2542804 hal4 Schizosaccharomyces pombe 972h- halotolerence protein 4 NP_594866.1 5114504 R 284812 CDS SPAC29A4.15 19115779 2542163 complement(5117526..5118878) 1 NC_003424.3 cytoplasmic serine-tRNA ligase Srs1 (predicted) 5118878 2542163 SPAC29A4.15 Schizosaccharomyces pombe 972h- cytoplasmic serine-tRNA ligase Srs1 (predicted) NP_594867.1 5117526 R 284812 CDS SPAC29A4.14c 63054664 2541734 join(5119673..5119830,5119887..5120333,5120441..5120876) 1 NC_003424.3 overlaps CDS SPAC29A4.13 by 4 aa at the 3' end; 11.09.2002 added N-terminal exon; peroxin-3 peroxisome import protein (predicted) 5120876 2541734 SPAC29A4.14c Schizosaccharomyces pombe 972h- peroxin-3 peroxisome import protein (predicted) NP_594868.2 5119673 D 284812 CDS SPAC29A4.13 19115781 2542355 complement(5120873..5121580) 1 NC_003424.3 overlaps CDS SPAC29A4.14c by 4 aa at the 3' end; urease accessory protein UreF 5121580 2542355 SPAC29A4.13 Schizosaccharomyces pombe 972h- urease accessory protein UreF NP_594869.1 5120873 R 284812 CDS SPAC29A4.12c 19115782 2542356 5124780..5125232 1 NC_003424.3 has transcript profile on microarray; sequence orphan 5125232 mug108 2542356 mug108 Schizosaccharomyces pombe 972h- sequence orphan NP_594870.1 5124780 D 284812 CDS SPAC29A4.11 19115783 2542306 complement(5125929..5128838) 1 NC_003424.3 Rho-type GTPase activating protein Rga3 5128838 rga3 2542306 rga3 Schizosaccharomyces pombe 972h- Rho-type GTPase activating protein Rga3 NP_594871.1 5125929 R 284812 CDS SPAC29A4.10 19115784 2542734 complement(5130055..5131725) 1 NC_003424.3 RNA polymerase I upstream activation factor complex subunit Rrn5 5131725 rrn5 2542734 rrn5 Schizosaccharomyces pombe 972h- RNA polymerase I upstream activation factor complex subunit Rrn5 NP_594872.1 5130055 R 284812 CDS SPAC29A4.09 19115785 2542251 complement(join(5132240..5132641,5132689..5132794,5132835..5132938)) 1 NC_003424.3 rRNA processing protein Rrp17 5132938 2542251 SPAC29A4.09 Schizosaccharomyces pombe 972h- rRNA processing protein Rrp17 NP_594873.1 5132240 R 284812 CDS SPAC29A4.08c 19115786 2542256 join(5133242..5133299,5133340..5133444,5133930..5135233) 1 NC_003424.3 ubiquitin-protein ligase E4 5135233 prp19 2542256 prp19 Schizosaccharomyces pombe 972h- ubiquitin-protein ligase E4 NP_594874.1 5133242 D 284812 CDS SPAC29A4.07 19115787 2542413 complement(5135423..5135833) 1 NC_003424.3 mediator complex subunit Srb6 5135833 srb6 2542413 srb6 Schizosaccharomyces pombe 972h- mediator complex subunit Srb6 NP_594875.1 5135423 R 284812 CDS SPAC29A4.06c 19115788 2542169 join(5136167..5136362,5136405..5137276) 1 NC_003424.3 human CCDC55 homolog 5137276 2542169 SPAC29A4.06c Schizosaccharomyces pombe 972h- human CCDC55 homolog NP_594876.1 5136167 D 284812 CDS SPAC29A4.05 19115789 2542611 complement(5137555..5137986) 1 NC_003424.3 myosin I light chain Cam2 5137986 cam2 2542611 cam2 Schizosaccharomyces pombe 972h- myosin I light chain Cam2 NP_594877.1 5137555 R 284812 CDS SPAC29A4.04c 19115790 2542481 5140407..5141831 1 NC_003424.3 pseudouridylate synthase (predicted) 5141831 2542481 SPAC29A4.04c Schizosaccharomyces pombe 972h- pseudouridylate synthase (predicted) NP_594878.1 5140407 D 284812 CDS SPAC29A4.03c 19115791 2542620 5142826..5143224 1 NC_003424.3 mitochondrial ribosomal protein subunit S9 5143224 2542620 SPAC29A4.03c Schizosaccharomyces pombe 972h- mitochondrial ribosomal protein subunit S9 NP_594879.1 5142826 D 284812 CDS SPAC29A4.02c 19115792 2542298 join(5143818..5144034,5144328..5145340) 1 NC_003424.3 translation elongation factor EF-1 gamma subunit 5145340 2542298 SPAC29A4.02c Schizosaccharomyces pombe 972h- translation elongation factor EF-1 gamma subunit NP_594880.1 5143818 D 284812 CDS SPAC26F1.14c 162312568 3361554 5146273..5148000 1 NC_003424.3 apoptosis-inducing factor homolog Aif1 5148000 aif1 3361554 aif1 Schizosaccharomyces pombe 972h- apoptosis-inducing factor homolog Aif1 XP_001713117.1 5146273 D 284812 CDS SPAC26F1.13c 19115794 2542670 5148944..5152279 1 NC_003424.3 cytoplasmic leucine-tRNA ligase Lrs1 (predicted) 5152279 lrs1 2542670 lrs1 Schizosaccharomyces pombe 972h- cytoplasmic leucine-tRNA ligase Lrs1 (predicted) NP_594882.1 5148944 D 284812 CDS SPAC26F1.12c 19115795 2542675 join(5153932..5153949,5153990..5154942,5154994..5155093) 1 NC_003424.3 conserved eukaryotic protein 5155093 2542675 SPAC26F1.12c Schizosaccharomyces pombe 972h- conserved eukaryotic protein NP_594883.1 5153932 D 284812 CDS SPAC26F1.11 19115796 2542676 complement(5158023..5158340) 1 NC_003424.3 ORF in predicted gene free region with (G-C)/(G+C) strand switch; previously annotated as dubious, but has localization signal; 28-11-07, returned to dubious, has no transcript from Affeymetrix or Solexa, very unlikely to be coding; dubious 5158340 2542676 SPAC26F1.11 Schizosaccharomyces pombe 972h- dubious NP_594884.1 5158023 R 284812 CDS SPAC26F1.10c 19115797 2542677 5161512..5163164 1 NC_003424.3 tyrosine phosphatase Pyp1 5163164 pyp1 2542677 pyp1 Schizosaccharomyces pombe 972h- tyrosine phosphatase Pyp1 NP_594885.1 5161512 D 284812 CDS SPAC26F1.09 19115798 2542680 complement(5163741..5166836) 1 NC_003424.3 GTPase activating protein Gyp51 (predicted) 5166836 gyp51 2542680 gyp51 Schizosaccharomyces pombe 972h- GTPase activating protein Gyp51 (predicted) NP_594886.1 5163741 R 284812 CDS SPAC26F1.08c 19115799 2542709 join(5167499..5167871,5167915..5170475) 