-- dump date   	20110803_090721
-- class       	Genbank::CDS
-- table       	cds_note
-- id	note
ScpofMp02	intronic ORF
ScpofMp03	intronic ORF
ScpofMp05	intronic ORF
ScpofMp07	urf a; unassigned reading frame a
SPCP20C8.02c	possibly not coding, may be a spurious ORF
SPCC757.06	this is unlikely to be protein coding as neither intron is supported by transcriptome data
SPCC613.11c	repeat consensus MQGTMNT 3/4 copies
SPCC613.12c	cullin-associated methyltransferase complex subunit Cmc1; Rik1-associated factor Raf1; delocalization of swi6 Dos1
SPCC330.19c	added Sept 4 2002, confirmed by EST, val
SPCC330.04c	biased repeat containing protein - 6 copies of 'WKKAREEDKAE' repeat and 6 copies of a smaller 'WRNSMDE' repeat
SPCC320.14	annotations dervived from PMID:12951240, previously annotated as threonine dehydratase
SPCC1235.01	~37 copies of a 7-10 repeat consensus 'PMEEITTMTI' and a S/N rich C terminal region
SPCC1235.02	vitamin metabolic process hardwired for analysis, temporary
SPCC1235.07	PMID:17035632 is pending curation
SPCC1235.15	non consensus intron fixed 19. Nov. 2003 pers. comm. Jan Dungan
SPCC1529.01	coordinates updated 12/Oct?07, pers. comm. Brian Wilhelm
SPCC794.15	below 100 amino acid size threshold
SPCC553.09c	PMID:15314153 is pending GO curation
SPCC553.07c	added missed C-terminal exon (pers. comm. Charly Chahwan); GO:0000790 is Rad17-dependent
SPCC736.12c	targets include meu26, crs1, mug9, meu1, rec8, bqt1, mug1, ssm4, spo5, rec25 PMID:16823445
SPCC594.05c	spp1 is already used by SPAC6B12.10c
SPCC4G3.13c	putative signal sequence at aa 1-20
SPCC364.01	splicing possibly incorrect, non-consensus branch, may use internal Met at position 1166
SPCC970.07c	cullin-associated methyltransferase complex subunit Cmc2; Rik1-associated factor Raf2; delocalization of swi6 Dos2
SPCP31B10.02	conserved VP.KP.EP.NCC.SGC..CVW.Y..DL
SPCP31B10.04	homology to YKL077W is low but has conserved residues by multiple alignment, conserved N-terminal signal peptide and C-terminal transmenbrane helix; confirmed intron
SPCC1183.12	synonym SPNGAF60 is from Solexa transcript data
SPCC1183.09c	NAS (nontraceable author statement) inferred from other family members
SPCC31H12.02c	no evidence for chaperone activity of YCR021C
SPCC16C4.01	GO:0005515 and GO:0005816 pers. comm. Osami Niwa; NAS from=GO:0005816|GO:0016021
SPCC16C4.21	previously predicted protein TR:Q09185, on the 54/1 promoter fragment, but this is 5' of the promoter there is no evidence that it is coding, as it has short length, very low coding potential and no homology
SPCC16C4.10	Pentose phosphate shunt enzymes are cytoplasmic (Bohringer metabolic pathways)
SPCC18B5.05c	Other S. pombe and S. cerevisiae phosphomethylpyrimidine kinases have additional TENA/THI domain
SPCC18B5.09c	was previously annotated as dubious
SPCC14G10.01	SPBC18B5.12 was a typo
SPCC1020.02	S. cerevisiae SPC105 can rescue S. pombe mal3 mutant strains (PMID:15371542); S. Pombe Centromere
SPCC1393.07c	possibly a glycoprotein
SPCC63.13	YMR161W same domain organization and single predicted tmm helix
SPCC16A11.05c	CARE ambiguous gene name
SPCC16A11.07	May use alternative initiation Met at codon 19
SPCC16A11.17	possibly spliced at C-term
SPCC24B10.05	may be additional small exon
SPCC24B10.12	GO component terms are inferres from TAS in Q8IWR7_HUMAN
SPCC24B10.22	mip1 is primary name for SPAC57A7.11
SPCPB16A4.06c	compositionally biased region; previously annotated as dubious, but has localization signal
SPCC1742.01	large repeated threonine-rich region
SPCC1795.12c	previously annotated as dubious, but has localization signal
SPCC1795.11	suppressor of uncontrolled mitosis; Multicopy suppressor of Overexpressed Cyr1
SPCC1259.08	N-terminal may need truncating
SPCC1259.15c	S. cerevisiae E2-C, is not a functional homolog of this E2 because it is not required for the degradation of mitotic cyclin
SPCC645.06c	divergently orientated to rgf1
SPCC645.07	divergently orientated to rgf3
SPCC645.11c	possibly spliced to SPCC645.12c
SPCC23B6.04c	longer than orthologs, possibly a gene fusion
SPCC1322.01	RNA processosome mitochondrial, name derivation
SPCC1322.07c	has transcript profile on microarray
SPCC1322.08	sty1 regulated kinase 1 (PMID 12080074)
SPCC1322.16	may use Met at upstream MNRQ
SPCC132.04c	S. cerevisiae ortholog YDL215C is not normally involved in glutamate biosynthesis (PMID:1975578) i.e reactiondirection is toward 2-oxoglutarate in vitro
SPCC622.21	was originally annotated as pseudo as original prediction had frameshift and stop codon
SPCC622.01c	has transcript CRUK 1227/094591
SPCC622.03c	low complexity gene free region
SPCC622.06c	low complexity gene free region
SPCC622.10c	similar to A. gossypii AGL158C (fasta), A. gossypii AGL158C is syntentic ortholog of S. cerevisiae YDR166C, similarity also from PSI Blast with S. cerevisiae YDR166, but not detectable via Blast or Fasta
SPCC622.15c	this was previously annotated as the ortholog Sae2p but was incorrect prediction
SPCC622.17	added back in frame splice confirmed by (PMID 14704348) was in original prediction, but removed because it disagreed with mRNA; 13-04-2004 Added back 2 N-terminal exons removed because they didn't agree with SP33625; since confirmed by PMID: 14704348
SPCC188.07	coiled coil protein quantitatively enriched Ccq1; possibly related to SMC proteins; orthology prediction pers. comm. Charly Chahwan, Ccq1 is now part od HDA2-3 PF11496
SPCC584.12	has transcript profile on microarray
SPCC584.15c	first intron is unsupported, it may be incorrect, CDS may need trimming to exclude this intron, or there may be another but haven't been able to improve this prediction
SPCC1753.02c	glucose insensitive transcription
SPCC1753.03c	deletion mutant results in frequent occurrence of two-spored asci (PMID 11156975); deletion mutant results in frequent nondisjunction of homologous chromosomes at the first meiotic division (PMID 11156975)
SPCC1753.04	deletion mutant results in sulfite auxotrophy (PMID 10850973)
SPCC13B11.02c	previously annotated as dubious
SPCC777.02	09.07.02 added N-terminal exon to extend homology. perhaps pseudo; 28.10.03 replaced N terminal exon with 2 better exons, still not sure its correct but it looks better than before
SPCC777.03c	region appears to be a duplication of a region of chromosome I cosmid c11D3, region encompasses SPCC777.02 & SPC777.03
SPCC663.06c	there are 4 tandem copies of this hypothetical protein one (SPCC663.07 ) is frameshifted and has been labelled as a pseudogene
SPCC663.08c	there are 4 tandem copies of this hypo thetical protein, one (SPCC663.07) is frameshifted and has been labelled as a pseudogene)
SPCC663.09c	there are 4 tandem copies of this hypothetical protein, one (SPCC663.07 ) is frameshifted and has been labelled as a pseudogene)
SPCC663.11	Dre4 Interacting Factor
SPCC1902.01	orthologous to S. cerevisiae YFL021W but missing conserved N-terminal domain
SPCC417.07c	primary name changed; pers. comm. S. Venkatram; date=20050415
SPCC191.06	has transcript profile on microarray
SPCC1450.08c	splice prediction may be incorrect
SPCC1450.15	looks like a gene merge but was sequenced independently in redundant clone c1100