1 NC_003424.3 hypothetical protein 5170475 2542709 SPAC26F1.08c Schizosaccharomyces pombe 972h- hypothetical protein NP_594887.1 5167499 D 284812 CDS SPAC26F1.07 19115800 2542088 complement(5170883..5171848) 1 NC_003424.3 glucose 1-dehydrogenase (NADP+) (predicted) 5171848 2542088 SPAC26F1.07 Schizosaccharomyces pombe 972h- glucose 1-dehydrogenase (NADP+) (predicted) NP_594888.1 5170883 R 284812 CDS SPAC26F1.06 19115801 2542085 complement(5173972..5174607) 1 NC_003424.3 monomeric 2,3-bisphosphoglycerate (BPG)-dependent phosphoglycerate mutase (PGAM), Gpm1 5174607 gpm1 2542085 gpm1 Schizosaccharomyces pombe 972h- monomeric 2,3-bisphosphoglycerate (BPG)-dependent phosphoglycerate mutase (PGAM), Gpm1 NP_594889.1 5173972 R 284812 CDS SPAC26F1.05 19115802 2542092 complement(5174979..5175326) 1 NC_003424.3 has transcript profile on microarray; sequence orphan 5175326 mug106 2542092 mug106 Schizosaccharomyces pombe 972h- sequence orphan NP_594890.1 5174979 R 284812 CDS SPAC26F1.04c 19115803 2542100 5178325..5179443 1 NC_003424.3 enoyl-[acyl-carrier protein] reductase 5179443 etr1 2542100 etr1 Schizosaccharomyces pombe 972h- enoyl-[acyl-carrier protein] reductase NP_594891.1 5178325 D 284812 CDS SPAC26F1.03 19115804 2541579 complement(5179831..5181060) 1 NC_003424.3 pyruvate dehydrogenase e1 component alpha subunit Pda1 5181060 pda1 2541579 pda1 Schizosaccharomyces pombe 972h- pyruvate dehydrogenase e1 component alpha subunit Pda1 NP_594892.1 5179831 R 284812 CDS SPAC26F1.02 19115805 2542087 complement(join(5181982..5182122,5182191..5182632,5182721..5182731)) 1 NC_003424.3 pinin homologue 5182731 2542087 SPAC26F1.02 Schizosaccharomyces pombe 972h- pinin homologue NP_594893.1 5181982 R 284812 CDS SPAC26F1.01 63054666 2542073 complement(5182922..5185708) 1 NC_003424.3 guanyl-nucleotide exchange factor Sec74 5185708 sec74 2542073 sec74 Schizosaccharomyces pombe 972h- guanyl-nucleotide exchange factor Sec74 NP_594894.2 5182922 R 284812 CDS SPAPJ691.02 19115807 2543316 5188171..5188566 1 NC_003424.3 yippee-like protein 5188566 2543316 SPAPJ691.02 Schizosaccharomyces pombe 972h- yippee-like protein NP_594895.1 5188171 D 284812 CDS SPAPJ691.03 19115808 2543313 join(5189727..5189768,5189969..5190053,5190125..5190258) 1 NC_003424.3 DUF543 family protein 5190258 2543313 SPAPJ691.03 Schizosaccharomyces pombe 972h- DUF543 family protein NP_594896.1 5189727 D 284812 CDS SPAC13D1.01c 19115809 2542763 complement(5191144..5195145) 1 NC_003424.3 tandem with Tf2-8; retrotransposable element 5195145 Tf2-7 2542763 Tf2-7 Schizosaccharomyces pombe 972h- retrotransposable element NP_594897.1 5191144 R 284812 CDS SPAC19D5.09c 63054667 2542903 complement(5195711..5199712) 1 NC_003424.3 retrotransposable element 5199712 Tf2-8 2542903 Tf2-8 Schizosaccharomyces pombe 972h- retrotransposable element NP_594898.2 5195711 R 284812 CDS SPAC19D5.01 19115811 2542200 5202823..5204958 1 NC_003424.3 tyrosine phosphatase Pyp2 5204958 pyp2 2542200 pyp2 Schizosaccharomyces pombe 972h- tyrosine phosphatase Pyp2 NP_594899.1 5202823 D 284812 CDS SPAC19D5.02c 19115812 2542392 complement(5205464..5206135) 1 NC_003424.3 peroxisomal membrane protein Pex22 (predicted) 5206135 2542392 SPAC19D5.02c Schizosaccharomyces pombe 972h- peroxisomal membrane protein Pex22 (predicted) NP_594900.1 5205464 R 284812 CDS SPAC19D5.03 19115813 2542420 join(5206713..5206956,5207061..5207201,5207303..5208135) 1 NC_003424.3 poly(A) polymerase Cid1 5208135 cid1 2542420 cid1 Schizosaccharomyces pombe 972h- poly(A) polymerase Cid1 NP_594901.1 5206713 D 284812 CDS SPAC19D5.04 19115814 2542537 5208776..5218459 1 NC_003424.3 HECT domain 5218459 ptr1 2542537 ptr1 Schizosaccharomyces pombe 972h- HECT domain NP_594902.1 5208776 D 284812 CDS SPAC19D5.05c 19115815 2542514 complement(join(5218899..5218922,5218962..5219470,5219517..5219535)) 1 NC_003424.3 U3 snoRNP-associated protein Imp3 (predicted) 5219535 2542514 SPAC19D5.05c Schizosaccharomyces pombe 972h- U3 snoRNP-associated protein Imp3 (predicted) NP_594903.1 5218899 R 284812 CDS SPAC19D5.11c 68005903 3361556 complement(join(5219635..5219847,5219897..5220013)) 1 NC_003424.3 identified by Stuart MacNeill; DNA replication factor C complex subunit Ctf8 5220013 ctf8 3361556 ctf8 Schizosaccharomyces pombe 972h- DNA replication factor C complex subunit Ctf8 NP_001018293.1 5219635 R 284812 CDS SPAC19D5.06c 19115816 2542540 complement(5220220..5221278) 1 NC_003424.3 Dhp1p-interacting protein Din1 5221278 din1 2542540 din1 Schizosaccharomyces pombe 972h- Dhp1p-interacting protein Din1 NP_594904.1 5220220 R 284812 CDS SPAC19D5.10c 68005908 3361557 complement(join(5221387..5221641,5221711..5221719)) 1 NC_003424.3 changed to dubious based on transcriptome data 08-01-08; dubious 5221719 3361557 SPAC19D5.10c Schizosaccharomyces pombe 972h- dubious NP_001018294.1 5221387 R 284812 CDS SPAC19D5.07 19115817 2542494 5223184..5224608 1 NC_003424.3 4-aminobutyrate aminotransferase (GABA transaminase) 5224608 uga1 2542494 uga1 Schizosaccharomyces pombe 972h- 4-aminobutyrate aminotransferase (GABA transaminase) NP_594905.1 5223184 D 284812 CDS SPAC14C4.01c 63054670 2541681 complement(5225237..5225971) 1 NC_003424.3 DUF1770 family protein 5225971 2541681 SPAC14C4.01c Schizosaccharomyces pombe 972h- DUF1770 family protein NP_594906.2 5225237 R 284812 CDS SPAC14C4.02c 19115819 2541587 