SPCC1442.04c	WARNING there are 4 bases missing from this sequence AACATCTTCCAAGTTCTCAT GATC CTTTAAAGATTCCTCAAGGT, which will change the C-terminal region slightly. This will be fixed in the next round of corrections; term=frameshifted; date=20090202; PMID:16823372 predict a frameshift at base 1194
SPCC1442.10c	The Rpb2p-Rpb3p-Rpb11p complex has DNA binding activity. Alone, Rpb3p exhibits virtually no DNA binding activity (PMID:9325316)
SPCC1442.13c	C terminal exon added 15.04.2002; old coordinates (26947..27936); new exon extends G-patch domain; 03-12-07 removed this exon as not confirmed by homology or Solexa intron data
SPCC285.08	S. pombe gene appears to be truncated ***possible deletion check***
SPCC1223.10c	sequence update pending
SPCC297.06c	was previously annotated as ribosomal protein based on SGD Mrp8, but there is no evidence for this assignment from experimentation or sequence similarity
SPCC737.03c	Inner MTOC Attachment Site
SPCC737.05	There may be problems with this gene prediction, it appears to be N terminal truncated in comparision to the S. cerevisiae orthologs, although is proximal to N terminal LTR so may have been N-terminally truncated deleted
SPCC737.06c	glutamate-cysteine ligase catalytic subunit has EC 6.3.2.2
SPCC18.01c	ace2 dependent gene
SPCC18.08	YNL073W is not the top Blast hit for SPCC18.08 (top hit YDR037W). However, the domain structure of SPCC18.08 corresponds better to YNL073W than YDR037W
SPCC4F11.03c	shows similar to FG repeat units of GLFG family of nucleoporins; possible alternative in frame intron at 5894..5962, does not improve homology
SPCC1906.01	deletion mutant results in G2/M arrest (cell size checkpoint) activation mediated be Wee1
SPCC126.06	NAS from (pers. comm. David R. Kovar and Thomas D. Pollard)
SPCC1620.08	Due to inconsistencies between the annotation of the proposed S. cerevisiae ortholog LSC2 in SWISSPROT:P53312 and SGD:S0003476 succinate-CoA ligase (GDP-forming)/6.2.1.4 and succinate-CoA ligase (ADP-forming) repectively, we have conservatively annotated to EC 6.2.1.- and GO:0004774, succinate-CoA ligase activity. However, this is likely to be ATP utilising (Pfam:PF02222)
SPCC830.04c	has transcript profile on microarray
SPCC830.08c	2 predicted transmembrane helices
SPCC1919.14c	N-terminal may be incorrectly rredicted
SPCC790.02	NOTE: May have an additional C-term exon
SPCC1840.04	Pombe CAspase 1
SPCC1494.02c	splicing tentative, 1st exon may not be real - also last two exons
SPCC70.12c	predicted as non coding RNA from Solexa data
SPCC70.10	confirmed by mRNA
SPCP1E11.04c	pears and lemons (PMID 15975911)
SPCP1E11.06	May use internal initiator MET
SPCC569.08c	SPCC24E4.01, len:207; NOTE:misnamed as ade8 from S. cerevisiae homolog, but actually maps to the ade5 locus; misnamed as ade8 from S. cerevisiae homolog, but maps to the ade5 locus
SPCC569.09	WARNING, this may be a none coding RNA, longest reading frome in solexa transcript SPNG2623; longest ORF with methionine is 99 amino acids; From Solexa transcript SPNG2623; This transcript is upregulated during stress; non-coding RNA or small protein (predicted)
SPCC569.02c	possibly not coding, may be a spurious ORF
SPBC1348.01	has late log phase cDNA
SPBC1683.05	this does not appear to be a thiamin transporter in S. pombe,thiamine-regulated gene, and does not complement the S. cerevisiae thi7 mutation pers. comm. J. Stolz
SPBC1683.10c	Pombe Ccc1-Like pcl1
SPBC1683.11c	assuming this is mitochondrial and involved in amino acid biosynthesis as YPR006C, rather than peroxizomal involved in glyoxylate pathway as YER065C even though YER065C is more closely related, S. pombe does not have any of the other peroxisomal glyoxylate pathway enzymes
SPBC1198.04c	alternative splicing (EMBL:AF199436)
SPBC660.15	NAS from PMID:16794580, not yet annotated at SGD
SPBC660.16	PMID 10099784 is pending curation
SPBC800.02	WHIskey
SPBC800.03	cryptic loci regulator
SPBC800.09	Supressor of Uncontrolled Mitosis 2
SPBC800.12c	there may be some additional C-terminal exons; the ubiquitin domain appears to be truncated
SPBC1271.08c	has transcript profile on microarray
SPBC1271.06c	has transcript profile on microarray
SPBC1271.01c	otholog candidate YMR094W ? check?
SPBC106.07c	was previously annotated as an acetyltransferase based on S. cerevisiae data, but this annotation was unconfirmed and has subsequently been removed in SGD
SPBC106.10	glucose insensitive transcription 6
SPBC106.14c	GO:0005515 IPI (pers. comm. Rosa Aligue)
SPBC106.17c	appears to be a gene loss in S. cerevisiae, their is no syntenic ortholog of the Ashbya protein AEL098W in S. cerevisiae
SPBC106.19	MAY USE INTERNAL INITITATOR MET
SPBC582.05c	NAS from PMID: 16569515, not yet annotated at SGD
SPBC428.01c	alternative N terminal exon, and alteration to first intron acceptor adds 16 amino acids (pers. comm. Valerie Doye) Nov 17 2003
SPBC428.06c	NAS inferred from PMID: 16275642
SPBC428.11	name from PMID:18808426
SPBC428.15	care, no evidence for GTPase activity
SPBC428.18	PMID 11836525 for similarity
SPBC902.02c	Ctf18 RFC-like complex is required in the absence of Rfc1 (PMID 16040599)
SPBC1685.01	suppressor of calcineurin deficiency (PMID 9427748)
SPBC1685.16	found in directed search for VMA9 ortholog, possibly still missing a bit at the N-term July 18th 2004
SPBC354.04	was previously annotated as dubious
SPBC354.09c	RCA, computational analysis, details avaiable on request
SPBC354.11c	changed to dubious based on transcriptome data 08-01-08
SPBC1706.01	Win1-interacting SH3 domain protein
SPBC839.06	Wis1-Sty1 MAPKK-MAPK cascade (PMID 10428498)
SPBC947.03c	was previously annotated as dubious 29-09-04
SPBPJ4664.02	~250-270 copies of a 12 AA repeat, NSSTPITSSSIL
SPBC530.03c	budding yeast presumed ortholog YIL016W does not have N-terminal ubiquitin domain
SPBC530.06c	frameshift but didnt want to flag as pseudo yet, needs checking again
SPBC530.12c	palmitoyl-protein thioesterase (N-term)/phoshphatidic acid phosphatase PAP2 (C-term)
SPBC36.05c	cryptic loci regulator (PMID 9755190)
SPBC36.06c	Fps1 appears to have YJL167W has retained the functions YPL069C, Spo9 (Fps1 paralog) appears to have farnesyltransferase like S. cerevisiae BTS1 YPL069C which does not have a direct ortholog in fission yeast
SPBC36.08c	candidate S. cerevisiae COG2 ortholog?
SPBC36.12c	glucose insensitive transcription
SPBC713.06	another DNA ligase
SPBC216.02	meiotically upregulated gene Mug21
SPBC646.06c	PMID:15194814 TAG stop codon changes to TAT which lengthened CDS from 407aa to 433aa
SPBC646.09c	A truncated C-terminal version of Int6 overexpression activated Pap1 dependent transcription , but did not affect Pap1 protein abundance, and a concommitant Pap1 dependent induction of stress response genes particularly those implicated in multidrug resistance (PMID 16278451)
SPBC646.12c	suppressor of activated ras1
SPBC646.13	Multicopy suppressor of Overexpressed Cyr1
SPBP35G2.03c	ShuGOshin 1 (Japanese meaning guardian spirit)
SPBP35G2.10	CHD like Fission yeast Protein
SPBP35G2.13c	NAS from PMID:16299513
SPBC146.09c	S. pombe SPAC23E2.02 has HMG box
SPBC146.10	overlaps CDS SPBC146.11c at the 5' end by 7 aa
SPBC146.11c	overlaps CDS SPBC146.10 at the 5' end by 7 aa
SPBC1734.11	predicted to be cytoplasmic, but act on mitochondrial proteins - check?
SPBC1709.02c	assigned cytoplasmic location due to lack of presequence similar to that found on S. cerevisiae YGR094W, used to direct protein to the mitochondria
SPBC1709.05	ask2 is the name which was given to the spurious orf on the opposite strand
SPBC1709.12	GO tracable author statements (TAS) (pers. comm. Yasmine Mamnun and Takashi Toda); RIng-localized protein with homology to Diaphanous GTPase-binding domain
SPBC1709.15c	NAS from PMID: 17128255, needs replacing with ISS when annotated at SGD
SPBC409.03	the gene predicted of YHR079C-A was extended to detect this similarity
SPBC409.05	see GNC for naming issues
SPBC409.08	was originally annotated as a pseudogene, but now has putative predicted splice with no branch site; splice may be incorrect, intron is unsupported, and this could be a single frameshift
SPBC409.09c	PMID:17035632 is pending curation
SPBC409.15	highly acidic C terminus
SPBC409.16c	was previously annotated as dubious
SPBC409.19c	metaxin 1 may be the ortholog of S. cerevisiae TOM37. I have multiply aligned it and it has conserved common residues; TOM37 has a C term TMM region like many metaxin 1 family; both are mitochondrial membrane proteins involved in pre-protein import; S. cerevisiae ortholog for metaxin hasn't been identified and vice versa; can't make a Pfam family because it overlaps with glutathionine S-transferase
SPBC4.03c	NAS from PMID: 18032584
SPBC725.02	S. Pombe YPD1-like protein
SPBC725.13c	Defect in REreplication 13 (PMID:15466421)
SPBC725.14	the name arg6 is tentative and was assigned because this is the only gene involved in arginine biosynthesis between ade7 1076817 on contig pB10D8 and ura5 1150778 on contig pB10D8
SPBC651.03c	GAP for Ypt
SPBC651.05c	defective organization of telomeres
SPBC651.06	COP9/signalosome associated (pers. comm. Tony Carr); merged SPBC651.06 and SPBC651.07 on 26-6-2008, pers. comm. Chary Chahwan
SPBC31A8.01c	RTNLA designation is also used in other species
SPBC3D6.04c	mitotic arrest deficient 1
SPBC3D6.16	no evidence from affey/Solexa
SPBC30B4.01c	52 consecutive serines; extended gene prediction at the N-term by 30 amino acids to include hydrophobic segment which is probably a signal peptide (S. cerevisiae orthologs all have sig peps) 12.11.03
SPBC30B4.08	gene structure updated as per PMID:16797182; the exonucleolytic trimming to generate mature 3'-end of 5.8S rRNA from tricistronic rRNA transcript function is performed by S. cerevisiae ortholog NRG2 which is not orthologous to eri1 PMID:18438419
SPBC27B12.01c	alternative splicing may exist using internal donors at positions 22869 and 22968
SPBC27B12.02	previously annotated as dubious, may not be protein coding
SPBC27B12.05	additional C terminal exon to D1022301
SPBC27B12.07	additional C terminal exon TR:D1022299
SPBC27B12.14	truncated C-terminal
SPBC8D2.07c	formed by merging entries SPBC8D2.07c and SPBC8D2.08c; orthology prediction pers comm R. Maraia
SPBC8D2.18c	This gene is not the gene described in Abe and Shimoda (2000), Genetics 154 1497-1508. They describe it as ORF SPBC8D2.18c, and as a kinase homologous to S. cerevisiae IME2 and S. pombe pit1.mde3 but the gene described in this paper corresponds to SPC8D2.19
SPBC8D2.19	function overlapping with pit1
SPBC17A3.04c	added name rar1 to remove conflicts, mrs1 and mes1 are already implemented as primary names for other genes
SPBC17A3.05c	WARNING: does not appear to be HLJ1 which has a different domain arrangement
SPBP22H7.06	uridine kinase PRINTS false positive
SPBP22H7.09c	updated sequence coordinates; db_xref=PMID:15369671; date=20070105
SPBC32H8.07	glucose insensitive transcription
SPBC11B10.05c	mutant results in random septum positioning (pers. comm. S. Kaplan)
SPBC83.01	overlaps at C terminal with opposite strand orf SPBC83.02c
SPBC83.02c	overlaps at C terminal with opposite strand orf SPBC83.01
SPBC83.19c	previously annotated as dubious, but has localization signal
SPBC29B5.01	target for the Sty1p stress-activated MAP kinase pathway (PMID 882458)
SPBC27.04	was annotated in error as ortholog of S. cerevisiae YNL250W, annotation removed 19.1.2005
SPBC27.05	has transcript profile on microarray but this is co- transcribed with SPBC27.04 (pers. comm. T. Toda); no localization from ORFeome project (Matsuyama et al); strange TMM prediction spatial context
SPBC27.08c	does not have adenylylsulfate kinase activity
SPBC28F2.03	cyp2 in PMID 11690648 is SPAC57A10.03 cyp1
SPBC28F2.08c	WARNING ignore cis trans isomerase ISP4
SPBC19C2.05	YDR247C is more divergent
SPBC2F12.03c	putative in-frame splice between codons 689 and 760
SPBC11G11.05	Note: overlaps SPBC11G11.06 by 4bp
SPBC11G11.06c	Note: overlaps SPBC11G11.05 by 4bp
SPBC18H10.06c	S. pombe paralogues are functionally diverged, S. cerevisiae YKL018W is a member of both CPF and SET1 complex (PMID 14617822)
SPBC18H10.12c	primary name changed 20051010, rpl702 is SPAC3H5.07
SPBC18H10.16	identification of SPBC18H10.16 as can1, pers. comm. Charlie Hoffman
SPBC18H10.19	this looks like it could have a few N-terminal exons, but can't make a gene structure, perhaps has a sequencing error?
SPBC9B6.03	reciprocal best hit of PIB2, but has a much shorter N terminal low complexity region. There is a possibility there is additional N-terminal splicing
SPBC9B6.11c	NOTE the exonucleolytic trimming to generate mature 3'-end of 5.8S rRNA from tricistronic rRNA transcript function performed by the S. cerevisiae ortholog NRG2 is performend by non orthologous eri1 in pombe PMID: 18438419
SPBP16F5.03c	possibly lacks protein kinase activity
SPBC16E9.19	previously annotated as dubious, but has localization signal; compositionally biased ORF
SPBC16E9.12c	PMID:17213188 refers to SPBC16E6.12c in error
SPBC1A4.03c	anomoly: predict additional N-terminal exon which increases homology with TOP2_CANAL/P87078
SPBP23A10.02	overlaps CDS SPBP23A10.03c by 64bps and 3' end
SPBP23A10.03c	overlaps CDS SPBP23A10.02 by 64bp at 3' end
SPBP23A10.04	04.02.2003 coordinates updated additional in-frame splice @ 5325,5371 (pers. comm. Hyun-Joo Yoon Vanderbilt.edu)
SPBP23A10.16	This gene could be involved in both the succinate dehydrogenase complex (ubiquinone) (cytochrome b small subunit) and inner membrane translocase component due to similarity to S. cerevisiae YLR164W, YDR178W and YOR297C
SPBC29A3.21	previously annotated as dubious
SPBC29A3.02c	this protein does not contain the C terminal histadinol dehydrogenase domain
SPBC29A3.04	named incorrectly, updated 20051010
SPBC29A3.06	frameshifted; PMID:16823372 predict a frameshift at base 1557
SPBC29A3.08	may not be an F-box protein; term=frameshifted; date=20090202; PMID:16823372 predict a frameshift at base 485 which changes C terminal amino acids
SPBC18E5.14c	splicing is tentative; SPBC18E5.09c & SPBC18E5.14c merged, pers. comm. Charly Chahwan
SPBC18E5.10	previously annotated as respiratory chain NADH dehydrogenase complex, this mapping was removed due to lack of the remaining 40 subunits found in mammals (PMID:1518044)
SPBC23G7.04c	ortholog data pers. comm. Maria Novatchkova
SPBC1711.05	central repeat region consensus DSESESSSEDSDSSSSSS ~7 copies?