complement(join(5226406..5229417,5229467..5229652)) 1 NC_003424.3 Smc5-6 complex SMC subunit Smc5 5229652 smc5 2541587 smc5 Schizosaccharomyces pombe 972h- Smc5-6 complex SMC subunit Smc5 NP_594907.1 5226406 R 284812 CDS SPAC14C4.16 68005924 3361558 join(5229826..5229903,5229941..5230123) 1 NC_003424.3 DASH complex subunit Dad3 5230123 dad3 3361558 dad3 Schizosaccharomyces pombe 972h- DASH complex subunit Dad3 NP_001018295.1 5229826 D 284812 CDS SPAC14C4.03 19115820 2541604 join(5231140..5231296,5231337..5231871,5231921..5232566) 1 NC_003424.3 Cds1/Rad53/Chk2 family protein kinase Mek1 5232566 mek1 2541604 mek1 Schizosaccharomyces pombe 972h- Cds1/Rad53/Chk2 family protein kinase Mek1 NP_594908.1 5231140 D 284812 CDS SPAC14C4.04 19115821 2542101 5234293..5235096 1 NC_003424.3 hypothetical protein 5235096 B22918-2 2542101 B22918-2 Schizosaccharomyces pombe 972h- hypothetical protein NP_594909.1 5234293 D 284812 CDS SPAC14C4.05c 19115822 2541585 complement(5235784..5238318) 1 NC_003424.3 LEM domain protein Man1, Sad1 interacting factor 5238318 mug61 2541585 mug61 Schizosaccharomyces pombe 972h- LEM domain protein Man1, Sad1 interacting factor NP_594910.1 5235784 R 284812 CDS SPAC14C4.06c 19115823 2541466 complement(join(5238805..5239047,5239094..5239192,5239236..5239817)) 1 NC_003424.3 novel or divergent zinc finger, no family identified but similar to zf-CCCH; poly(A) binding protein Nab2 (predicted) 5239817 2541466 SPAC14C4.06c Schizosaccharomyces pombe 972h- poly(A) binding protein Nab2 (predicted) NP_594911.1 5238805 R 284812 CDS SPAC14C4.07 19115824 2541546 5240792..5242726 1 NC_003424.3 membrane transporter 5242726 2541546 SPAC14C4.07 Schizosaccharomyces pombe 972h- membrane transporter NP_594912.1 5240792 D 284812 CDS SPAC14C4.08 19115825 2541696 5243071..5243610 1 NC_003424.3 meiotically upregulated gene Mug5 5243610 mug5 2541696 mug5 Schizosaccharomyces pombe 972h- meiotically upregulated gene Mug5 NP_594913.1 5243071 D 284812 CDS SPAC14C4.09 68005944 3361560 5244207..5245481 1 NC_003424.3 extended by 22 amino acids at N-term PMID:15194814; glucan endo-1,3-alpha-glucosidase Agn1 5245481 agn1 3361560 agn1 Schizosaccharomyces pombe 972h- glucan endo-1,3-alpha-glucosidase Agn1 NP_001018296.1 5244207 D 284812 CDS SPAC14C4.10c 19115827 2541421 complement(join(5246039..5246610,5246673..5247090)) 1 NC_003424.3 Nudix family hydrolase 5247090 2541421 SPAC14C4.10c Schizosaccharomyces pombe 972h- Nudix family hydrolase NP_594915.1 5246039 R 284812 CDS SPAC14C4.11 19115828 2541428 join(5247756..5247923,5248131..5250167) 1 NC_003424.3 polyphosphate synthetase (predicted) 5250167 2541428 SPAC14C4.11 Schizosaccharomyces pombe 972h- polyphosphate synthetase (predicted) NP_594916.1 5247756 D 284812 CDS SPAC14C4.12c 19115829 2541650 complement(5251141..5252034) 1 NC_003424.3 clr6 L associated factor 1 Laf1 5252034 laf1 2541650 laf1 Schizosaccharomyces pombe 972h- clr6 L associated factor 1 Laf1 NP_594917.1 5251141 R 284812 CDS SPAC14C4.13 19115830 2541643 join(5253358..5253568,5253612..5253715,5253773..5255278) 1 NC_003424.3 RFC related checkpoint protein Rad17 5255278 rad17 2541643 rad17 Schizosaccharomyces pombe 972h- RFC related checkpoint protein Rad17 NP_594918.1 5253358 D 284812 CDS SPAC14C4.14 19115831 2541526 join(5256781..5256843,5257013..5257072,5257342..5258829) 1 NC_003424.3 F1-ATPase alpha subunit 5258829 atp1 2541526 atp1 Schizosaccharomyces pombe 972h- F1-ATPase alpha subunit NP_594919.1 5256781 D 284812 CDS SPAC14C4.15c 63054673 2542105 complement(join(5259148..5260252,5260297..5261753)) 1 NC_003424.3 dipeptidyl peptidase (predicted) 5261753 2542105 SPAC14C4.15c Schizosaccharomyces pombe 972h- dipeptidyl peptidase (predicted) NP_594920.2 5259148 R 284812 CDS SPAPJ760.02c 19115833 2542979 complement(join(5262392..5264817,5264883..5265030)) 1 NC_003424.3 divergent repeat containing consensus PVVPE[VA]PSVPQPP[AV][AV] (10); App1 protein 5265030 app1 2542979 app1 Schizosaccharomyces pombe 972h- App1 protein NP_594921.1 5262392 R 284812 CDS SPAPJ760.03c 19115834 2543050 complement(5265853..5266353) 1 NC_003424.3 ace2 dependent gene; sequence orphan 5266353 adg1 2543050 adg1 Schizosaccharomyces pombe 972h- sequence orphan NP_594922.1 5265853 R 284812 CDS SPAC2H10.01 19115835 2541664 5274171..5275613 1 NC_003424.3 transcription factor, zf-fungal binuclear cluster type (predicted) 5275613 2541664 SPAC2H10.01 Schizosaccharomyces pombe 972h- transcription factor, zf-fungal binuclear cluster type (predicted) NP_594923.1 5274171 D 284812 CDS SPAC2H10.02c 19115836 2543070 complement(join(5276195..5276755,5276827..5276907)) 1 NC_003424.3 26S proteasome regulator (predicted) 5276907 2543070 SPAC2H10.02c Schizosaccharomyces pombe 972h- 26S proteasome regulator (predicted) NP_594924.1 5276195 R 284812 CDS SPAC11E3.01c 162312570 3361561 complement(5277498..5281364) 1 NC_003424.3 SNF2 family helicase Swr1 5281364 swr1 3361561 swr1 Schizosaccharomyces pombe 972h- SNF2 family helicase Swr1 XP_001713118.1 5277498 R 284812 CDS SPAC11E3.02c 19115838 2542968 complement(join(5281940..5285570,5285617..5285699)) 1 NC_003424.3 C2 domain protein 5285699 2542968 SPAC11E3.02c Schizosaccharomyces pombe 972h- C2 domain protein NP_594926.1 5281940 R 284812 CDS SPAC11E3.03 68005983 3361562 join(5286289..5286562,5286606..5286821,5286877..5287055) 1 NC_003424.3 13.04.2003 N terminal truncated, removed exon 9067..9103, truncated from 9149 to 9211 start PMID 12689592; chromosome segregation protein Pcs1 (predicted) 5287055 pcs1 3361562 pcs1 Schizosaccharomyces pombe 972h- chromosome segregation protein Pcs1 (predicted) NP_001018298.1 5286289 D 284812 CDS SPAC11E3.04c 19115841 2542925 complement(join(5287384..5287556,5287614..5287698,5287851..5288012,5288055..5288081)) 1 NC_003424.3 ubiquitin conjugating enzyme Ubc13 5288081 ubc13 2542925 ubc13 Schizosaccharomyces pombe 972h- ubiquitin conjugating enzyme Ubc13 NP_594929.1 5287384 R 284812 CDS SPAC11E3.05 19115842 2541877 5288392..5292363 1 NC_003424.3 ubiquitin-protein ligase E3 5292363 2541877 SPAC11E3.05 Schizosaccharomyces pombe 972h- ubiquitin-protein ligase E3 NP_594930.1 5288392 D 284812 CDS SPAC11E3.06 19115843 2541765 join(5292795..5292938,5293023..5293191,5293461..5294344) 1 NC_003424.3 MADS-box transcription factor Map1 5294344 map1 2541765 map1 Schizosaccharomyces pombe 972h- MADS-box transcription factor Map1 NP_594931.1 5292795 D 284812 CDS SPAC11E3.07 19115844 2543000 5295021..5295704 1 NC_003424.3 V-type ATPase subunit E 5295704 vma4 2543000 vma4 Schizosaccharomyces pombe 972h- V-type ATPase subunit E NP_594932.1 5295021 D 284812 CDS SPAC11E3.08c 19115845 2541512 complement(5296165..5297733) 1 NC_003424.3 Smc5-6 complex non-SMC subunit Nse6 5297733 nse6 2541512 nse6 Schizosaccharomyces pombe 972h- Smc5-6 complex non-SMC subunit Nse6 NP_594933.1 5296165 R 284812 CDS SPAC11E3.09 19115846 2541443 join(5298838..5299125,5299231..5299854) 1 NC_003424.3 protein-tyrosine phosphatase Pyp3 5299854 pyp3 2541443 pyp3 Schizosaccharomyces pombe 972h- protein-tyrosine phosphatase Pyp3 NP_594934.1 5298838 D 284812 CDS SPAC11E3.10 19115847 2541504 join(5300782..5300843,5300925..5300948,5301116..5301302,5301350..5301379,5301457..5301642) 1 NC_003424.3 VanZ-like family protein 5301642 2541504 SPAC11E3.10 Schizosaccharomyces pombe 972h- VanZ-like family protein NP_594935.1 5300782 D 284812 CDS SPAC11E3.11c 19115848 2541783 complement(5302569..5305397) 1 NC_003424.3 guanyl-nucleotide exchange factor (predicted) 5305397 2541783 SPAC11E3.11c Schizosaccharomyces pombe 972h- guanyl-nucleotide exchange factor (predicted) NP_594936.1 5302569 R 284812 CDS SPAC11E3.12 19115849 2542955 join(5305838..5306043,5306103..5306265,5306315..5306434) 1 NC_003424.3 this coding sequence was previously annotated to the NADH dehydrogenase of the mitochondrial respiratory chain complex I. This annotation was removed due to lack of the other 40 subunits that are present in that complex in mammals (PMID:1518044). It is suggested that this protein may have an alternative role in fatty acid biosynthesis (PMID:1518044).; conserved eukaryotic protein 5306434 2542955 SPAC11E3.12 Schizosaccharomyces pombe 972h- conserved eukaryotic protein NP_594937.1 5305838 D 284812 CDS SPAC11E3.13c 19115850 2542989 complement(5307065..5308597) 1 NC_003424.3 cell wall protein Gas5, 1,3-beta-glucanosyltransferase (predicted) 5308597 gas5 2542989 gas5 Schizosaccharomyces pombe 972h- cell wall protein Gas5, 1,3-beta-glucanosyltransferase (predicted) NP_594938.1 5307065 R 284812 CDS SPAC11E3.14 19115851 2542997 5312420..5314186 1 NC_003424.3 conserved eukaryotic protein 5314186 2542997 SPAC11E3.14 Schizosaccharomyces pombe 972h- conserved eukaryotic protein NP_594939.1 5312420 D 284812 CDS SPAC11E3.15 19115852 2543021 join(5314862..5314867,5314914..5315165,5315222..5315317) 1 NC_003424.3 60S ribosomal protein L22 5315317 rpl22 2543021 rpl22 Schizosaccharomyces pombe 972h- 60S ribosomal protein L22 NP_594940.1 5314862 D 284812 CDS SPAP8A3.02c 19115853 2541495 complement(5315814..5316491) 1 NC_003424.3 2 OG-Fe(II) oxygenase superfamily protein Ofd2 5316491 ofd2 2541495 ofd2 Schizosaccharomyces pombe 972h- 2 OG-Fe(II) oxygenase superfamily protein Ofd2 NP_594941.1 5315814 R 284812 CDS SPAP8A3.03 19115854 2542125 5317939..5319300 1 NC_003424.3 ZIP zinc transporter 1 5319300 2542125 SPAP8A3.03 Schizosaccharomyces pombe 972h- ZIP zinc transporter 1 NP_594942.1 5317939 D 284812 CDS SPAP8A3.04c 19115855 2542035 complement(5320399..5320605) 1 NC_003424.3 possible sequencing error, 98 aa version reported (PMID:8654972); heat shock protein Hsp9 5320605 hsp9 2542035 hsp9 Schizosaccharomyces pombe 972h- heat shock protein Hsp9 NP_594943.1 5320399 R 284812 CDS SPAP8A3.05 19115856 2541693 join(5322527..5322722,5322778..5323251,5323312..5324283,5324324..5324408,5324446..5324806) 1 NC_003424.3 ski complex interacting GTPase (predicted) 5324806 2541693 SPAP8A3.05 Schizosaccharomyces pombe 972h- ski complex interacting GTPase (predicted) NP_594944.1 5322527 D 284812 CDS SPAP8A3.06 19115857 2542482 5325611..5326261 1 NC_003424.3 U2AF small subunit, U2AF-23 5326261 2542482 SPAP8A3.06 Schizosaccharomyces pombe 972h- U2AF small subunit, U2AF-23 NP_594945.1 5325611 D 284812 CDS SPAP8A3.07c 19115858 2542597 complement(join(5326720..5327829,5328101..5328109)) 1 NC_003424.3 phospho-2-dehydro-3-deoxyheptonate aldolase (predicted) 5328109 2542597 SPAP8A3.07c Schizosaccharomyces pombe 972h- phospho-2-dehydro-3-deoxyheptonate aldolase (predicted) NP_594946.1 5326720 R 284812 CDS SPAP8A3.08 19115859 2541699 join(5329218..5329248,5329301..5329432,5329506..5329646,5329713..5329805,5329878..5329906) 1 NC_003424.3 myosin II light chain 5329906 cdc4 2541699 cdc4 Schizosaccharomyces pombe 972h- myosin