SPBC1711.15c	below 100 amino acid size threshold, included because there is a confirmed upstream intron and this is the largest reading frame in region with MET; previously annotated as dubious, but has localization signal
SPBC17G9.04c	Ba?? S.W et al., submitted
SPBC14C8.13	previously annotated as dubious as overlaps SPBC14C8.14c
SPBC15C4.02	first exon may be incorrect, unsupported
SPBC16H5.12c	possible alternative N-terminal splicing, but no consensus branch
SPBC16H5.11c	Shk1 kinase-binding protein 1
SPBC12D12.01	YJL019W (Ned98) is reciprocal best hit (blast), ordered hsps, has conserved residues with other orthologs, both have 1 TMM, functionally similar
SPBC12D12.09	added new exon to insert KCIDIFGEF, pers. comm. Nicole Kosarek; date=20060801; truncated punultimate exon to remove GIN, pers. comm. Nicole Kosarek; date=20060801
SPBC12D12.05c	final exon possibly incorrect; overlaps opposite strand prediction
SPBC19G7.02	possible N terminal incorrect
SPBC19G7.06	Mads BoX protein 1; gene structure updated 01-12-07, pers. comm. Chris McInerny
SPBC19G7.18c	overlaps with SPBC19G7.12c, one isn't real; SPBC19G7.12c removed because sequence similarity supports SPBC19G7.18c, 20040914
SPBC1921.02	orthology with Rad60, pers. comm. Charly Chahwan
SPBC1921.04c	previously annotated as dubious, but has localization signal; opposite sno20
SPBC21D10.09c	NAS from PMID: 17283062, not yet annotated at SGD
SPBC21D10.06c	map4 designation (pers. comm. Yoshiyuki Imai and Masayuki Yamamoto); WARNING: Map4 in GeneDB contains an array of 5 repeats. In PMID:16857197 9 repeats are reported and this number is the correct number of repeats and will be updated via an insertion into the contig sequence shortly
SPBC21D10.05c	multicopy suppressor of Cdc2 (pers. comm. Nancy Walworth)
SPBC12C2.02c	appears to contain a PF00618 domain below threshold (which is present in S. cerevisiae), but it isn't certain whether this is a GEF as it doesn't appear to have the usually co-occuring PF00617; date=20061012
SPBC365.13c	deletion induces nuclear accumulation of Pap1p and Sty1p (PMID:12896976)
SPBC29A10.02	NAS from AB248101
SPBC29A10.11c	PMID:16823372 predict a frameshift at base 1339
SPBC29A10.12	functional inferences from Clan membership
SPBC25B2.02c	SPCC663.03, pmd1 is more closely related to STE6
SPBC25B2.09c	given primary name mrs1 because rrs1 is used for SPBC29A3.16
SPBC1826.01c	overlaps and extends SPBC25B2.12.c & SPBC6B1.01c
SPBC6B1.03c	WARNING: not sure whether this is a false positive for family/homology/ needs checking
SPBC6B1.09c	02.04.2002 prediction extended (V.W) by 4 N-terminal exons, this identified FHA domain; 07.03.2003 additional intron 25664..25705, and exon extension 25974..25988 (pers. comm. C. Chahwan); slr10 is an FHA domain mutant PMID:18378696
SPBC3E7.01	conjugation defect due to inefficient secretion of pheromone peptides
SPBC4F6.05c	NAS GO:0030134 inferred from GO:0030138 and GO:0006888
SPBC336.01	no S. cerevisiae protein with this domain combination; stimulated by single-stranded DNA-binding protein at low ATP concentration (PMID 9228070); ?Fbh1 inhibits Rhp51 in the absence of Rad22 PMID:16135800?
SPBC336.02	CARE ambiguous gene name
SPBC336.10c	previously thought to function in initiation
SPBC336.14c	Warning, this has a Pfam protein kinase dominan, but none of its orthologs do. It needs looking into further but it could be a false positive
SPBC336.15	N term exon may be incorrect
SPBC32F12.09	2 transcripts
SPBC32F12.11	made tdh1 primary name as we have another gpd1; NAS from Rend. Lincei Sci. Fis. Nat. 7:315-322 (1996)
SPBC32F12.15	was annotated as misc_RNA originally, before we identified SPBC32F12.15 from the Blandin paper
SPBC19C7.01	N-terminal splicing uncertain; 1st exon possibly at 441..466
SPBC19C7.03	glucose insensitive transcription
SPBC19C7.05	possible RNA binding
SPAP19A11.05c	WARNING: Not sure why but this chromosome 2 gene has got a chromosome 1 systematic ID. I added the SPBP19A11.05c as a synonym for searching, but don't want to change the systamtic ID as it will probably be more confusing
SPBP4H10.17c	was originally thought to be a ribosomal protein (ISS)
SPBC1703.02	YML127W is similar at the C-terminus but has no ARID domain
SPBC1703.04	non-consensus branch site in second intron
SPBC1703.07	Direction of reaction forming acetyl-CoA and oxaloacetate (PMID:10794176)
SPBC2A9.13	identified by confirmed intron
SPBC2D10.13	GO:0000184, NAS from PMID: 17984081
SPBC2D10.16	gene structure uopdated 007-01-08, which identified homology
SPBC2D10.19c	confirmed by est
SPBC15D4.02	trimmed N terminal 28.10.03; looked overextended as large low complexity region in front in zinc finger which is usually N-term; alignment looks better
SPBC15D4.09c	candidate for met3, but not proven experimentally; pers. comm. Juerg Kohli
SPBC15D4.10c	Aberrent Microtubules when Overexpressed
SPBC15D4.12c	possibly merged to SPBC15D4.13c but can't identify correct splicing
SPBC13E7.02	domain combination does not usually co-occur, check sequence
SPBC13E7.05	large N-terminal extension
SPBC30D10.17c	not glucan synthase EC 2.4.1.34 as reported in SW:GS1_NEUCR
SPBC30D10.16	splicing possibly incorrectly predicted
SPBC1778.02	sequence updated: 22.05.01. N-terminal exon added Yasushi Hiraoka, pers comm
SPBC1778.05c	has transcript profile on microarray
SPBC4C3.07	was incorrectly annotated as COP9/signalosome complex, updated 8 Sept 2000, (PMID 15904532)
SPBC4C3.06	NAS GO annotation inferred from S. cerevisiae orthologs genetic interactions with profilin
SPBC776.02c	double mutant dis2delta/sds21delta lethal; phosphorylation site: T316 cdc2 kinase in vitro (PMID: 795709)
SPBC776.14	Pombe LRO 1 Homolog 1
SPBC776.18c	mitotic catastrophe suppressor (pers. comm. R Fisher)
SPBC21.03c	NOTE this is s-adenosyl l-homocysteinhydrolase in bacteria; splicing may be incorrect
SPBC21.07c	N-terminal prediction possibly incorrect
SPBC25H2.10c	new gene prediction (changed N terminal exon to give different donor, and canged acceptor for 2nd exon) removed stop codon from translation, status changed from pseudo to coding (V.W 15.03.2004)
SPBC25H2.09	PSORT 87.0 %: nuclear, 8.7 %: mitochondrial, 4.3 %: cytoplasmic
SPBC25H2.02	Has been mapped to YIL078W rather than YKL194C due to same domain combinations
SPBC20F10.04c	2 N-terminal exons replaced with better exons, C-terminal exon truncated and two extra C-terminal exons added according to EMBL entry AB158548; Hypomorphic allele causes DNA segregation defects and sensitivity to DNA damaging agents (pers comm M. Boddy)
SPBC17D1.04	Accumulation of Condensin at RDNA (name_derivation)
SPBC17D1.06	N-terminal may need truncating; used to have code SPCC17D1.06 (typo)
SPBC11C11.01	first two predicted exons are tentative - may use internall Met at base position. 18530
SPBC3B8.11	ortholog for S. cerevisiae RRN6, alignment will be in next Pfam release
SPBC3B8.06	overlaps two S.cerevisiae hypotheticals - putative mis-prediction in S. cer ChrIII region), similar (at N-term) eg. to YCR061W, similar (at C-term) eg. to YCR062W
SPBC4B4.12c	previously annotated as dubious, but has localization signal
SPBC2G2.01c	involved in cell division when ribonucleotide reductase is inhibited (PMID 9950674)
SPBC2G2.04c	sequence possibly needs truncating to second met
SPBC1718.02	splicing at 3rd exon possibly incorrect
SPBC1718.03	lysine (K) and glutamic acid (E) Rich protein
SPBC1718.07c	Multicopy suppressor of Overexpressed Cyr1
SPBPB7E8.01	NOTE: zinc metallopeptidase is tanetative, below threshold
SPBPB7E8.02	S. cerevisiae PSP1 suppresses temperature sensitive mutations in DNA polymerase alpha
SPBC1105.09	Note ubc15 is truncated with respect to YDR054C
SPBC1105.13c	has transcript profile on microarray
SPBC887.04c	NASA from PMID: 16705165 not yet annotated at SGD
SPBC16D10.01c	transcriptional coregulation predicts a role in ribosome biogenesis for S. cerevisiae ortholog, which is supported by nueceolar localization, however S. cerevisie interaction data indicates a connection to glycolysis
SPBC16D10.03	pombe glycoprotease 2 (PMID 11115118)
SPBC16D10.07c	gene structure updated extended N-term by 9 amino acids, moved 1st splice site downstream by 15 bases (PMID 15545655)
SPBC16D10.10	overlap AT THE C TERMINAL
SPBC317.01	Mads BoX protrein 2
SPBP8B7.16c	large 3' intron like S. cerevisiae DBP2
SPBP8B7.27	first exon may be incorrect
SPBC13G1.14c	uncertain translation start point
SPBC13G1.06c	this gene product was previously annotated to the NADH dehydrogenase of the mitochondrial respiratory chain complex I, this mapping was removed due to lack of the remaining 40 subunits found in mammals (PMID:1518044)
SPBC31F10.08	mei4-dependent expression 2
SPBC31F10.13c	HIRA in S. pombe 1
SPBC31F10.14c	HIRA interacting protein 3
SPBC21C3.06	questionable ORF
SPBC21C3.11	note PSI Blast shows conserved N-terminal region, needs Pfam submission
SPBC21C3.17c	homology to YKL077W is low but has conserved residues by multiple alignment, conserved N-terminal signal peptide and C-terminal transmenbrane helix
SPBC21C3.20c	glucose insensitive transcription
SPBC23E6.09	recruited by sequence-specific DNA-binding proteins (predicted)
SPBC211.01	this is reported to be mitochondrial...but maybe it is really cytoplasmic?