II light chain NP_594947.1 5329218 D 284812 CDS SPAP8A3.09c 19115860 2543042 complement(join(5330519..5330779,5330825..5331162,5331218..5331318,5331380..5332283,5332392..5332497,5332552..5332599,5332651..5332665)) 1 NC_003424.3 we predict MQTEN at N terminus instead of MLDNS; protein phosphatase regulatory subunit Paa1 5332665 paa1 2543042 paa1 Schizosaccharomyces pombe 972h- protein phosphatase regulatory subunit Paa1 NP_594948.1 5330519 R 284812 CDS SPAP8A3.10 19115861 2542962 join(5334178..5334260,5334328..5334760) 1 NC_003424.3 mitochondrial intermembrane space protein sorting protein 5334760 2542962 SPAP8A3.10 Schizosaccharomyces pombe 972h- mitochondrial intermembrane space protein sorting protein NP_594949.1 5334178 D 284812 CDS SPAP8A3.11c 19115862 2543126 complement(join(5334980..5336152,5336212..5336298)) 1 NC_003424.3 mitochondrial GTPase Mtg2 5336298 2543126 SPAP8A3.11c Schizosaccharomyces pombe 972h- mitochondrial GTPase Mtg2 NP_594950.1 5334980 R 284812 CDS SPAP8A3.12c 19115863 2543179 complement(5336815..5340639) 1 NC_003424.3 tripeptidyl-peptidase II Tpp2 5340639 tpp2 2543179 tpp2 Schizosaccharomyces pombe 972h- tripeptidyl-peptidase II Tpp2 NP_594951.1 5336815 R 284812 CDS SPAP8A3.13c 19115864 2543156 complement(5341027..5342670) 1 NC_003424.3 Vid24 family protein 5342670 2543156 SPAP8A3.13c Schizosaccharomyces pombe 972h- Vid24 family protein NP_594952.1 5341027 R 284812 CDS SPAP8A3.14c 19115865 2543149 complement(5343874..5345907) 1 NC_003424.3 mitochondrial inner membrane protein (predicted) 5345907 2543149 SPAP8A3.14c Schizosaccharomyces pombe 972h- mitochondrial inner membrane protein (predicted) NP_594953.1 5343874 R 284812 CDS SPAC4D7.01c 19115866 2543610 complement(join(5346324..5350780,5350830..5351808)) 1 NC_003424.3 Sec7 domain protein, ARF GEF (predicted) 5351808 sec71 2543610 sec71 Schizosaccharomyces pombe 972h- Sec7 domain protein, ARF GEF (predicted) NP_594954.1 5346324 R 284812 CDS SPAC4D7.02c 19115867 2543587 complement(join(5352606..5353449,5353557..5353672)) 1 NC_003424.3 glycerophosphoryl diester phosphodiesterase (predicted) 5353672 2543587 SPAC4D7.02c Schizosaccharomyces pombe 972h- glycerophosphoryl diester phosphodiesterase (predicted) NP_594955.1 5352606 R 284812 CDS SPAC4D7.03 19115868 2543514 5355131..5357242 1 NC_003424.3 F-box/WD repeat protein Pop2 5357242 pop2 2543514 pop2 Schizosaccharomyces pombe 972h- F-box/WD repeat protein Pop2 NP_594956.1 5355131 D 284812 CDS SPAC4D7.04c 19115869 2543620 complement(join(5357392..5357502,5357558..5357774,5357821..5358080,5358193..5358399)) 1 NC_003424.3 cis-prenyltransferase (predicted) 5358399 2543620 SPAC4D7.04c Schizosaccharomyces pombe 972h- cis-prenyltransferase (predicted) NP_594957.1 5357392 R 284812 CDS SPAC4D7.05 19115870 2543537 join(5358956..5359018,5359074..5359194,5359551..5360353) 1 NC_003424.3 translation initiation factor eIF3i 5360353 sum1 2543537 sum1 Schizosaccharomyces pombe 972h- translation initiation factor eIF3i NP_594958.1 5358956 D 284812 CDS SPAC4D7.06c 19115871 2543624 complement(join(5360572..5361331,5361503..5361537)) 1 NC_003424.3 siroheme synthase (predicted) 5361537 2543624 SPAC4D7.06c Schizosaccharomyces pombe 972h- siroheme synthase (predicted) NP_594959.1 5360572 R 284812 CDS SPAC4D7.07c 19115872 2543524 complement(5361908..5363710) 1 NC_003424.3 sequence orphan 5363710 2543524 SPAC4D7.07c Schizosaccharomyces pombe 972h- sequence orphan NP_594960.1 5361908 R 284812 CDS SPAC4D7.08c 19115873 2543626 complement(5364360..5365961) 1 NC_003424.3 amidophosphoribosyltransferase Ade4 5365961 ade4 2543626 ade4 Schizosaccharomyces pombe 972h- amidophosphoribosyltransferase Ade4 NP_594961.1 5364360 R 284812 CDS SPAC4D7.09 19115874 2543622 join(5367548..5367696,5367821..5368091,5368188..5368659,5368701..5368843,5368915..5369286) 1 NC_003424.3 translation initiation factor eIF2B 5369286 tif223 2543622 tif223 Schizosaccharomyces pombe 972h- translation initiation factor eIF2B NP_594962.1 5367548 D 284812 CDS SPAC4D7.10c 19115875 2543675 complement(join(5370180..5370466,5370554..5371540,5371623..5371770)) 1 NC_003424.3 SAGA complex subunit Spt20 (predicted) 5371770 spt20 2543675 spt20 Schizosaccharomyces pombe 972h- SAGA complex subunit Spt20 (predicted) NP_594963.1 5370180 R 284812 CDS SPAC4D7.11 19115876 2543396 join(5372201..5372301,5372356..5372398,5372503..5373204) 1 NC_003424.3 conserved fungal protein 5373204 2543396 SPAC4D7.11 Schizosaccharomyces pombe 972h- conserved fungal protein NP_594964.1 5372201 D 284812 CDS SPAC4D7.12c 19115877 2543397 complement(join(5374117..5374281,5374327..5374992)) 1 NC_003424.3 ATP binding protein Fet5 (predicted) 5374992 fet5 2543397 fet5 Schizosaccharomyces pombe 972h- ATP binding protein Fet5 (predicted) NP_594965.1 5374117 R 284812 CDS SPAC4D7.13 19115878 2543409 5375612..5377699 1 NC_003424.3 U1 snRNP-associated protein Usp104 5377699 usp104 2543409 usp104 Schizosaccharomyces pombe 972h- U1 snRNP-associated protein Usp104 NP_594966.1 5375612 D 284812 CDS SPAC3G6.01 19115879 2543064 join(5378427..5378618,5378676..5382650) 1 NC_003424.3 ATP-dependent DNA helicase Hrp3 5382650 hrp3 2543064 hrp3 Schizosaccharomyces pombe 972h- ATP-dependent DNA helicase Hrp3 NP_594967.1 5378427 D 284812 CDS SPAC3G6.02 19115880 2543058 join(5383093..5383123,5383230..5383271,5383312..5383454) 1 NC_003424.3 mRNA export protein Dss1 5383454 dss1 2543058 dss1 Schizosaccharomyces pombe 972h- mRNA export protein Dss1 NP_594968.1 5383093 D 284812 CDS SPAC3G6.03c 19115881 2543209 complement(join(5383955..5384083,5384207..5384530,5384630..5384758,5385010..5385138)) 1 NC_003424.3 Maf-like protein 5385138 2543209 SPAC3G6.03c Schizosaccharomyces pombe 972h- Maf-like protein NP_594969.1 5383955 R 284812 CDS SPAC3G6.04 19115882 2542965 5385883..5386992 1 NC_003424.3 RNA-binding protein Rnp24 5386992 rnp24 2542965 rnp24 Schizosaccharomyces pombe 972h- RNA-binding protein Rnp24 NP_594970.1 5385883 D 284812 CDS SPAC3G6.05 19115883 2543194 join(5388586..5388963,5389020..5389091,5389156..5389253,5389323..5389395) 1 NC_003424.3 Mvp17/PMP22 family protein 1 5389395 2543194 SPAC3G6.05 Schizosaccharomyces pombe 972h- Mvp17/PMP22 family protein 1 NP_594971.1 5388586 D 284812 CDS SPAC3G6.06c 19115884 2543164 complement(join(5389669..5390707,5391089..5391179,5391249..5391261)) 1 NC_003424.3 FEN-1 endonuclease 5391261 rad2 2543164 rad2 Schizosaccharomyces pombe 972h- FEN-1 endonuclease NP_594972.1 5389669 R 284812 CDS SPAC3G6.07 19115885 2543067 5392273..5392650 1 NC_003424.3 dubious 5392650 2543067 SPAC3G6.07 Schizosaccharomyces pombe 972h- dubious NP_594973.1 5392273 D 284812 CDS SPAC3G6.08 19115886 2543175 5393688..5394236 1 NC_003424.3 sulfhydryl oxidase (predicted) 5394236 erv1 2543175 erv1 Schizosaccharomyces pombe 972h- sulfhydryl oxidase (predicted) NP_594974.1 5393688 D 284812 CDS SPAC3G6.09c 19115887 2543109 complement(5394646..5397195) 1 NC_003424.3 trehalose-phosphate synthase Tps2 (predicted) 5397195 tps2 2543109 tps2 Schizosaccharomyces pombe 972h- trehalose-phosphate synthase Tps2 (predicted) NP_594975.1 5394646 R 284812 CDS SPAC3G6.10c 19115888 2543127 complement(5397600..5398079) 1 NC_003424.3 human c11orf2; GARP complex subunit Vps51 (predicted) 5398079 2543127 SPAC3G6.10c Schizosaccharomyces pombe 972h- GARP complex subunit Vps51 (predicted) NP_594976.1 5397600 R 284812 CDS SPAC3G6.11 19115889 2543118 join(5399114..5399752,5399818..5400010,5400070..5401772) 1 NC_003424.3 NAS annotations inferred by curator from PMID:16182251; ATP-dependent DNA helicase Chl1 5401772 2543118 SPAC3G6.11 Schizosaccharomyces pombe 972h- ATP-dependent DNA helicase Chl1 NP_594977.1 5399114 D 284812 CDS SPAC3G6.13c 19115890 2542213 complement(join(5402104..5402110,5402163..5402233)) 1 NC_003424.3 60S ribosomal protein L41 5402233 rpl4101 2542213 rpl4101 Schizosaccharomyces pombe 972h- 60S ribosomal protein L41 NP_594978.1 5402104 R 284812 CDS SPAC29B12.01 68006105 3361566 5403241..5408055 1 NC_003424.3 SNF2 family helicase Ino80 5408055 ino80 3361566 ino80 Schizosaccharomyces pombe 972h- SNF2 family helicase Ino80 NP_001018299.1 5403241 D 284812 CDS SPAC29B12.02c 19115892 2542070 complement(5408418..5410814) 1 NC_003424.3 histone lysine methyltransferase Set2 (predicted) 5410814 set2 2542070 set2 Schizosaccharomyces pombe 972h- histone lysine methyltransferase Set2 (predicted) NP_594980.1 5408418 R 284812 CDS SPAC29B12.03 19115893 2542696 5412489..5412863 1 NC_003424.3 ribonucleotide reductase (RNR) inhibitor 5412863 spd1 2542696 spd1 Schizosaccharomyces pombe 972h- ribonucleotide reductase (RNR) inhibitor NP_594981.1 5412489 D 284812 CDS SPAC29B12.04 19115894 2542689 5415186..5416076 1 NC_003424.3 pyridoxine biosynthesis protein 5416076 snz1 2542689 snz1 Schizosaccharomyces pombe 972h- pyridoxine biosynthesis protein NP_594982.1 5415186 D 284812 CDS SPAC29B12.05c 19115895 2542697 complement(5416351..5417280) 1 NC_003424.3 mitochondrial S-adenosylmethionine-dependent methyltransferase (possibly N(5)-glutamine) 5417280 2542697 SPAC29B12.05c Schizosaccharomyces pombe 972h- mitochondrial S-adenosylmethionine-dependent methyltransferase (possibly N(5)-glutamine) NP_594983.1 5416351 R 284812 CDS SPAC29B12.06c 19115896 2542094 complement(5417960..5418811) 1 NC_003424.3 RNA-binding protein, CCR4-NOT complex subunit Rcd1 5418811 rcd1 2542094 rcd1 Schizosaccharomyces pombe 972h- RNA-binding protein, CCR4-NOT complex subunit Rcd1 NP_594984.1 5417960 R 284812 CDS SPAC29B12.07 19115897 2542678 5419997..5425984 1 NC_003424.3 multidomain vesicle coat component Sec16 5425984 sec16 2542678 sec16 Schizosaccharomyces pombe 972h- multidomain vesicle coat component Sec16 NP_594985.1 5419997 D 284812 CDS SPAC29B12.08 162312572 2542669 join(5428786..5428883,5429122..5431072) 1 NC_003424.3 N-term may be over-extended into 5' UTR; sequence orphan 5431072 2542669 SPAC29B12.08 Schizosaccharomyces pombe 972h- sequence orphan NP_594986.2 5428786 D 284812 CDS SPAC29B12.10c 19115899 2542082 complement(5431858..5434413) 1 NC_003424.3 glutathione transporter Pgt1 5434413 pgt1 2542082 pgt1 Schizosaccharomyces pombe 972h- glutathione transporter Pgt1 NP_594987.1 5431858 R 284812 CDS SPAC29B12.11c 19115900 2542813 complement(5436678..5437202) 1 NC_003424.3 human WW domain binding protein-2 ortholog 5437202 2542813 SPAC29B12.11c Schizosaccharomyces pombe 972h- human WW domain binding protein-2 ortholog NP_594988.1 5436678 R 284812 CDS SPAC29B12.12 19115901 2542713 5438212..5438553 1 NC_003424.3 helper of TIM (predicted) 5438553 2542713 SPAC29B12.12 Schizosaccharomyces pombe 972h- helper of TIM (predicted) NP_594989.1 5438212 D 284812 CDS SPAC29B12.13 19115902 2542706 5439049..5439462 1 NC_003424.3 carbon-sulfur lyase (predicted) 5439462 2542706 