SPBC211.06	possibility of internal splice but predicted intron has poor score, and homology not improved; Gcp Four Homolog
SPBC1604.17c	coordinates updated 29/4/2002 previous coordinates (8945..8971,9475..10455,10528..10851) VW
SPBC1604.12	multiple TSS
SPBC26H8.01	Match to PF01946 Thi4, Thi4 family Score 628.69
SPBC26H8.05c	possible intron between 145 21,14639 would improve homology slightly, but has no good acceptor, and insertions are present at this position
SPBC26H8.16	derived from SPNG1907-08
SPBC26H8.09c	repeat consensus HHDNSNKESTNLDDLNMLEEPK
SPBC26H8.10	does not bind GeneDB_Spombe:SPBC776.02c PMID 1944266
SPBC32C12.02	the equivalent function in S. cerevisiae is performed by STE12, but this is STE-like not HMG
SPBC3B9.08c	non-consensus gc donor
SPBC3B9.09	possible additional N-terminal exon
SPBC215.03c	N-terminal exon possibly incorrect
SPBC215.04	glucose insensitive transcription; term=related to S. cerevisiae YJR086W but not functional ortholog; date=19700101
SPBC1347.03	possibly a protein kinase inhibitor as related to S. cerevisiae LSP1 and PIL1
SPBC1347.05c	new C-terminal exon 11 Oct 2002
SPBC1347.08c	orthology predicition, pers comm C. Chahwan
SPBC56F2.07c	NAS from PMID:17646390, not yet annotated at SGD
SPBC56F2.14	added 20.03.2004, found by targeting ortholog of MRP144 TBLASTN; 100 aa but spliced so missed initially
SPBC1861.08c	splice donor sequence is incorrect (not GT) homology shows that position of intron is correct but cosmid sequence has good coverage in this region. This region will be checked by sequencing PCR products primed from genomic DNA
SPBC14F5.07	Added the human name because the yeast name Ssm4 is already used in S. pombe
SPBC342.01c	initially annotated as hypothetical protein but no Met or homology in adjoining cosmid
SPBC342.06c	this may have broader species conservation which has not yet been detected
SPBC16G5.08	assignment made from mapping data
SPBC16G5.11c	budding yeast presumed ortholog YIL016W does not have N-terminal ubiquitin domain
SPBC16G5.13	was previously annotated as dubious
SPBC16G5.19	was previously annotated as dubious
SPBC16A3.18	Csx1-interacting protein 1
SPBC16A3.16	was previusly annotated as cwc27 in error
SPBC16A3.13	260 residue sequence containing 9 1/2 highly similar repeats; large repeat insertion potential glycosylation sites
SPBC16A3.09c	ubiquitin fusion degradation protein-1 (predicted)
SPBC16A3.03c	Late cYtokiNesis 1
SPBC16C6.14	gene created from C-tem of SPBC16C6.02c; Spo2 is recruited to the SPB during meiosis and assists in the localization of Spo13 to the outer surface of the SPB
SPBC16C6.09	O-glycoside mannosyltransferase 4
SPBC244.01c	Septum Initiation Defective
SPBC1289.03c	Supressor of PIm
SPBC1289.09	Translocase of the Inner Membrane
SPBC1289.15	26 copies of a 35 amino acid repeat
SPBC1289.16c	no amine oxidase activity detected when expressed in S. cerevisiae PMID:16946276
SPBC8E4.03	NAS from Biocyc pathway hole filling
SPBPB2B2.07c	altered coordinates based on Solexa transcript SPNG2000, added exon 4474145..4474403
SPBPB2B2.11	appears to be part of a galactose metabolism cluster
SPBPB2B2.18	There is a region which is duplicated in PB2B2 which is represented by the ORF SPBPB2B2.18 although the similarity is not very high...the predicition looks odd. The exon structure is not typical. There is also a region which is duplicated at the DNA level in c750 which is not incorporated into the prediction.
SPAC212.04c	repeat expansion SQRSQRS
SPAC212.03	has transcript profile on microarray
SPAC212.02	has transcript profile on microarray
SPAC212.01c	repeat expansion SQRSQRS
SPAPJ695.01c	possibly not coding, may be a spurious ORF
SPAC1F8.05	may not be protein coding (strange AA composiition and GC plot)
SPAC11D3.04c	has transcript profile on microarray
SPAC5H10.01	annotated to mitochondria based on Pence subcellular location mitochondria 99.938%
SPAC5H10.07	has EST
SPAC5H10.08c	possibly coexpressed with SPAC5H10.09c which is also involved in pantothenate biosynthesis
SPAC5H10.09c	possibly coexpressed with SPAC5H10.08c which is also involved in pantothenate biosynthesis
SPAC13G6.13	was previously annotated as dubious in error
SPAC24B11.10c	possibility of splicing at 3' end but extra exon (20311..20497) doesn't improve homology; Chs Four Homologue (pers. comm. Henar Montero)
SPAC24B11.11c	Septum Initiation Defective
SPAC24B11.14	added 3-9-99; neither intron was detected in transcriptome data, unlikely to be coding
SPAC806.02c	gene structure confirmed (pers. comm. Ryo Hanai); in S. cerevisiae, both genes are involved in iron sulfur cluster assembly
SPAC1F5.11c	possibly lacks protein kinase activity; not detected in SAGA (pers. comm. Dom Helmlinger)
SPAC1F5.05c	has EST
SPAC18B11.10	a number of genes are differentially affected by mutations in tup11 and tup 12 in response to cation stress (PMID 156320722)
SPAC12G12.15	GO:0005515 and GO:0005816 pers. comm. Osami Niwa; NAS inferred
SPAC12G12.03	Csx1-interacting protein 2 (PMID 16407405)
SPAC630.04c	was previously annotated as dubious
SPAC630.15	has transcript profile on microarray; poor correlation score
SPAC630.14c	a number of genes are differentially affected by mutations in tup11 and tup 12 in response to cation stress (PMID 15632072)
SPAC1751.02c	initiation is possibly at second Met, and upstream splicing possiply in 5' UTR
SPAC1751.03	was incorrectly annotated as COP9/signalosome complex, updated 8 Sept 2000, (PMID:15904532)
SPAC31A2.15c	S. cerevisiae YCL016C reciprocal best hit, conserved residues from PMID 12766176
SPAC13C5.02	Defect in REreplication 4 (PMID:15466421)
SPAC23E2.02	S. pombe SPBC146.09C has no HMG box
SPAC24H6.01c	NAS from PMID:16597698, not yet amnnotated at SGD
SPAPB21F2.03	confirmed intron
SPAC227.19c	some fungal orthologs seem to be longer, but this small C-terminal region is conserved
SPAC227.03c	NAS from PMID:16291748
SPAC227.14	uridine kinase PRINTS false positive
SPAC2F7.06c	A template-instructed polymerase with preference for purines which combines properties of mammalian DNA polymerase beta, mu and lambda (PMID 16120966)
SPAC13A11.02c	source of the name cyp51 unknown
SPAC13A11.03	meiotically upregulated gene Mug32
SPAC1F3.06c	possible ortholog of S. cerevisiae SPO21
SPAC1F3.09	NOTE:corresponding transcript SPD244 is framshifted w.r.t this sequence; it also does not use the two final predicted splice sites; however this prediction shows reasonable homology to yeast YGR093W in this region and hence has been kept; it is possible this locus displays alternative splicing, or SPD244 is incompletely spliced
SPAC22F3.13	deletion mutant defective in conjugation (PMID 12136010)
SPAC22F3.11c	possibly missing N-terminal exons; term=frameshifted; date=20090202; PMID:16823372 predict a frameshift at base 124
SPAC22F3.03c	09.05.03 4th exon extended by altering intron 3 acceptor (cosmid coordiantes 34092->33923) (PMID 14551247); double mutant with rhp54 does not sporulate (PMID 14551247); double mutant with rhp54 does not arrest meiotic progression (PMID 14551247)
SPAC1296.04	2 N-terminal exons added 28-5-2002; similarity is *very low* but they are reciprocal best hits, also both seem to contain novel dysferlin-C terminal domain
SPAC2G11.05c	NAS to endosome inferred from PMID: 16407402
SPAC2G11.07c	protein phosphatase 2c homolog 3