SPAC29B12.13 Schizosaccharomyces pombe 972h- carbon-sulfur lyase (predicted) NP_594990.1 5439049 D 284812 CDS SPAC29B12.14c 19115903 2541559 complement(5439849..5441594) 1 NC_003424.3 purine transporter (predicted) 5441594 2541559 SPAC29B12.14c Schizosaccharomyces pombe 972h- purine transporter (predicted) NP_594991.1 5439849 R 284812 CDS SPAC1039.01 19115904 2542956 5445350..5447053 1 NC_003424.3 amino acid permease, unknown 5 5447053 2542956 SPAC1039.01 Schizosaccharomyces pombe 972h- amino acid permease, unknown 5 NP_594992.1 5445350 D 284812 CDS SPAC1039.02 19115905 2543024 5449717..5451522 1 NC_003424.3 phosphoprotein phosphatase (predicted) 5451522 2543024 SPAC1039.02 Schizosaccharomyces pombe 972h- phosphoprotein phosphatase (predicted) NP_594993.1 5449717 D 284812 CDS SPAC1039.03 19115906 2543023 5452729..5453754 1 NC_003424.3 esterase/lipase (predicted) 5453754 2543023 SPAC1039.03 Schizosaccharomyces pombe 972h- esterase/lipase (predicted) NP_594994.1 5452729 D 284812 CDS SPAC1039.04 19115907 2542960 5454901..5456424 1 NC_003424.3 nicotinic acid plasma membrane transporter (predicted) 5456424 2542960 SPAC1039.04 Schizosaccharomyces pombe 972h- nicotinic acid plasma membrane transporter (predicted) NP_594995.1 5454901 D 284812 CDS SPAC1039.05c 19115908 2541685 complement(join(5456745..5456788,5456840..5457472,5457528..5457826,5457872..5457993,5458047..5459173,5459275..5459395)) 1 NC_003424.3 zinc finger protein Klf1 5459395 klf1 2541685 klf1 Schizosaccharomyces pombe 972h- zinc finger protein Klf1 NP_594996.1 5456745 R 284812 CDS SPAC1039.06 19115909 2542996 5460567..5461814 1 NC_003424.3 S. cerevisiae YGL196W is either pseudo, or has 3 frameshifts; alanine racemase (predicted) 5461814 2542996 SPAC1039.06 Schizosaccharomyces pombe 972h- alanine racemase (predicted) NP_594997.1 5460567 D 284812 CDS SPAC1039.07c 19115910 2542926 complement(5462443..5463789) 1 NC_003424.3 aminotransferase class-III, unknown specificity 5463789 2542926 SPAC1039.07c Schizosaccharomyces pombe 972h- aminotransferase class-III, unknown specificity NP_594998.1 5462443 R 284812 CDS SPAC1039.08 19115911 2542932 5464248..5465060 1 NC_003424.3 serine acetyltransferase (predicted) 5465060 2542932 SPAC1039.08 Schizosaccharomyces pombe 972h- serine acetyltransferase (predicted) NP_594999.1 5464248 D 284812 CDS SPAC1039.09 19115912 2543028 5466778..5468520 1 NC_003424.3 amino acid permease Isp5 5468520 isp5 2543028 isp5 Schizosaccharomyces pombe 972h- amino acid permease Isp5 NP_595000.1 5466778 D 284812 CDS SPAC1039.10 19115913 2543017 join(5470914..5471227,5471284..5471350) 1 NC_003424.3 homologous Pmf1p factor 1 5471350 mmf2 2543017 mmf2 Schizosaccharomyces pombe 972h- homologous Pmf1p factor 1 NP_595001.1 5470914 D 284812 CDS SPAC1039.11c 162312574 5802985 complement(5471561..5474548) 1 NC_003424.3 alpha-glucosidase (predicted) 5474548 5802985 SPAC1039.11c Schizosaccharomyces pombe 972h- alpha-glucosidase (predicted) XP_001713119.1 5471561 R 284812 CDS SPAC922.03 19115915 2543564 join(5476877..5477883,5477948..5477957) 1 NC_003424.3 1-aminocyclopropane-1-carboxylate deaminase (predicted) 5477957 2543564 SPAC922.03 Schizosaccharomyces pombe 972h- 1-aminocyclopropane-1-carboxylate deaminase (predicted) NP_595003.1 5476877 D 284812 CDS SPAC922.04 19115916 2543561 5479978..5480331 1 NC_003424.3 has transcript; sequence orphan 5480331 2543561 SPAC922.04 Schizosaccharomyces pombe 972h- sequence orphan NP_595004.1 5479978 D 284812 CDS SPAC922.05c 19115917 2543555 complement(5483049..5484563) 1 NC_003424.3 membrane transporter (predicted) 5484563 2543555 SPAC922.05c Schizosaccharomyces pombe 972h- membrane transporter (predicted) NP_595005.1 5483049 R 284812 CDS SPAC922.06 19115918 2543550 5485371..5486147 1 NC_003424.3 YNL202W, but possibly not functional orthologs as pombe seems to be missing this peroxisomal beta oxidation pathway; short chain dehydrogenase (predicted) 5486147 2543550 SPAC922.06 Schizosaccharomyces pombe 972h- short chain dehydrogenase (predicted) NP_595006.1 5485371 D 284812 CDS SPAC922.07c 19115919 2543659 complement(5487116..5488606) 1 NC_003424.3 aldehyde dehydrogenase (predicted) 5488606 2543659 SPAC922.07c Schizosaccharomyces pombe 972h- aldehyde dehydrogenase (predicted) NP_595007.1 5487116 R 284812 CDS SPAC869.11 63054678 2543573 complement(5489385..5491127) 1 NC_003424.3 cationic amino acid transporter Cat1 5491127 cat1 2543573 cat1 Schizosaccharomyces pombe 972h- cationic amino acid transporter Cat1 NP_595008.2 5489385 R 284812 CDS SPAC869.10c 19115921 2543679 5493222..5494880 1 NC_003424.3 proline specific permease (predicted) 5494880 2543679 SPAC869.10c Schizosaccharomyces pombe 972h- proline specific permease (predicted) NP_595009.1 5493222 D 284812 CDS SPAC869.09 19115922 2543507 complement(5497041..5497391) 1 NC_003424.3 conserved fungal protein 5497391 2543507 SPAC869.09 Schizosaccharomyces pombe 972h- conserved fungal protein NP_595010.1 5497041 R 284812 CDS SPAC869.08 19115923 2543383 complement(5498273..5498965) 1 NC_003424.3 protein carboxyl methyltransferase; protein-L-isoaspartate O-methyltransferase Pcm2 (predicted) 5498965 pcm2 2543383 pcm2 Schizosaccharomyces pombe 972h- protein-L-isoaspartate O-methyltransferase Pcm2 (predicted) NP_595011.1 5498273 R 284812 CDS SPAC869.07c 19115924 2543243 5499782..5501092 1 NC_003424.3 MEL genes are absent from S. cerevisiaie sequenced strain; alpha-galactosidase, melibiase 5501092 mel1 2543243 mel1 Schizosaccharomyces pombe 972h- alpha-galactosidase, melibiase NP_595012.1 5499782 D 284812 CDS SPAC869.06c 19115925 2543135 5502575..5503186 1 NC_003424.3 cation binding protein (predicted) 5503186 2543135 SPAC869.06c Schizosaccharomyces pombe 972h- cation binding protein (predicted) NP_595013.1 5502575 D 284812 CDS SPAC869.05c 19115926 2543130 5505900..5508422 1 NC_003424.3 sulfate transporter (predicted) 5508422 2543130 SPAC869.05c Schizosaccharomyces pombe 972h- sulfate transporter (predicted) NP_595014.1 5505900 D 284812 CDS SPAC869.04 19115927 2543137 complement(5511137..5512369) 1 NC_003424.3 formamidase-like protein 5512369 2543137 SPAC869.04 Schizosaccharomyces pombe 972h- formamidase-like protein NP_595015.1 5511137 R 284812 CDS SPAC869.03c 19115928 2543152 5512757..5514742 1 NC_003424.3 urea transporter (predicted) 5514742 2543152 SPAC869.03c Schizosaccharomyces pombe 972h- urea transporter (predicted) NP_595016.1 5512757 D 284812 CDS SPAC869.02c 19115929 2542104 5517959..5519242 1 NC_003424.3 closest S. cerevisiae protein is YGR234W, but this does not appear to be a true ortholog as clustering shows closer relationship with bacterial and other fungal oxidoreductases, phyletic pattern could be a result of lineage specific gene losses or horizontal transfer in both or either organisms, although they are likely to be functionally equivalent; annotated to 1.14.12.17 from similarity to FHP_CANNO, but could be 1.7.99.7 reverse reaction; nitric oxide dioxygenase (predicted) 5519242 2542104 SPAC869.02c Schizosaccharomyces pombe 972h- nitric oxide dioxygenase (predicted) NP_595017.1 5517959 D 284812 CDS SPAC869.01 19115930 2543104 complement(5521357..5523108) 1 NC_003424.3 amidase (predicted) 5523108 2543104 SPAC869.01 Schizosaccharomyces pombe 972h- amidase (predicted) NP_595018.1 5521357 R 284812 CDS SPAC186.01 19115931 2542453 5527692..5528672 1 NC_003424.3 cell surface glycoprotein (predicted), DIPSY family 5528672 2542453 SPAC186.01 Schizosaccharomyces pombe 972h- cell surface glycoprotein (predicted), DIPSY family NP_595019.1 5527692 D 284812 CDS SPAC186.02c 19115932 2542495 complement(5529962..5530960) 1 NC_003424.3 hydroxyacid dehydrogenase (predicted) 5530960 2542495 SPAC186.02c Schizosaccharomyces pombe 972h- hydroxyacid dehydrogenase (predicted) NP_595020.1 5529962 R 284812 CDS SPAC186.03 19115933 2542491 5535198..5536280 1 NC_003424.3 L-asparaginase (predicted) 5536280 2542491 SPAC186.03 Schizosaccharomyces pombe 972h- L-asparaginase (predicted) NP_595021.1 5535198 D 284812 CDS SPAC186.05c 19115935 2542574 complement(5540350..5541138) 1 NC_003424.3 human TMEM165 homolog 5541138 2542574 SPAC186.05c Schizosaccharomyces pombe 972h- human TMEM165 homolog NP_595023.1 5540350 R 284812 CDS SPAC186.06 19115936 2542595 5542419..5542973 1 NC_003424.3 human MAWBP homolog 5542973 2542595 SPAC186.06 Schizosaccharomyces pombe 972h- human MAWBP homolog NP_595024.1 5542419 D 284812 CDS SPAC186.07c 19115937 2542600 complement(5545615..5546613) 1 NC_003424.3 hydroxyacid dehydrogenase (predicted) 5546613 2542600 SPAC186.07c Schizosaccharomyces pombe 972h- hydroxyacid dehydrogenase (predicted) NP_595025.1 5545615 R 284812 CDS SPAC186.08c 19115938 2542569 complement(join(5548884..5549819,5549956..5550012)) 1 NC_003424.3 L-lactate dehydrogenase (predicted) 5550012 2542569 SPAC186.08c Schizosaccharomyces pombe 972h- L-lactate dehydrogenase (predicted) NP_595026.1 5548884 R 284812 CDS SPAC186.09 19115939 2542602 5552811..5554529 1 NC_003424.3 pyruvate decarboxylase (predicted) 5554529 2542602 SPAC186.09 Schizosaccharomyces pombe 972h- pyruvate decarboxylase (predicted) NP_595027.1 5552811 D 284812 CDS SPAC750.02c 19115940 2541534 complement(5560189..5561646) 1 NC_003424.3 membrane transporter 5561646 2541534 SPAC750.02c Schizosaccharomyces pombe 972h- membrane transporter NP_595028.1 5560189 R 284812 CDS SPAC750.03c 19115941 2542647 complement(5562608..5563045) 1 NC_003424.3 methyltransferase (predicted) 5563045 2542647 SPAC750.03c Schizosaccharomyces pombe 972h- methyltransferase (predicted) NP_595029.1 5562608 R 284812 CDS SPAC750.04c 19115942 2542627 complement(5564211..5564651) 1 NC_003424.3 dubious 5564651 2542627 SPAC750.04c Schizosaccharomyces pombe 972h- dubious NP_595030.1 5564211 R 284812 CDS SPAC750.05c 19115943 2541564 complement(5566206..5567240) 1 NC_003424.3 S. pombe specific 5Tm protein family 5567240 2541564 SPAC750.05c Schizosaccharomyces pombe 972h- S. pombe specific 5Tm protein family NP_595031.1 5566206 R 284812 CDS SPAC750.06c 19115944 2541646 complement(join(5568903..5569255,5569314..5569803)) 1 NC_003424.3 S. pombe specific DUF999 protein family 4 5569803 2541646 SPAC750.06c Schizosaccharomyces pombe 972h- S. pombe specific DUF999 protein family 4 NP_595032.1 5568903 R 284812 CDS SPAC750.07c 19115945 2542711 complement(5575193..5575564) 1 NC_003424.3 S. pombe specific GPI anchored protein family 1 5575564 2542711 SPAC750.07c Schizosaccharomyces pombe 972h- S. pombe specific GPI anchored protein family 1 NP_595033.1 5575193 R 284812 CDS SPAC750.08c 19115946 2542710 complement(5578447..>5579133) 1 NC_003424.3 NAD-dependent malic enzyme >5579133 2542710 SPAC750.08c Schizosaccharomyces pombe 972h- NAD-dependent malic enzyme NP_595034.1 5578447 R 284812 CDS