SPAC23G3.02c	possible FRAMESHIFT; base-check of problem region in progress
SPAC23G3.07c	candidate ortholog for S. cerevisiae YDR073W (SNF11)
SPAC222.09	SEven Binding
SPAC222.15	originally annotated as a pseudogene because the third intron has a GAG acceptor, in 2 independently sequenced cosmids. But has Meiosis specific transcript disruption of which causes defect in meiosis (pers. comm. Y. Hiraoka)
SPAC821.07c	Multicopy suppressor of Overexpressed Cyr1
SPAC139.06	PMID:17052979 is pending curation
SPAC23C4.04c	intron confirmed by Solexa transread data
SPAC23C4.06c	protein family submitted ISS to be added later
SPAC23C4.18c	Defect in REreplication 4 (PMID:15466421)
SPAC1A6.05c	NAS from PMID:16135509
SPAC30D11.14c	involved in mRNA splicing (pers. comm. J.A. Potashkin)
SPAC30D11.07	deletion mutant sensitive to MMS (PMID 12675805)
SPAC30D11.02c	previously annotated as dubious, but has localization signal; under 100 amino acid threshold
SPAC56F8.08	N terminal exon possibly incorrect; possibly spliced upstream to SPAC56F8.11c
SPAC56F8.10	possibly allelic with met5 (correct map position but mutant not sequenced)
SPAC56F8.14c	has expression profile on microarray in otherwise apparently gene free region
SPAC22A12.02c	has transcript profile on microarray
SPAC22A12.07c	O-glycoside mannosyltransferase 1
SPAC22A12.16	Direction of reaction forming acetyl-CoA and oxaloacetate (PMID:10794176)
SPAC56E4.04c	due to absence of mitochondrial signal sequence found on S. cerevisiae YMR207C (PMID:14761959) this protein was only annotated to the cytosol
SPAC56E4.05	NOTE:may not be spliced
SPAC1420.03	expression level is tightly controlled so that deletion of either copy is compensated (PMID 12783882)
SPAC1420.04c	pre-rsm22-cox11
SPAPB17E12.08	gene structure updated to improve homology 12/12/06
SPAC1565.03	has transcript profile on microarray
SPAC6F12.03c	fission yeast syntaxin homolog required for vacuolar sorting and fusion
SPAC6F12.10c	inferred from map position
SPAC6F12.13c	Fps1 appears to have YJL167W has retained the functions YPL069C, Spo9 (Fps1 paralog) appears to have farnesyltransferase like S. cerevisiae BTS1 YPL069C which does not have a direct ortholog in fission yeast
SPAC6F12.14	mutant (cut23-194) is sterile; mutant (cut23-194) is blocked at metaphase
SPAC6F12.15c	Defect in REreplication 1 (PMID:15466421)
SPAC19E9.01c	(NAS = pers comm Osami Niwa)
SPAC57A10.14	identified in targeted search for ortholog of S. cerevisiae SGF11, 23 jan 2005
SPAC57A10.06	has transcript profile on microarray
SPAC57A10.08c	NOTE: C-term exons may not be real
SPAC57A10.12c	S. cerevisiae ortholog is cytoplasmic PMID:1409592
SPAC20G8.01	nuclear form is initiated from codon 20 (PMID 14752051)
SPAC3A12.03c	meiotic expression upregulated
SPAC3A12.19	identified in targetted search for YBR282W ortholog 25-09-04
SPAC9.03c	PMID: 16133344 is pending full curation
SPAC9.09	accummulation of homocysteine causes a defect in purine biosynthesis (PMID 16436428)
SPAC9.10	the functionally complementing transporters are not orthologous
SPAC5D6.02c	chromatin association inferred from composition, localization and low similarity to transcriptional regulators
SPAC57A7.09	human r31343_1 has the same domain combiantion
SPAC57A7.04c	pab1 used previously by SPAC227.07c
SPAC23H4.18c	pop-interacting protein 1
SPAC23H4.16c	possibly broadly conserved (to human), possible conserved motif QAFCI at C term
SPAC23H4.13c	nonconsensus branch
SPAC23H4.08	confirmed intron; 4 predicted exons
SPAP27G11.10c	Sequence differs at C-term to Q9Y8G4, EM:AF055035
SPAP27G11.16	previously annotated as dubious, but has localization signal
SPAC343.04c	was incorrectly annotated as gnr1
SPAC343.11c	Multi-copy Suppressor of Chk1 PMID:15082762
SPAC343.20	has transcript profile on microarray, but appears to be antisense RNA to SPAC343.12
SPAC343.14c	possibility of internal splice between 33743..33820 which improves homology in alignment
SPAC824.04	swd2.2; S. pombe paralogues are functionally diverged, S. cerevisiae YKL018W is a member of both CPF and SET1 complex (PMID 14617822)
SPAC664.10	first exon possibly incorrect; may use MKLNFSNTLQYPHVFGEKEK as alternative first exon
SPAC664.13	previously annotated as dubious
SPAC105.01c	name from PMID 9428701
SPAC17A5.02c	we predict different C-terminal
SPAC17A5.09c	conserved WDE*N.*MK**EP*TP[FY]
SPAC17A5.10	possily DNAJ needs checking**
SPAC17A5.12	possibly needs N-terminal truncating
SPAC17A5.15c	Probably cytoplasmic as the mitochondrial glutamate- tRNA ligase has been identified (SPAPB1A10.11C)
SPAC1610.03c	prediction updated 24.1.2001, to change exon 3 start from 3828 to 3777 to comform with crp 79 submission, now has good branch site
SPAC1610.04	localization was additionally determined through the presence of CCCTCTC downstream sequence significantly overrepresented in mitochondrial proteins
SPAC1002.03c	GLucoSidase II
SPAC1002.07c	human homolog SAT is a Spermidine/spermine N1-acetyltransferase which catalyzes rate-limiting step in polyamine catabolism
SPAPB1A10.03	this gene structure was altered based on Solexa transcript data. This resulted in a gene split with the final exon creating a new CDS SPAPB1A10.16
SPAPB1A10.16	this CDS feature was created from what was previouly the C-term exon of SPAPB1A10.03/Nxt1
SPAC3H1.04c	PMID:16823372 predict a frameshift at base 1684, unconfirmed
SPAC9G1.06c	NAS annotation pers. comm. Matthew Lord and Thomas D. Pollard
SPAC9G1.09	Septum Initiation Defective
SPAC17H9.03c	highly conserved region A L/F M M * L * R K/E C/L R/K IL* R D/K L/F * L/M/V A V **************KPAL with vertebrate Trad
SPAC17H9.05	TAS Osami Niwa
SPAC17H9.20	sequence updated from PMID: 16207082 added intron at 37250..37297 date=20051010
SPAC3C7.14c	this does not appear to be a histone fold as published in (PMID:7929079); Note:PMID: 12073089 does not refer to this apt1
SPAC20H4.10	possibly overpredicted at the N-terminal exon; ubiquitin fusion degradation protein-2
SPAC23C11.07	has transcript profile on microarray
SPAC23C11.10	18/6/2002 added 3 additional C-terminal exons
SPAC1783.05	Helicase-Related Protein from S. Pombe
SPAC1783.07c	caf3-89 Leu->Ser disrupts nuclear export signal (PMID 14758541)
SPAC18G6.02c	CHromodomain Protein 1
SPAC18G6.04c	possibly spliced at 5' end (9288..10667, 10814..10897)
SPAC18G6.13	previously annotated as dubious, but has localization signal
SPAC4G9.20c	may use upstream Met with alternative intron
SPAC4G9.22	WARNING: This may be a non-coding RNA, longest ORF in Solexa transcript
SPAC6C3.03c	previously annotated as dubious, may not be protein coding
SPAC17G8.01c	overlaps and extends orf SPAC6C3.09c which has similar to tRNA ligase, no met initiation codon near 5' end in this frame and splicing uncertain
SPAC17G8.03c	Dpb3p may be important for establishing or maintaining normal localization of Dbp4p (PMID 15388803); SPAC17G8.03c was annotated as similar to its top Blast hit S. cerevisiae YER159C, but its functional ortholog is YBR278W and the full length alignment is better
SPAC17G8.13c	functional studies suggest that Mst2 is functionally more similar to S. cerevisiae Sas2 than Sas3
SPAC6B12.04c	no other genes of the kynurenine pathway (de novo synthesis of NAD+ from tryptophan) can be identified in S. pombe the arylformamidase activity molecular function was not included in the annotation inferrence.
SPAC6B12.06c	02-04-2004 deleted Adenine at 13981, extended gene prediction from 64 aa to 117 AA
SPAC6B12.08	NAS from PMID:17242366
SPAC6B12.14c	previously annotated as dubious, may not be protein coding
SPAC6B12.16	conserved KTS*YWYHMN**HGI*SKG
SPAC32A11.01	possible alternative for first splice donor sequence at 418 (gtatgg); orthology prediction, reciprocal Blast and PSI Blast (pers. comm. Maria Novatchkova)
SPAC32A11.03c	Pombe HomeoboX
SPAC4A8.05c	myosin-3 isoform
SPAC4A8.08c	assigned mitochondrial location due to presence of presequence similar to that found on S. cerevisiae YGR094W, used to direct protein to the mitochondria
SPAC4A8.09c	annexin v-binding protein?
SPAC4A8.11c	primary name changed to fas2 and synonym to lsd1 date=20061024
SPAC4A8.14	prs1 is the primary name for SPBC19C7.06 using unified nomenclature for tRNA ligases
SPAC823.02	confirmed intron
SPAC823.04	This does not agree with Solexa intron at 2587898..2587951 but can't find a better prediction
SPAC7D4.10	there are 2 different confirmed introns at 3' which would give slightly different products; possible alternative splice for C-term, have 2 different confirmed introns
SPAC7D4.08	previously annotated as dubious, but has localization signal; below 100 amino acid size threshold
SPAC4F8.13c	localization dependent on actin
SPAC644.10	previously annotated as dubious, but has localization signal
SPAC644.11c	no detectable kinase domain
SPAPB2B4.07	possibly conserved in human, D. melanogaster and A. thaliana by mulitiple alignment
SPAC6F6.16c	SPAC6F6.16c and SPAC6F6.18c were merged 09-06-08
SPAC1805.01c	possible internal in-frame splice at bases 1119..2154, doesnt improve homology
SPAC1805.03c	first intron may be incorrect
SPAC1805.07c	high osmolarity sensitivity for growth protein Hos2
SPAC3F10.04	protein is cleaved to produce different subunits (PMID 12734194)
SPAC3F10.07c	previously annotated as dubious
SPAC3F10.09	possibly his6 from map position
SPAC3F10.10c	overlaps C-term of SPAC3F10.09, possibility of splicing at codon 316
SPAC8F11.03	changed splice boundary from the experimentally determined one. possible alternative splice used with low frequency, the acceptor used in this prediction has better consensus, and increases the homology when this translation is aligned with homologs
SPACUNK4.08	one of the S. cerevisiae paralogs in involved in alpha-factor maturation
SPAC513.04	previously annotated as dubious, but has localization signal
SPAC2E1P3.02c	putative splice 2531,2640 but inframe and no consensus branch
SPAPB2C8.01	3kb of 36 AA repeat
SPAC31G5.06	orthology prediction pers. comm. Charly Chahwan
SPAC1786.04	previously annotated as dubious, but has localization signal
SPAC24C9.09	Has been mapped to YKL194C rather than YIL078W due to domain combination
SPAC16A10.07c	provides a telomeric cap that prevents Ku from recognising telomeres as double strand breaks (Ku-dependent end-to-end fusions) (PMID 11172711); requires a ss telomeric overhang for T-loop formation (PMID 15383525); forms oligomeric donut structures (PMID 15383525)
SPAC589.04	metaxin 1 may be the ortholog of S. cerevisiae TOM37. multiply alignment has conserved common residues; TOM37 has a C term TMM region like many metaxin 1 family; both are mitochondrial membrane proteins involved in pre-protein import; S. cerevisiae ortholog for metaxin hasn't been identified and vice versa; can't make a Pfam family because it overlaps with glutathionine S-transferase
SPAC688.08	NOTE:first intron possibly incorrect as has no consensus branch and last exon predicted may not be correct; first intron may not be correct, possible frameshift
SPAC688.09	NAS from PMID:16043509, not yet annotated in yeast
SPAC6G9.05	alterntive start at 12302
SPAC6G9.06c	pole target of calmodulin in S. pombe Pcp1
SPAC6G9.16c	gene prediciton extended by transcript data
SPAC26A3.01	does not appear to be a yapsin (PMID 11115118)
SPAC26A3.10	SPAC26A3.09c and SPAC26A3.10 are convergent and very close, functionally related, perhaps co-regulated?
SPAC26A3.12c	CARE dph1 is in same cosmid
SPAC26A3.16	CARE dhp1 is in same cosmid
SPAC8E11.06	predicted from EST data
SPAC8E11.04c	orthologous to S. cerevisiae YLR118C; reciprocal best hit but possibly not ortholog due to probable lineage specific gene losses (is more divergent than higher eukaryotic orthologs)
SPAC959.05c	gene stucture updated; merged SPAC959.06c & SPAC959.05c, pers. comm. Charly Chahwan, splicing is tentative
SPAC3A11.05c	NAS from GO:0005816|GO:0003674
SPAC3A11.03	orthology inference via Ashbya syntenic ortholog of YJR129C
SPAC16E8.10c	extended to include potential mitochondrial signal peptide 11-08-04
SPAC16E8.18	previously annotated as dubious, but has localization signal
SPAC16E8.17c	due to inconsistencies between the annotation of the proposed S. cerevisiae ortholog LSC1 in SWISSPROT:P53598 and SGD:S0005668 succinate-CoA ligase (GDP-forming)/6.2.1.4 and succinate-CoA ligase (ADP-forming) repectively, conservatively annotated to EC 6.2.1.- and GO:0004774, succinate-CoA ligase activity
SPAC17A2.10c	previously annotated as dubious, but has localization signal; largish ORF in compositionally biased region, probably not real. has odd translation. this is in region where botton strand is T rich, so lots of LLLFFFFLLFFLSFSFSFS; see comment on SPAC17A2.11, this region is the same but inverted orientation
SPAC17A2.11	previously annotated as dubious, but has localization signal; see comment on SPAC17A2.10, this region is the same but inverted orientation; largish ORF in compositionally biased region, probably not real. has odd translation. this is in region where botton strand is T rich, so lots of LLLFFFFLLFFLSFSFSFS
SPAC17A2.13c	NOT transcription initiation factor TFIIH subunit-?
SPAC17G6.02c	WARNING: in the current viewer tco1 gene is hidden behind SPNCRNA.600 non coding transcript, to see the feature please use the Artemis or Gbrowse links
SPAC17G6.17	Pof8 F-box is very degenerate, but is detectable by sequence similarty and confirmed by Skp1 binding assay PMID:15147268
SPAC1142.08	similarity pers. comm. Richard Bulmer
SPAC8C9.06c	this homology was assigned from recipriocal blast hits
SPAC8C9.07	previously annotated as dubious
SPAC15A10.01	probably regulates cellular iron homeostasis through the transport of mitochondrially synthesised Fe/S clusters (PMID:11493598)
SPAC15A10.09c	this is not in the current release of Pfam, but should be built into SUR7 family shortly
SPAC15A10.13	aminotransferase for S. cerevisiae YOR112W looks like a false positive. see Pfam for correct inference
SPAC15A10.15	ShuGOshin 2 (Japanese meaning guardian spirit)
SPAC15A10.16	localization depends on vesicular traffic and and requires Tea1
SPAC15E1.04	SPAC15E1.04 is similar to YOR074 at the C-term, but has an N-terminal flavoprotein domain
SPAP7G5.02c	inferred from genetic map position
SPAC1556.04c	care not azr1
SPAC1556.05c	second intron branch site deviates from consensus
SPAC1F12.02c	NAS from PMID:16806052, not yet curated at SGD
SPAC1F12.08	splice prediction is tentative
SPAC4H3.04c	in some organisms this domain is present with ammecr1 which interacts with mediator complex and is implicated in transcription
SPAC4H3.12c	previously annotated as dubious, may not be protein coding; reverted to dubious based on transcriptome data 08-01-08
SPAC323.01c	splicing may be incorrect, possibly frameshift, intron unsupported
SPAC2F3.18c	ORF added after genome completion for consistency but didn't realise SPAC2F3.17c was already used by lsm6; same strand as plr48 (misc RNA)
SPAC2F3.12c	31.06.02 created from the C-terminal of SPAC2F3.13c
SPAC2F3.13c	31.06.02 split to create SPAC2F3.13c and SPAC2F3.12c
SPAC11G7.02	deletion of pub1 suppresses the mislocalization of cat1 in tsc2-delta PMID:18219492
SPAPB15E9.02c	has transcript on microarray; sequence composition
SPAC27E2.11c	possibly not coding
SPAC27E2.04c	unusual GC plot and composition; previously annotated as dubious, but has localization signal; based on transcriptome data it appears that the ORF on the opposite strand is real, so this has been changed back to dubious
SPAC27E2.12	was previously annotated as dubious but transcriptome data indicated regulated splicing
SPAC27E2.14	intron from Solexa transread data
SPAC19G12.16c	4.5 copies of 53AA repeat; consensus ATFTSSPPFYSNSSVIPTSVPSSVSSFTSSNSSYTTTLTASNTTVTFTGTGTGS; ace2 dependent gene
SPAC23A1.04c	May use an alternative initiation met at codon 32
SPAC23A1.05	previously annotated as dubious, but has localization signal
SPAC23A1.09	NAS (pers. comm. J.A. Potashkin)
SPAC26H5.02c	updated sequence to add 4th intron 2133,2174 at (changed frame of final exon) (pers. comm. Stuart MacNeill) date=20050419
SPAC26H5.04	possible in frame splice at 4123354,4123535, improved homology, but unsupproted
SPAC25B8.08	possibly conserved in metazoa also
SPAC683.03	previously annotated as dubious, but has localization signal
SPAC21E11.04	is similar to SGD:S0007536 MPR1 not found in the S288C strain
SPAC21E11.05c	seq change GAGT[G]GCA
SPAC2C4.06c	splicing possibly incorrect
SPAC2C4.11c	ribosome-nucleus export from GO:0006913 and GO:0006364
SPAC25G10.04c	orthology prediction from
SPAC27F1.10	previously annotated as dubious, but has localization signal
SPAC23D3.16	intron from Solexa transread data
SPAC29E6.03c	last exon my be incorrect; NAS needs updating when annotated in SGD
SPAC29E6.04	WARNING: The genomic sequence appears to contain an extra 'G' at position 4410193. This needs to be verified by resequencing. The presumed sequence would lead to a C-term extension to Nnf1 see PMID:17035632. This is represented in the current entry by a frameshift at 4410192, and an N terminal extension from 4410194..4410391 to give the correct translation; term=likely sequence error is represented as short intron
SPAC29E6.07	previously annotated as dubious
SPAC9E9.17c	has a good correlation score and good consensus intron; gene prediction extended 29-08-05
SPAC9E9.05	candidate ortholog of S. cerevisiae YPR171W, similarity is low but reciprocal best hits
SPAC9E9.12c	abc1 is the primary name for SPBC2D10.18
SPAC9E9.13	alternative polyadenylation sites in 3' UTR results in the production of the 3 differently sized transcripts (PMID 12207226)
SPAC17C9.15c	previously annotated as dubious, but has localization signal
SPAC17C9.05c	Pombe Mediator Component 3
SPAC27D7.09c	WARNING: the sequence previously referred to as SPAC27D7.10c was a duplication caused by missassembly of the cosmid. In future releases this region will be removed and SPAC27D7.10c will merge into SPAC27D7.09c.Therefore SPAC27D7.09c and SPAC27D7.10c refer to the same CDS
SPAC637.11	RNA processosome mitochondrial, name derivation
SPAC12B10.15c	S. cerevisiae orthology prediction pers. comm Charly Chahwan
SPAC1093.03	GAG acceptor
SPAC30C2.06c	ISS to human from PMID:17349998
SPAC144.01	confirmed intron
SPAC144.12	Pentose phosphate shunt enzymes are cytoplasmic (Bohringer Biochemical Pathways)
SPAC144.17c	phosphoglycerate mutase family is below threshold
SPAC1834.07	overexpression inhibits mitotic growth (PMID 12132578)
SPAC1782.04	ISS not annotated at SGD from PMID:16339141
SPAC22F8.03c	previously annotated as dubious, may not be protein coding
SPAC22F8.07c	gene structure updated 28-08-07 based on AJ627891
SPAC22F8.12c	orthology prediction Pers. comm. Charly Chahwan, both entries are notw in Pfam PF11488
SPAC20G4.04c	HydroxyUrea sensitive 1
SPAC20G4.09	intron from Solexa transread data
SPAC4F10.06	NOTE: the ribosome biogeneis assignment is based on a computational prediction made from cerevisiae physical interactions, but looks likely based on species distribution/copy number/localization
SPAC4F10.17	YOL109W tentative , reciprocal blast best hit, size and compositon agree
SPAC19B12.06c	22.04.2003 added exon 18153..18218
SPAPB8E5.02c	expression level is tightly controlled so that deletion of either copy is compensated (PMID 12783882)
SPAPB8E5.08	unusual nucleotide composition; previously annotated as dubious, but has localization signal
SPAPB8E5.10	candidate ortholog S. cerevisiae YJL062W-A
SPAC1B3.06c	possibly vitamin, cofactor or ergosterol metabolism
SPAC1B3.20	confirmed intron
SPAC1952.02	highly charged C-term
SPAC1952.16	rga9 proposed PMID: 14506270
SPAC890.06	possible alternative donor for 1st intron at position 10149-10154
SPAC22E12.01	similar to nucleotide-sugar transporters
SPAC22E12.08	was originally annotated as dubious due to small size, no homology, only identified by splice site
SPAC1006.01	the third S. pombe serine protease (PMID 11115118)
SPAC1006.05c	C12N15/09,C07K14/00,C07K14/39,C12N1/00,C12N1/15, C12N 1/19,C12N1/21,C12N5/10,C12N9/10,C12P21/02//(C12N15/09, C12R1 :645),(C12N1/00,C12R1:645),(C12N9/10,C12R1:645), (C12P21/02, C12R1:645),C12N15/00,C12N5/00, (C12N15/00, C12R1:645)
SPAC1250.04c	ribonuclease domain present in other eukaryotic homologs is missing
SPAC1250.07	gene added 20070412 from PMID:17409385
SPAC29A4.14c	overlaps CDS SPAC29A4.13 by 4 aa at the 3' end; 11.09.2002 added N-terminal exon
SPAC29A4.13	overlaps CDS SPAC29A4.14c by 4 aa at the 3' end
SPAC29A4.12c	has transcript profile on microarray
SPAC26F1.11	ORF in predicted gene free region with (G-C)/(G+C) strand switch; previously annotated as dubious, but has localization signal; 28-11-07, returned to dubious, has no transcript from Affeymetrix or Solexa, very unlikely to be coding
SPAC26F1.05	has transcript profile on microarray
SPAC13D1.01c	tandem with Tf2-8
SPAC19D5.11c	identified by Stuart MacNeill
SPAC19D5.10c	changed to dubious based on transcriptome data 08-01-08
SPAC14C4.06c	novel or divergent zinc finger, no family identified but similar to zf-CCCH
SPAC14C4.09	extended by 22 amino acids at N-term PMID:15194814
SPAPJ760.02c	divergent repeat containing consensus PVVPE[VA]PSVPQPP[AV][AV] (10)
SPAPJ760.03c	ace2 dependent gene
SPAC11E3.03	13.04.2003 N terminal truncated, removed exon 9067..9103, truncated from 9149 to 9211 start PMID 12689592
SPAC11E3.12	this coding sequence was previously annotated to the NADH dehydrogenase of the mitochondrial respiratory chain complex I. This annotation was removed due to lack of the other 40 subunits that are present in that complex in mammals (PMID:1518044). It is suggested that this protein may have an alternative role in fatty acid biosynthesis (PMID:1518044).
SPAP8A3.04c	possible sequencing error, 98 aa version reported (PMID:8654972)
SPAP8A3.09c	we predict MQTEN at N terminus instead of MLDNS
SPAC3G6.10c	human c11orf2
SPAC3G6.11	NAS annotations inferred by curator from PMID:16182251
SPAC29B12.08	N-term may be over-extended into 5' UTR
SPAC1039.06	S. cerevisiae YGL196W is either pseudo, or has 3 frameshifts
SPAC922.04	has transcript
SPAC922.06	YNL202W, but possibly not functional orthologs as pombe seems to be missing this peroxisomal beta oxidation pathway
SPAC869.08	protein carboxyl methyltransferase
SPAC869.07c	MEL genes are absent from S. cerevisiaie sequenced strain
SPAC869.02c	closest S. cerevisiae protein is YGR234W, but this does not appear to be a true ortholog as clustering shows closer relationship with bacterial and other fungal oxidoreductases, phyletic pattern could be a result of lineage specific gene losses or horizontal transfer in both or either organisms, although they are likely to be functionally equivalent; annotated to 1.14.12.17 from similarity to FHP_CANNO, but could be 1.7.99.7 reverse reaction